TABLE 1

Primer sequences

Primer nameSequence
T7p-GFP-FTACGGGTACCTAATACGACTCACTATAG
T7p-GFP-RTACGCATATGCCGCGGTTTTTTTTTTTTTT
Ronin-FGAATTCGAGCTCGGTACCAG
Ronin-RGCAGACTCATCCACGGTAG
S1UnaG1-FGGCGCCTCGCTCAGTTGCGCCTATCCTTG
S1UnaG1-RCAAGGATAGGCGCAACTGAGCGAGGCGCC
S1UnaG2-FATGGTCTTTGTAGTCAGGACCGGGGTTTTCTTCCACGTCTC
S1UnaG2-RGAGACGTGGAAGAAAACCCCGGTCCTGACTACAAAGACCAT
S4-RT-FGGAACATTGTGAGAGCAGCA
S4-RT-RGCAAGCTAGTGGAGGCAGTC
M2-RT-FACGATGTCCCCACTATCAGC
M2-RT-RGATTGCTTCGGCTATCTTCG
mGAPDH-RT-FTGGCAAAGTGGAGATTGTTGCC
mGAPDH-RT-RAAGATGGTGATGGGCTTCCCG
haGAPDH-RT-FAACTTTGGCATTGTGGAAGG
haGAPDH-RT-RGGATGCAGGGATGATGTTCT
UnaG-RT-FCCTGGACACCCAAGTGAAGT
UnaG-RT-RTGCACGTACACCAGCTTCTC