TABLE 2

PCR primers

GeneProteinForward primer (5′ → 3′)Reverse primer (5′ → 3′)
RL2ICP0CTGTCGCCTTACGTGAACAACATCCAGAGGCTGTTCCACT
RS1ICP4CGACACGGATCCACGACCCGATCCCCCTCCCGCGCTTCGTCCG
UL23TKGTAATGACAAGCGCCCAGATATGCTGCCCATAAGGTATCG
UL29ICP8ACATTACGTTCACGGCCTTCGGCCATCGACACGATAGACT
UL48VP16GGACGAGCTCCACTTAGACGAGGGCATCGGTAAACATCTG
UL31pUL31GTGAAGACCACTCCCGTCTCATCGTGTTGATCTGCTGCAC
UL55gBTTTGTGTACATGTCCCCGTTTTACAGAAGCCGTCGACCTGCTT
DDX3XDDX3XTGCTGGCCTAGACCTGAACTTTGATCCACTTCCACGATCA
GAPDHGAPDHGAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG
IFN-βIFN-βAAACTCATGAGCAGTCTGCAAGGAGATCTTCAGTTTCGGAGG