TABLE 2

Primers used to genotype progeny isolated from mixed infections

Parental virus pairingPrimer nameaPrimer sequence
pH1N1wt plus pH1N1varNL PB2 247 FGGACAAACCCTCTGGAGCAA
NL PB2 315 RTACGGCCAGAGGTGATACCA
NL PB1 225 FCCCGATTGATGGACCACTACC
NL PB1 311 RTCAAGGAAAGCCATAGCCTCT
NL PA 313 FACAACAGGGGTAGAGAAGCC
NL PA 410 RATGTGGACTTCCCTCCGTGT
NL HA 282 FTGTGAATCACTCTCCACAGCA
NL HA 361 RCCTGGGTAACACGTTCCATTG
NL NP 309 FCCCTAAGAAAACAGGAGGACCC
NL NP 411 RTTGGCGCCAAACTCTCCTTA
NL NA 293 FCTGCCCTGTTAGTGGATGGG
NL NA 368 RGACAAACACATCCCCCTTGG
NL M 256 FACGCTTTGTCCAAAATGCCC
NL M 364 RCTTGGCCCCATGGAACGTTA
NL NS 320 FGTCACGAGACTGGTTCATGC
NL NS 389 RCTGGTCCAATCGCACGCAAA
pH1N1 plus H3N2P99 NL PB2 101 FGTGGACCATATGGCCATAAT
P99 NL PB2 187 RTCATTGCCATCATCCARTTCAT
P99 NL PB1 809 FTTTGCGAAAAGCTTGAACAG
P99 NL PB1 912 RTGTGTCTTGTGAATTAGTCATCATC
P99 NL PA 601 FCAGTCCGAAAGAGGCGAAG
P99 NL PA 755 RCCCTCAATGCAGCCGTTC
P99 NL NP 161 FCTACATCCAAATGTGCACTG
P99 NL NP 270 RCTTCTCTCATCAAAAGCAGA
P99 NL M 145 FGGCTCTCATGGAATGGCTAA
P99 NL M 258 RCGTCTACGCTGCAGTCCTC
P99 NL NS 539 FTGAGGATGTCAAAAATGCA
P99 NL NS 639 RTTCTCCAAGCGAATCTCTGT
P99 HA 802 FATTGCTCCTCGGGGTTACTT
P99 HA 926 RGGTTTGTCATTGGGAATGCT
P99 NA 408 FATCAATTTGCCCTTGGACAG
P99 NA 517 RTGGAACACCCAACTCATTCA
NL HA 345 FGGAACGTGTTACCCAGGAGA
NL HA 459 RGATTGGGCCATGAACTTGTC
NL NA 296 FCCCTGTTAGTGGATGGGCTA
NL NA 397 RGGGGAGCATGATATGAATGG
  • a F, forward; R, reverse.