TABLE 2

Primers used for construction of the CD83 promoter, N protein, and nsp10 mutants

PrimerSequence (5′–3′)a
pCD83FTAAGGTACCCTCATATCTTTGATTTAATAGGAGA
pCD83RACTAAGCTTAGGGCAAGTCCACAGCCTCCGAACA
ORF7SFGCGAAGCTTCACCATGGATTACAAGGATGACGACGATAAGATGGGGTCGTCTCTAG
ORF7SRGCGGAATTCCATCATGCTGAGGGTGATGCT
ORF7tSRGCGGAATTCCATCACACAGTATGATGCGTCGGCAAACT
C23ASFCAGCCAGTCAATCAGCTGGCCCAAATGCTGGGTAAGATC
C23ASRGATCTTACCCAGCATTTGGGCCAGCTGATTGACTGGCTG
C75ASFCCTAGTGAGCGGCAATTGGCTCTGTCGTCGATCCAGACT
C75ASRAGTCTGGATCGACGACAGAGCCAATTGCCGCTCACTAGG
C90ASFAATCAGGGCGCTGGAACTGCTACCCTGTCAGATTCAGGG
C90ASRCCCTGAATCTGACAGGGTAGCAGTTCCAGCGCCCTGATT
K10-4ASFGGCAAGCAGCAAGCGGCAGCGGCGGGGAATGGCCAGCCA
K10-4ASRTGGCTGGCCATTCCCCGCCGCTGCCGCTTGCTGCTTGCC
Q33-5ASFGTAAGATCATCGCTCAAGCAGCCGCGGCCGCAGGCAAGGGACCGGGG
Q33-5ASRCCCCGGTCCCTTGCCTCTGGCCGCGGCTGCTTGAGCGATGATCTTAC
K43-5ASFGGCAAGGGACCGGGGGCGGCGGCTGCGGCGACAAAACCGGA
K43-5ASRTCCGGTTTTGTCGCCGCAGCCGCCGCCCCCGGTCCCTTGCC
P56-4ASFGGAGAAGCCCCATTTCGCTGCAGCGGCTGAAGATGACGTCAG
P56-4ASRCTGACGTCATCTTCAGCCGCTGCAGCGAAATGGGGCTTCTCC
E60-5ASFCATTTCCCTCTAGCGACTGCAGCTGCCGCCGCGCATCACTTTACCCCT
E60-5ASRAGGGGTAAAGTGATGCGCGGCGGCAGCTGCAGTCGCTAGAGGGAAATG
H65-4ASFACTGAAGATGACGTCAGGGCTGCCGCTGCCCCTAGTGAGCGGCAATTG
H65-4ASRCAATTGCCGCTCACTAGGGGCAGCGGCAGCCCTGACGTCATCTTCAGT
V112-4ASFTTGCCGACGCATCATACTGCGGCTGCGGCCCGCGCCACAGCATCACCCT
V112-4ASRAGGGTGATGCTGTGGCGCGGGCCGCAGCCGCAGTATGATGCGTCGGCAA
Q33ASFAAGATCATCGCTCAAGCAAACCAGTCCAGAGG
Q33ASRCCTCTGGACTGGTTTGCTTGAGCGATGATCTT
N34ASFATCATCGCTCAACAAGCCCAGTCCAGAGGCAA
N34ASRTTGCCTCTGGACTGGGCTTGTTGAGCGATGAT
Q35ASFATCGCTCAACAAAACGCGTCCAGAGGCAAGGG
Q35ASRCCCTTGCCTCTGGACGCGTTTTGTTGAGCGAT
S36ASFGCTCAACAAAACCAGGCCAGAGGCAAGGGAC
S36ASRGTCCCTTGCCTCTGGCCTGGTTTTGTTGAGC
R37ASFGCTCAACAAAACCAGTCCGCAGGCAAGGGACCGGG
R37ASRCCCCGGTCCCTTGCCTGCGGACTGGTTTTGTTGAGC
43ASFGGCAAGGGACCGGGGGCGAAAAATAGGAAGACA
43ASRTGTCTTCCTATTTTTCGCCCCCGGTCCCTTGCC
44ASFAAGGGACCGGGGAAGGCAAATAGGAAGACAAAA
44ASRTTT TGT CTT CCT ATT TGC CTT CCC CGG TCC CTT
45ASFGGACCGGGGAAGAAAGCTAGGAAGACAAAACCG
45ASRCGGTTTTGTCTTCCTAGCTTTCTTCCCCGGTCC
46ASFCCGGGGAAGAAAAATGCGAAGACAAAACCGGAG
46ASRCTCCGGTTTTGTCTTCGCATTTTTCTTCCCCGG
47ASFGGGAAGAAAAATAGGGCGACAAAACCGGAGAAG
47ASRCTTCTCCGGTTTTGTCGCCCTATTTTTCTTCCC
H65ASFGAAGATGACGTCAGGGCTCACTTTACCCCTAG
H65ASRCTAGGGGTAAAGTGAGCCCTGACGTCATCTTC
H66ASFGATGACGTCAGGCATGCCTTTACCCCTAGTGA
H66ASRTCACTAGGGGTAAAGGCATGCCTGACGTCATC
F67ASFGACGTCAGGCATCACGCTACCCCTAGTGAGCG
F67ASRCGCTCACTAGGGGTAGCGTGATGCCTGACGTC
T68ASFGTCAGGCATCACTTTGCCCCTAGTGAGCGGC
T68ASRGCCGCTCACTAGGGGCAAAGTGATGCCTGAC
V112ASFCGACGCATCATACTGCGCGTCTGATCCGCGC
V112ASRGCGCGGATCAGACGCGCAGTATGATGCGTCG
R113ASFACGCATCATACTGTGGCTCTGATCCGCGCCAC
R113ASRGTGGCGCGGATCAGAGCCACAGTATGATGCGT
L114ASFCATCATACTGTGCGTGCGATCCGCGCCACAGC
L114ASRGCTGTGGCGCGGATCGCACGCACAGTATGATG
I115ASFCATACTGTGCGTCTGGCCCGCGCCACAGCATC
I115ASRGATGCTGTGGCGCGGGCCAGACGCACAGTATG
Nsp10FCCGCTCGAGATGGGGAAGAAGTCCAGAATGTGCGGGT
Nsp10RCGCGCGGCCGCTCACTTATCGTCGTCATCCTTGTAATCTTCCAGGTCTGCGCAAAT
Nsp10-1023RCGCGCGGCCGCTCACTTATCGTCGTCATCCTTGTAATCCACATCAAATGTGGCGCC
Nsp10-723RCGCGCGGCCGCTCACTTATCGTCGTCATCCTTGTAATCTTTACTGAGAAGCCTCAA
Nsp10-451FCCGCTCGAGATGCCCGGTGCTGGGAAAACACACTGGC
Nsp10-549FCCGCTCGAGATGTAGGGCTTTGGGGACGTGCCGGTTT
Nsp10-649FCCGCTCGAGATGTGTCCTGGCAAGAACTCCTTCCTGG
R182-5ASFATGCTCGACATGATTGCGGCTGCGGCGGCGTGCCGGTTTAACGTT
R182-5ASRAACGTTAAACCGGCACGCCGCCGCAGCCGCAATCATGTCGAGCAT
C187-5ASFAGGGCTTTGGGGACGGCCGCGGCTGCCGCTCCAGCAGGTACAACG
C187-5ASRCGTTGTACCTGCTGGAGCGGCAGCCGCGGCCGTCCCCAAAGCCCT
P192-5ASFTGCCGGTTTAACGTTGCAGCAGCTGCAGCGCTGCAATTCCCTGCC
P192-5ASRGGCAGGGAATTGCAGCGCTGCAGCTGCTGCAACGTTAAACCGGCA
L197-5ASFCCAGCAGGTACAACGGCGGCAGCCGCTGCCCCCTCCCGTACCGGC
L197-5ASRGCCGGTACGGGAGGGGGCAGCGGCTGCCGCCGTTGTACCTGCTGG
P202-5ASFCTGCAATTCCCTGCCGCCGCCGCTGCCGCCCCATGGGTTCGCATC
P202-5ASRGATGCGAACCCATGGGGCGGCAGCGGCGGCGGCAGGGAATTGCA
P207-5ASFCCCTCCCGTACCGGCGCAGCGGCTGCCGCCTTGGCCGGCGGTTGG
P207-5ASRCCAACCGCCGGCCAAGGCGGCAGCCGCTGCGCCGGTACGGGAGGG
L212-5ASFCCATGGGTTCGCATCGCGGCCGCCGCTGCGTGTCCTGGCAAGAAC
L212-5ASRGTTCTTGCCAGGACACGCAGCGGCGGCCGCGATGCGAACCCATGG
C217-5ASFTTGGCCGGCGGTTGGGCTGCTGCCGCGGCCTCCTTCCTGGATGAA
C217-5ASRTTCATCCAGGAAGGAGGCCGCGGCAGCAGCCCAACCGCCGGCCAA
P192ASFTGCCGGTTTAACGTTGCAGCAGGTACAACGCTG
P192ASRCAGCGTTGTACCTGCTGCAACGTTAAACCGGCA
A193ASFCGGTTTAACGTTCCAGCAGGTACAACGCTGCAA
A193ASRTTGCAGCGTTGTACCTGCTGGAACGTTAAACCG
G194ASFTTTAACGTTCCAGCAGCTACAACGCTGCAATTC
G194ASRGAATTGCAGCGTTGTAGCTGCTGGAACGTTAAA
T195ASFAACGTTCCAGCAGGTGCAACGCTGCAATTCCCT
T195ASRAGGGAATTGCAGCGTTGCACCTGCTGGAACGTT
T196ASFTTCCAGCAGGTACAGCGCTGCAATTCCCTGCC
T196ASRGGCAGGGAATTGCAGCGCTGTACCTGCTGGAAC
L212ASFCCATGGGTTCGCATCGCGGCCGGCGGTTGGTGT
L212ASRACACCAACCGCCGGCCGCGATGCGAACCCATGG
A213ASFTGGGTTCGCATCTTGGCCGGCGGTTGGTGTCCT
A213ASRAGGACACCAACCGCCGGCCAAGATGCGAACCCA
G214ASFGTTCGCATCTTGGCCGCCGGTTGGTGTCCTGGC
G214ASRGCCAGGACACCAACCGGCGGCCAAGATGCGAAC
G215ASFCGCATCTTGGCCGGCGCTTGGTGTCCTGGCAAG
G215ASRCTTGCCAGGACACCAAGCGCCGGCCAAGATGCG
W216ASFATCTTGGCCGGCGGTGCGTGTCCTGGCAAGAAC
W216ASRGTTCTTGCCAGGACACGCACCGCCGGCCAAGAT
  • a The genomic positions of the primers were based on the sequence under GenBank accession number XM_001928655. The restriction enzyme sites used for cloning are underlined. The N- or C-terminal Flag tag sequence in the “R” primers is indicated by double underlining. Locations of mutations are indicated in bold.