TABLE 1

Primers for bisulfite pyrosequencinga

Annotated geneAnnealing temp (°C)Primer typePrimer sequence
RPH3AL57ForwardGGGTGAGATTATTTTTATGGTGAGAA
ReverseCACCCCTAATATAAAAAATACACTTAAACC*
SequencingGAGGGGTTGGGGGAA
RFLNB (FAM101B)57ForwardGGGATTGGTAGGAGGTTTTAAGAA
ReverseACACCAAACAAACTAAAATACATTCA*
SequencingGAGGTAGGTTTGAAGT
VPS53 (1)56ForwardGGAGTAAAGGGTTTTTTGTTGTTGTTAT*
ReverseACCTCTACTAACCCCATATCCAAATAC
SequencingCCATTCTAACCCAAACTT
VPS53 (2)56ForwardTTGTGAGGATGTTGGTGGGAAGTA
ReverseCCCCAACATACACAATCTTCCCATTA*
SequencingTGTTTAAATAGAGGGAATGTTTAG
  • a The concentration used for the forward and reverse primers was 0.2 μM, and the concentration used for the sequencing primer in the wells was 0.4 μM. *, biotinylated primer. (1) and (2) are two different primer pairs for the same gene.