TABLE 1

Primers used to generate individual viral protein-expressing plasmids

PrimerSequence (5′–3′)a
GP2FACTAAGCTTATGGATTACAAGGATGACGACGATAAGAAATGGGGTCTATGCAAAGCCT
GP2RTATCTCGAGTCACCATGAGTTCAAAAGAAAAGTT
GP3FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGCTAATAGCTGTACATTCCTCC
GP3RTATCTCGAGCTATCGCCGTGCGGCACTGAGAACT
GP4FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGCTGCGCCCTTTCTTTTCCTCT
GP4RTATCTCGAGTCAAATTGCCAGTAGGATGGCAAAA
GP5FTAAGGTACCATGGATTACAAGGATGACGACGATAAGATGTTGGGGAAGTGCTTGACCGCGT
GP5RCACTCTAGACTAGAGACGACCCCATTGTTCCGCT
MFCCGCTCGAGATGGATTACAAGGATGACGACGATAAGATGGGGTCGTCTCTAGACGACTTCT
MRCGCGCGGCCGCTTATTTGGCATATTTAACAAGGTTT
NFGCGAAGCTTATGGATTACAAGGATGACGACGATAAGCCAAATAATAACGGCAAGCAGC
NRGCGGAATTCTCATGCTGAGGGTGATGCTGTGGCG
Nsp1FACTAAGCTTATGGATTACAAGGATGACGACGATAAGTCTGGGATACTTGATCGGTGCA
Nsp1RTATCTCGAGGTACCACTTATGACTGCCAAACCGG
Nsp1αFACTAAGCTTATGGATTACAAGGATGACGACGATAAGTCTGGGATACTTGATCGGTGCA
Nsp1αRTATCTCGAGCTGCGGGAGCGGCAGGTTGGTCAAC
Nsp1βFACTAAGCTTATGGATTACAAGGATGACGACGATAAGAGGCCCAAACCTGAGGACTTTTGCC
Nsp1βRTATCTCGAGGTACCACTTATGACTGCCAAACCGG
Nsp2FTAAGGTACCATGGATTACAAGGATGACGACGATAAGGGTGCTGGAAAGAGAGCAAGAAGAA
Nsp2RCACTCTAGAGCCCAGTAACCTGCCAAGAATGGCA
Nsp3FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGGGCACGCTACATCTGGCACTTTT
Nsp3RTATCTCGAGCTCAAGGAGGGACCCGAGCTGAGAC
Nsp4FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGCGCTTTCAGAACTCAAAAGCCCT
Nsp4RTATCTCGAGTTCCAGTTCGGGTTTGGCAGCAAGC
Nsp5FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGAGGCCTTTCCACAGTTCAACTTC
Nsp5RCACTCTAGACTCGGCAAAGTATCGCAAGAAGAAA
Nsp6FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGAAAGTTGAGGGAAGGGGTGTCGC
Nsp6RCACTCTAGACTCATGACTCATCCCGCAGGATTGCGACACCCCTT
Nsp7FACTAAGCTTATGGATTACAAGGATGACGACGATAAGTCGCTGACTGGTGCCCTCGCCATGA
Nsp7RCACTCTAGATTCCCACTGAGCTCTTCTATTCTCG
Nsp8FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGCCGCCAAGCTTTCCGTGGAGCAAG
Nsp8RCACTCTAGAGCAGTTTAAACACTGCTCCTTAGTC
Nsp9FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGTTTAAACTGCTAGCCGCCAGCGGC
Nsp9RTATCTCGAGCTCATGATTGGACCTGAGTTTTTCC
Nsp10FCCGCTCGAGATGGATTACAAGGATGACGACGATAAGGGGAAGAAGTCCAGAATGTGCGGGT
Nsp10RCGCGCGGCCGCTCATTCCAGGTCTGCGCAAAT
Nsp11FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGGTCGAGCTCCCCGCTCCCCAAGG
Nsp11RTATCTCGAGTTTCAAGTTGAAAATAGGCCGTCTTG
Nsp12FACTAAGCTTATGGATTACAAGGATGACGACGATAAGGGCCGCCATTTTACCTGGTATCAAC
Nsp12RTATCTCGAGATTCAGGCCTAAAGTTGGTTCAATG
  • a The genomic positions of the primers were based on the sequence under GenBank accession number HQ315835. The restriction enzyme sites used for cloning are underlined. The N-terminal Flag tag sequence in the “F” primers is shown in bold.