TABLE 1

Primers used for qPCR and qRT-PCR

GeneOrientationaSequence (5′-3′)Product size (bp)
ORF61FACATCCCTGCGTTGTCTTT172
RTTGAGGTGGTTTCTGGTCTTA
ORF62FATGTGGTTTCCAAGGCCAAGAG101
RTCCGTCAAGTGGCATCGTTATT
ORF63FCTTCAACCCACCCAGACGC206
RGAATCCCGAAATTCAATTACATCC
ORF5FGGGATATTAACTCACAGG192
RAAACCGCTATTTCTACAC
ORF6FGAGGGCTTCTAATGGAGTT129
RCAAAGTGGTCGTACTGGTT
ORF8FATTTGACGGCGAGTTTGAT215
RCCAACGGAGTTATTGATGC
ORF9AFAACTTTGCAGAACGGAATT130
RCTAACGAAATAAGGGCTAC
ORF14FTACCGCCGAAACATAACT154
RGACATACGCAGCCTACTG
ORF23FGCCGAGACTGACCCTATGACA116
RCCCGAGATTCCCAAACTCAT
ORF29FGGGTTACGTTTATGCGTGCCG245
RCTCCGTGAAAGACAAAGACAGATGG
ORF31FGCCGTGGGATTATTGGTTT168
RAGTAGCGTTGGGTTTCTCG
ORF37FGATTACACGAAACAAACCT181
RAACACTTCCGCAATACAA
ORF40FCAACGGAACATACAACCTTACA249
RGCATCGCTTGAGCATAGTG
ORF50FCCGTGTAGTAAGTAAATGCC137
RTTATGCTGCCGTAGTTGA
ORF60FGGAAAGGGCATCCAACAA249
RGAACCGTGCGTGTCATCG
ORF67FGTGGCATTATGGTAACTCAA128
RTGCTATGGTCTAACCGAAC
ORF68FCCCGCAGTAACTCCTCAAC127
RATGGCGCTTCATGTATCTT
  • a F, forward; R, reverse.