ABSTRACT
MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression posttranscriptionally by silencing or degrading their targets and play important roles in the host response to pathogenic infection. Although infectious bursal disease virus (IBDV)-induced apoptosis in host cells has been established, the underlying molecular mechanism is not completely unraveled. Here, we show that infection of DF-1 cells by IBDV induced gga-miR-16-5p (chicken miR-16-5p) expression via demethylation of the pre-miR-16-2 (gga-miR-16-5p precursor) promoter. We found that ectopic expression of gga-miR-16-5p in DF-1 cells enhanced IBDV-induced apoptosis by directly targeting the cellular antiapoptotic protein B-cell lymphoma 2 (Bcl-2), facilitating IBDV replication in DF-1 cells. In contrast, inhibition of endogenous miR-16-5p markedly suppressed apoptosis associated with enhanced Bcl-2 expression, arresting viral replication in DF-1 cells. Furthermore, infection of DF-1 cells with IBDV reduced Bcl-2 expression, and this reduction could be abolished by inhibition of gga-miR-16-5p expression. Moreover, transfection of DF-1 cells with gga-miR-16-5p mimics enhanced IBDV-induced apoptosis associated with increased cytochrome c release and caspase-9 and -3 activation, and inhibition of caspase-3 decreased IBDV growth in DF-1 cells. Thus, epigenetic upregulation of gga-miR-16-5p expression by IBDV infection enhances IBDV-induced apoptosis by targeting the cellular antiapoptotic protein Bcl-2, facilitating IBDV replication in host cells.
IMPORTANCE Infectious bursal disease (IBD) is an acute, highly contagious, and immunosuppressive disease in young chickens, causing severe economic losses to stakeholders across the globe. Although IBD virus (IBDV)-induced apoptosis in the host has been established, the underlying mechanism is not very clear. Here, we show that infection of DF-1 cells by IBDV upregulated gga-miR-16-5p expression via demethylation of the pre-miR-16-2 promoter. Overexpression of gga-miR-16-5p enhanced IBDV-induced apoptosis associated with increased cytochrome c release and caspase-9 and -3 activation. Importantly, we found that IBDV infection induced expression of gga-miR-16-5p that triggered apoptosis by targeting Bcl-2, favoring IBDV replication, while inhibition of gga-miR-16-5p in IBDV-infected cells restored Bcl-2 expression, slowing down viral growth, indicating that IBDV induces apoptosis by epigenetic upregulation of gga-miR-16-5p expression. These findings uncover a novel mechanism employed by IBDV for its own benefit, which may be used as a potential target for intervening IBDV infection.
INTRODUCTION
Infectious bursal disease (IBD), also known as Gumboro disease, is an acute, highly contagious disease caused by IBD virus (IBDV) across the world (1). IBDV causes severe damage in the bursa of Fabricius (BF) by destroying its target cells, the B lymphocyte precursors (2), inducing apoptosis of spleen, thymus, and peripheral lymphocytes. The diseased chickens suffer from severe immunosuppression leading to an increased susceptibility to other infectious diseases and vaccination failures (3, 4). IBDV is an Avibirnavirus belonging to the Birnaviridae family, which is composed of nonenveloped viruses containing two segments of double-stranded RNA (segments A and B) (5). Segment B (2.8 kb) encodes VP1, an RNA-dependent RNA polymerase (RdRp) linked to the virus genomic segments (6, 7), whereas segment A (3.17 kb), encoding the major components of the virus, contains two partially overlapping open reading frames (ORFs) (8). The first ORF encodes a nonstructural protein, VP5 (17 kDa), and the second one encodes the pVP2-VP4-VP3 polyprotein (110 kDa) that can be cleaved by the viral protease VP4 to release pVP2 (54.4 kDa), VP4 (28 kDa), and VP3 (32 kDa) (9, 10).
IBDV infection causes apoptosis in the BF, spleen, and thymus of susceptible chickens, and it was reported that the VP2 and VP5 were the major viral proteins involved in IBDV-induced apoptosis (11–15); however, other factors might also be involved in IBDV-induced apoptosis because inhibition of VP2- and/or VP5-induced apoptosis by inhibitors or knocking down the target proteins of VP2 and/or VP5 during IBDV infection could only partially block IBDV-induced apoptosis in host cells (16–18). Thus, it is very likely that IBDV-induced apoptosis involves multiple factors. MicroRNAs (miRNAs) are small noncoding RNAs of 20 to 24 nucleotides (nt) in length that are widespread in eukaryotes (19, 20). Cellular endogenous miRNAs can serve as a type of guiding molecule through base pairing with their target mRNAs, thereby leading to posttranscriptional splicing or translation inhibition by targeting the 3′ untranslated region (UTR) of mRNA in target genes. It has been reported that miRNA plays critical roles in a wide variety of biological processes (21), such as cell growth, differentiation (22), proliferation (23), apoptosis (24), immune response, cancer, etc. (25, 26). Increasing evidence suggests that cellular miRNAs contribute to the repertoire of host-pathogen interactions during viral infection (27, 28). Alterations in cellular miRNA expression, as a consequence of host-virus interactions, play a key role in the regulation of viral replication during virus infection (29, 30).
In our previous study, we screened IBDV-infected DF-1 cells for the potential host miRNA response to IBDV infection by deep sequencing (31, 32). Among the miRNA candidates, gga-miR-16-5p was found to be upregulated with IBDV infection. In the present study, we found that infection of DF-1 cells by IBDV upregulated gga-miR-16-5p expression via demethylation of the pre-miR-16-2 promoter and that gga-miR-16-5p induced apoptosis by directly targeting the cellular antiapoptotic protein B-cell lymphoma 2 (Bcl-2), favoring IBDV growth in DF-1 cells, while inhibition of gga-miR-16-5p in IBDV-infected cells restored Bcl-2 expression, slowing down viral growth. These data suggest that the epigenetic upregulation of gga-miR-16-5p expression by IBDV infection favors viral replication in host cells via enhancing IBDV-induced apoptosis.
RESULTS
Infection of DF-1 cells with IBDV strain Lx enhances gga-miR-16-5p expression.In our previous studies, we performed deep sequencing to analyze miRNA expression in DF-1 cells infected with IBDV strain Lx, and our data indicated that plenty of differentially expressed miRNAs participated in the process of IBDV infection (Gene Expression Omnibus [GEO] database accession number GSE90095) (31, 32); gga-miR-16-5p was such a microRNA whose expression was markedly affected by IBDV infection. To further determine the effect of IBDV infection on gga-miR-16-5p expression, we infected DF-1 cells with different doses of IBDV and examined the expression of mature gga-miR-16-5p at 12 and 24 h postinfection. As shown in Fig. 1, the expression of miR-16-5p markedly increased in DF-1 cells in a dose-dependent manner at both 12 and 24 h postinfection, indicating that IBDV infection increased gga-miR-16-5p expression in host cells.
Infection of DF-1 cells with IBDV strain Lx enhances gga-miR-16-5p expression. (A and B) DF-1 cells were mock infected or infected with IBDV strain Lx at an MOI of 0.01, 0.1, 1, or 10. Twelve (A) or twenty-four (B) hours after IBDV infection, the expression levels of miR-16-5p were examined by qRT-PCR. The expression of U6 was used as an internal control. The relative level of miR-16-5p expression was calculated as follows: miR-16-5p expression in IBDV-infected cells/expression of miR-16-5p in normal cells. Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01.
IBDV-mediated demethylation of the pre-miR-16-2 promoter upregulates the expression of gga-miR-16-5p in DF-1 cells.Since IBDV infection increased gga-miR-16-5p expression in DF-1 cells, it is intriguing to explore the underlying molecular mechanism. Epigenetic modification, such as DNA methylation, is involved in regulating gene expression (33). Methylation status, particularly in the promoter region, is closely related to the transcriptional status of gene expression: hypomethylation promotes transcription, while hypermethylation restrains it (34, 35). Thus, we proposed that the expression of gga-miR-16-5p in IBDV-infected cells might be related to the epigenetic modification of miRNA promoters. As mature gga-miR-16-5p can be derived from two independent precursors, the pre-miR-16-1 and pre-miR-16-2, we set out to determine whether IBDV infection upregulates miR-16-5p expression via epigenetic modification of the pre-miR-16 promoter. We performed bisulfite sequencing PCR (BSP) to examine methylation levels in the pre-miR-16-1 and pre-miR-16-2 promoter regions in mock- or IBDV-infected DF-1 cells. As shown in Fig. 2A and B, the methylation levels of CpG sites in the pre-miR-16-2 promoter (the region from bp −2465 to −2116) in IBDV-infected cells markedly decreased compared to levels in mock-infected controls (P < 0.001), but there was no difference in methylation levels of CpG sites in the pre-miR-16-1 promoter (the region from bp −2775 to −2329) (data not shown), suggesting that IBDV infection induces demethylation of the pre-miR-16-2 rather than the pre-miR-16-1 promoter. To further determine the effect of epigenetic modification on miR-16-5p expression, we examined the expression of mature miR-16-5p in DF-1 cells treated with 5-aza-2-deoxycytidine (5-aza-CdR), a DNA hypomethylating agent. As a result, 5-aza-CdR treatment markedly decreased methylation of the pre-miR-16-2 promoter region associated with enhancement of miR-16-5p expression compared to that of mock-treated controls (P < 0.01) (Fig. 2C and D). These data indicate that IBDV-mediated reduction of methylation of the pre-miR-16-2 promoter contributes to the upregulation of gga-miR-16-5p expression in cells.
IBDV-mediated demethylation of the pre-miR-16-2 promoter region upregulates gga-miR-16-5p expression. (A and B) Infection of DF-1 cells with IBDV caused demethylation of the pre-miR-16-2 promoter region. DF-1 cells were mock infected or infected with IBDV (MOI of 0.1 or 1). Twenty-four hours after IBDV infection, bisulfite sequencing PCR (BSP) of the pre-miR-16-2 promoter region was performed to examine the methylation levels of CpG sites in cells. The sequenced region covered bp −2465 to −2116 within the pre-miR-16-2 promoter region. Horizontal lines denote triplicates, with three clones from each of three experiments. The methylation levels shown in panel A were quantitated as shown in panel B. (C and D) DF-1 cells treated with 5-aza-2′-deoxycytidine (5-aza-CdR; a DNA hypomethylating agent) decreased methylation of the pre-miR-16-2 promoter region and upregulated the expression of miR-16-5p. DF-1 cells were treated with 5-aza-CdR at a final concentration of 1 μM or with dimethyl sulfoxide as a control for 48 h. Genomic DNA was prepared to analyze methylation levels of the pre-miR-16-2 promoter by BSP, and the methylation levels were quantitated as shown in panel C. Total RNA was prepared to analyze abundance of mature miR-16-5p by qRT-PCR at indicated time points (12 and 24 h) after treatment (D). The relative level of miR-16-5p expression was calculated as follows: the expression of miR-16-5p in 5-aza-CdR-treated cells/that of miR-16-5p in controls. Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01.
gga-miR-16-5p facilitates IBDV replication in DF-1 cells.To determine the role of miRNAs in the cell response to IBDV infection, we examined the effects of gga-miR-16-5p and four other microRNAs on IBDV replication in cells since the expression of these five microRNAs had markedly changed in cells with IBDV infection, and their involvement in immune response and viral infection had been previously reported (36–38). As a result, transfection of gga-miR-16-5p significantly enhanced IBDV replication in DF-1 cells compared to that with microRNA controls as examined by 50% tissue culture infective dose (TCID50) assay, while four other microRNAs did not affect IBDV replication (P < 0.01) (Fig. 3A). Furthermore, we examined the expression of VP2, a structural protein of IBDV, in miR-16-5p transfected cells post-IBDV infection by Western blotting and found that VP2 expression increased with gga-miR-16-5p transfection in a dose-dependent manner (Fig. 3B and C), indicating that gga-miR-16-5p enhances IBDV replication. Similarly, transfection of DF-1 cells with gga-miR-16-5p mimics also enhanced IBDV replication, as demonstrated by indirect immunofluorescence antibody (IFA) assay (Fig. 3D to M). To consolidate these findings, we transfected DF-1 cells with gga-miR-16-5p mimics or miRNA controls and examined the viral titers in the cell cultures or supernatants at different time points using a TCID50 assay. As shown in Fig. 3N and O, transfection of DF-1 cells with miR-16-5p markedly promoted IBDV replication compared to that of control cells (P < 0.01), suggesting that overexpression of gga-miR-16-5p benefits IBDV replication in host cells. In contrast, knockdown of endogenous gga-miR-16-5p in DF-1 cells significantly inhibited VP2 expression in IBDV-infected cells as examined by Western blotting (Fig. 4A and B) and IFA assay (Fig. 4C to L). Consistently, inhibition of endogenous miR-16-5p markedly suppressed IBDV replication (Fig. 4M). These data clearly show that gga-miR-16-5p facilitates IBDV replication in DF-1 cells.
gga-miR-16-5p facilitates IBDV replication in DF-1 cells. (A) DF-1 cells were transfected with the indicated gga-miR mimics or controls. Twenty-four hours after transfection, cells were infected with IBDV at an MOI of 0.1 and continuously cultured for 24 h before the viral loads in the cell cultures were measured by TCID50 analysis. (B and C) DF-1 cells were transfected with gga-miR-16-5p mimics or controls at different concentrations. Twenty-four hours after transfection, cells were infected with IBDV at an MOI of 0.1. Twenty-four hours after IBDV infection, cell lysates were prepared and subjected to Western blot analysis using anti-VP2 antibodies. Endogenous GAPDH expression was examined as an internal control. The band densities of VP2 shown in panel B were quantitated by densitometry as shown in panel C. The relative levels of VP2 were calculated as follows: band density of VP2/band density of GAPDH. (D to M) IBDV VP2 protein was examined by immunofluorescent antibody (IFA) assay. The pictures were taken under a fluorescence microscope (D to H) and a light microscope (I to M) at 100× magnification, respectively. Scale bar, 100 μm. (N and O) Viral loads increased in cell cultures after miR-16-5p-transfection. DF-1 cells were treated as described in panel A. At indicated time points (12, 24, 48, and 72 h) after IBDV infection, the viral titers in the cell cultures (N) or supernatants (O) were determined by TCID50 analysis. The significance of the differences between miR-16-5p-transfected cells and those of the miR controls in terms of viral growth was determined by ANOVA (P < 0.01). Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01; *, P < 0.05.
Inhibition of endogenous gga-miR-16-5p suppresses IBDV replication. (A) Examination of IBDV VP2 expression in cells with Western blotting. DF-1 cells were transfected with gga-miR-16-5p inhibitors (Inh) or controls at 200 nM for 24 h, followed by infection with IBDV at an MOI of 0.1. Twenty-four hours after infection, cell lysates were prepared and examined by Western blotting using anti-VP2 antibodies. (B) Relative levels of VP2 expression in cells. The band densities of IBDV VP2 shown in panel A were quantitated by densitometry. Endogenous GAPDH expression was examined as an internal control. The relative levels of VP2 were calculated as follows: band density of VP2/band density of GAPDH. (C to L) Detection of IBDV VP2 expression in cells by IFA assay. DF-1 cells were treated as described in panel A. IBDV VP2 protein was examined by IFA assay. The pictures in the upper panels were taken under a fluorescence microscope, and those in the lower panels were taken under a light microscope at 100× magnification. Scale bar, 100 μm. (M) Inhibition of endogenous gga-miR-16-5p slowed down viral growth in cell cultures. DF-1 cells were treated with gga-miR-16-5p-inhibitor or controls as described in panel A. At indicated time points (12, 24, 48, and 72 h) after IBDV infection, the viral titers in the cell cultures were determined by TCID50 analysis. The significance of the differences between miR-16-5p inhibitor transfected cells and those of miR controls in terms of viral growth was determined by ANOVA (P < 0.01). Data are representative of three independent experiments and presented as means ± SD. **, P < 0.01.
gga-miR-16-5p enhances IBDV-induced apoptosis in DF-1 cells.We previously found that IBDV-induced apoptosis at a later stage of infection enhances viral growth (16). It is likely that the enhancement of IBDV growth in cells might be attributed to the apoptotic effect of gga-miR-16-5p because miR-16-5p has been reported to induce apoptosis in tumor or microbial infection (36, 39). Thus, we set out to examine the role of gga-miR-16-5p in apoptosis in DF-1 cells. We transfected DF-1 cells with gga-miR-16-5p mimics or inhibitors and examined apoptosis at different time points posttransfection by flow cytometry using annexin-V staining. As shown in Fig. 5, cells receiving gga-miR-16-5p displayed marked apoptotic changes compared to apoptosis with miRNA controls (P < 0.01), while inhibition of endogenous miR-16-5p with its inhibitors significantly inhibited apoptosis (P < 0.05), indicating that gga-miR-16-5p induces spontaneous cell death in DF-1 cells.
Transfection of DF-1 cells with gga-miR-16-5p induces apoptosis. (A) DF-1 cells were seeded on 12-well plates and cultured overnight, followed by transfection with miR-16-5p mimics, inhibitors (Inh), or miRNA controls. At different time points (24, 48, and 72 h) posttransfection with mimics, inhibitors, or miRNA controls, cells were collected, stained with annexin-V–PE, and examined for apoptosis by flow cytometry. (B) The percentage of apoptotic cells in each group shown in panel A was graphed and statistically analyzed. Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01; *, P < 0.05.
The fact that gga-miR-16-5p is involved in apoptosis prompted us to determine the role of gga-miR-16-5p in IBDV-induced apoptosis. We transfected DF-1 cells with gga-miR-16-5p mimics, gga-miR-16-5p inhibitors, or miRNA controls and examined apoptosis at different time points (24, 48, and 72 h) post-IBDV infection. As shown in Fig. 6, overexpression of gga-miR-16-5p markedly enhanced IBDV-induced apoptosis in DF-1 cells (P < 0.01). In contrast, inhibition of endogenous miR-16-5p significantly reduced IBDV-induced apoptosis (P < 0.05). These data clearly show that gga-miR-16-5p enhances IBDV-induced apoptosis, facilitating viral replication in host cells.
Transfection of DF-1 cells with gga-miR-16-5p enhances IBDV-induced apoptosis. (A) DF-1 cells were seeded on 12-well plates and cultured overnight, followed by transfection with miR-16-5p mimics, miR inhibitors, or miRNA controls. Twenty-four hours after transfection, cells were infected with IBDV at an MOI of 0.1. At different time points (24, 48, and 72 h) post-IBDV infection, cells were collected, stained with annexin-V–PE, and examined for apoptosis by flow cytometry. (B) The percentage of apoptotic cells in each group shown in panel A was graphed and statistically analyzed. Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01; *, P < 0.05.
The Bcl-2 gene is a target of gga-miR-16-5p in DF-1 cells.Since gga-miR-16-5p is involved in apoptosis, it is intriguing to explore the underlying molecular mechanism. Using the TargetScan, PicTar, and RNA22 (version 2) databases, we predicted Bcl-2 as a target of miR-16-5p in host cells. The region of the Bcl-2 3′ untranslated region (UTR) at bp 382 to 388 contains the target site for gga-miR-16-5p (Fig. 7A). Bcl-2 is a well-characterized antiapoptosis protein (40), exerting antiapoptotic effects by preventing the release of mitochondrial cytochrome c (41). It was reported that Bcl-2 could be targeted by human miR-16-5p (has-miR-16-5p) (42). Therefore, we hypothesized that gga-miR-16-5p might regulate apoptosis by targeting Bcl-2 in IBDV-infected cells. To test this hypothesis, we constructed a firefly luciferase reporter gene plasmid (pGL3-Bcl-2-WT, where WT is wild type) containing the predicted target site in Bcl-2 and another construct (pGL3-Bcl-2-Mut) with a mutation (Mut) in the seed region as controls, transfected DF-1 cells with these reporter gene plasmids and miRNAs, and performed luciferase reporter gene assays. As shown in Fig. 7B, transfection of cells with miR-16-5p together with pGL3-Bcl-2-WT significantly reduced luciferase activity of the reporter gene compared to that of controls (P < 0.01), but this reduction was completely abolished by transfection with pGL3-Bcl-2-Mut, indicating that miR-16-5p inhibits Bcl-2 expression by targeting its specific sequence in the Bcl-2 gene 3′ UTR. Furthermore, we examined the effect of miR-16-5p on Bcl-2 mRNA expression by quantitative reverse transcription-PCR (qRT-PCR). Consistently, our results show that transfection of DF-1 cells with miR-16-5p decreased the levels of Bcl-2 mRNA compared to those with the miRNA controls (Fig. 7C). To consolidate these findings, we examined the effect of miR-16-5p on Bcl-2 expression at the protein level. We transfected DF-1 cells with miR-16-5p or miRNA controls and examined the effect of miR-16-5p on Bcl-2 expression by Western blot analysis. As a result, overexpression of miR-16-5p in DF-1 cells markedly suppressed Bcl-2 expression (P < 0.01) (Fig. 7D and E). In contrast, knockdown of endogenous miR-16-5p by its inhibitors enhanced Bcl-2 expression compared to that of the controls (P < 0.01) (Fig. 7F and G). These data clearly show that gga-miR-16-5p inhibits Bcl-2 expression by directly targeting Bcl-2 gene expression in DF-1 cells, leading to apoptosis.
The Bcl-2 gene is a cellular target of gga-miR-16-5p in host cells. (A) Diagram of predicted target sites for gga-miR-16-5p in the Bcl-2 gene. The target sequence of miR-16-5p is underlined, and the mutant is indicated by an arrow. (B) Transfection of miR-16-5p reduced expression of Bcl-2 but not of its mutant. DF-1 cells were cotransfected with the indicated miRNAs and luciferase reporter vectors. Forty-eight hours posttransfection, cells were lysed, and a luciferase reporter gene assay was performed to measure Bcl-2 expression. The relative levels of luciferase activity (Rel Luc Act) were calculated as follows: luciferase activity of cells transfected with the reporter plasmids together with miR-16-5p mimics or inhibitors/that of cells cotransfected with the reporter plasmids and miRNA controls. (C) miR-16-5p reduced the mRNA expression of Bcl-2. DF-1 cells were transfected with the indicated miRNAs. Twenty-four hours after transfection, the mRNA expression of Bcl-2 was examined by qRT-PCR. GAPDH was used as an internal control. (D and E) Transfection of miR-16-5p reduced expression of Bcl-2 in DF-1 cells. DF-1 cells were transfected with miRNA controls or miR-16-5p mimics. Forty-eight hours after transfection, cell lysates were prepared and subjected to Western blot analysis using anti-Bcl-2 antibodies (D). β-Actin expression was used as an internal control. The band densities of Bcl-2 shown in panel D were quantitated by densitometry (E). The relative levels of Bcl-2 expression were calculated as follows: band density of Bcl-2/band density of β-actin. (F and G) miR-16-5p inhibitors enhanced Bcl-2 expression in DF-1 cells. DF-1 cells were transfected with miR-16-5p inhibitors or inhibitor controls. Forty-eight hours after transfection, the expression of Bcl-2 was examined as described for panel D. The band densities of Bcl-2 shown in panel F were quantitated by densitometry, and the relative levels of Bcl-2 expression were calculated as described for panel E. Data are representative of three independent experiments and presented as means ± SD. **, P < 0.01; *, P < 0.05.
IBDV-induced reduction of Bcl-2 in cells is attributable to gga-miR-16-5p.The facts that IBDV infection upregulates gga-miR-16-5p expression and that gga-miR-16-5p enhances IBDV-induced apoptosis by inhibiting Bcl-2 expression suggest that IBDV infection might reduce Bcl-2 expression via gga-miR-16-5p and that inhibition of endogenous gga-miR-16-5p in IBDV-infected cells would therefore abolish IBDV-induced reduction of Bcl-2 expression. To test this hypothesis, we infected DF-1 cells with different doses of IBDV and examined Bcl-2 expression at 24 h postinfection. As a result, the expression of Bcl-2 in IBDV-infected cells markedly decreased with IBDV infection in a dose-dependent manner (P < 0.01) (Fig. 8A and B), indicating that IBDV infection reduces Bcl-2 expression in host cells. Importantly, this reduction could be abolished by inhibition of gga-miR-16-5p (Fig. 8C and D), suggesting that IBDV-induced reduction of Bcl-2 is attributable to gga-miR-16-5p. Considering that IBDV infection upregulates gga-miR-16-5p expression and that miR-16-5p enhances IBDV-induced apoptosis by inhibiting Bcl-2 expression, it is very likely that IBDV induces apoptosis by upregulating gga-miR-16-5p expression that inhibits Bcl-2 expression.
Inhibition of endogenous gga-miR-16-5p blocks the effect of IBDV on Bcl-2 expression. (A) IBDV infection reduced Bcl-2 expression in host cells. DF-1 cells were mock infected or infected with IBDV at an MOI of 0.01, 0.1, 1, or 10. Twenty-four hours after IBDV infection, cells lysates were prepared and subjected to Western blot analysis using anti-Bcl-2 antibodies. β-Actin expression was examined as an internal control. The band densities of Bcl-2 shown in panel A were quantitated by densitometry (B). The relative levels of Bcl-2 expression were calculated as follows: band density of Bcl-2/band density of β-actin. (C and D) Inhibition of endogenous gga-miR-16-5p restored the expression of Bcl-2 in IBDV-infected cells. DF-1 cells were transfected with controls or miR-16-5p inhibitors for 24 h, followed by infection with IBDV at an MOI of 0.1. Twenty-four hours after infection, the expression of Bcl-2 was examined as described for panel A, and β-actin expression was examined as an internal control (C). The band densities of Bcl-2 shown in panel C were quantitated by densitometry, and the relative levels of Bcl-2 expression were calculated as described above for panel B. Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01; ns, not significant.
Overexpression of gga-miR-16-5p enhances IBDV-induced cytochrome c release and activation of caspase-9 and -3.Bcl-2, a member of Bcl-2 family proteins that regulate apoptosis by controlling mitochondrial permeability, mediates apoptosis associated with the release of cytochrome c from mitochondria to the cytoplasm (43, 44), which is a hallmark of the intrinsic apoptotic pathway. Since gga-miR-16-5p inhibits the expression of Bcl-2 and Bcl-2-mediated apoptosis is associated with cytochrome c release, we hypothesized that gga-miR-16-5p enhances apoptosis via facilitating cytochrome c release and activation of caspase-9 and -3. To test this hypothesis, we transfected DF-1 cells with the miRNAs or miRNA controls indicated on the figures and then examined the release of cytochrome c and the activities of caspase-9 and -3 at 24 h and 48 h with or without IBDV infection. We observed that transfection of DF-1 cells with gga-miR-16-5p significantly increased cytochrome c release and the activities of caspase-9 and -3, while inhibition of endogenous gga-miR-16-5p suppressed the activities of caspase-9 and -3 (Fig. 9A to D), suggesting that gga-miR-16-5p enhances IBDV-induced apoptosis by inhibiting Bcl-2 expression, triggering the intrinsic apoptotic pathway associated with cytochrome c release and activation of caspase-9 and -3.
gga-miR-16-5p enhances IBDV-induced release of cytochrome c and activation of caspase-9 and caspase-3. (A and B) gga-miR-16-5p enhances IBDV-induced release of cytochrome c. DF-1 cells were transfected with the indicated miRNAs or miRNA controls. Twenty-four hours after transfection, cells were mock infected or infected with IBDV at an MOI of 0.1. At the indicated time points (24 and 48 h) after IBDV infection, cytosolic proteins were prepared and subjected to Western blot analysis for the measurement of cytochrome c in the cytosol of cells. The band densities of cytochrome c shown in panel A were quantitated by densitometry. The relative levels of cytochrome c were calculated as follows: band density of cytochrome c/that of β-actin. (C and D) gga-miR-16-5p enhances IBDV-induced activation of caspase-9 and caspase-3. DF-1 cells were treated as described for panel A, and at indicated time points after IBDV infection, the activities of caspase-9 and caspase-3 were measured at 405 nm with a microplate reader using the substrates LEHD-pNA (synthetic caspase-9 substrate) and DEVD-pNA (synthetic caspase-3 substrate). (E and F) Inhibition of caspase-3 suppresses IBDV replication. DF-1 cells were treated with 20 μM caspase-3 inhibitor (Z-DEVD-FMK) or dimethyl sulfoxide (DMSO) as a control for 2 h, followed by infection with IBDV at an MOI of 0.1. After 2 h, the cells were retreated with caspase-3 inhibitor or dimethyl sulfoxide as a control in fresh DMEM. At the indicated time points (12, 24, 48, and 72 h) post-IBDV infection, the viral titers in the cell cultures or supernatants were determined by TCID50 analysis. The significance of the differences between caspase-3 inhibitor-treated cells and controls in terms of viral growth was determined by ANOVA (P < 0.01). Data are representative of three independent experiments and presented as means ± SD. ***, P < 0.001; **, P < 0.01; *, P < 0.05.
Since our data show that IBDV-induced apoptosis favors viral replication, it would be intriguing to determine if apoptosis is required for IBDV release and replication. Thus, we treated cells with Z-DEVD-FMK (an inhibitor of caspase-3, the executive caspase for apoptosis) or a control and examined viral titers in the cell cultures or supernatants at different time points after IBDV infection. As shown in Fig. 9E and F, inhibition of caspase-3 markedly reduced IBDV titers in both cell cultures and supernatants compared to those in control-treated cells (P < 0.01), suggesting that apoptosis is necessary for IBDV release and growth, especially at a later stage of IBDV infection. These data confirmed our previous findings that IBDV-induced apoptosis facilitates the release of viral particles at a later stage of IBDV infection (16). Therefore, IBDV might take advantage of apoptosis via various means, including epigenetic upregulation of gga-miR-16-5p expression, for its own benefit.
DISCUSSION
IBDV infection causes severe damage to the lymphoid organs of birds, especially the bursa of Fabricius (4), leading to severe economic losses to the poultry industry worldwide. Chickens that survive IBDV infection suffer from immunosuppression with compromised humoral and cellular immune responses (45, 46) and display increased susceptibility to other diseases. Although IBDV-induced apoptosis in host cells has been very well established (12–14) and although VP2 and VP5 are implicated in the induction of apoptosis (11, 15), it was not until recently that the molecular mechanism underlying IBDV-induced apoptosis was partially elucidated (16–18). In our previous studies, we found that IBDV VP5 induces apoptosis via interaction with the cellular protein voltage-dependent anion channel 2 (VDAC2) (16) and that the receptor of activated protein C kinase 1 (RACK1) interacts with both VDAC2 and VP5, forming a complex affecting apoptosis and viral replication (17), while VP2 induces apoptosis by targeting the protein oral cancer overexpressed 1 (ORAOV1), an antiapoptotic protein, for degradation (18). However, the detailed molecular mechanisms underlying IBDV-induced apoptosis remain elusive. It is highly possible that IBDV-induced apoptosis is attributed to multiple factors including viral proteins (VP2 and VP5) and other mechanisms as well.
In the present study, first, we found that IBDV-induced demethylation of the pre-miR-16-2 promoter upregulated gga-miR-16-5p expression in host cells. Second, our data show that overexpression of gga-miR-16-5p facilitated IBDV replication and apoptosis in DF-1 cells, but these effects were markedly mitigated by knockdown of gga-miR-16-5p expression in cells. Third, based on a bioinformatic approach, we predicted and confirmed that gga-miR-16-5p induced apoptosis by directly targeting cellular antiapoptotic protein Bcl-2. Importantly, IBDV infection reduced Bcl-2 expression in cells, and this reduction could be abolished by inhibition of endogenous gga-miR-16-5p. Finally, transfection of cells with gga-miR-16-5p mimics enhanced IBDV-induced apoptosis associated with increased cytochrome c release and caspase-9 and -3 activation in host cells. Thus, our data clearly show that IBDV infection upregulates gga-miR-16-5p expression via epigenetic modification, which enhances IBDV-induced apoptosis by triggering Bcl-2-mediated apoptosis, facilitating viral replication (Fig. 10). These findings contribute to an understanding of the mechanisms underlying IBDV-induced apoptosis at the RNA level.
The model for gga-miR-16-5p-mediated apoptosis by targeting Bcl-2 for the enhancement of IBDV replication. Infection of host cells with IBDV upregulates gga-miR-16-5p expression via epigenetic modification. As a consequence, gga-miR-16-5p enhances IBDV-induced apoptosis by targeting Bcl-2, increasing cytochrome c (Cyto c) release and caspase-9 and -3 activation, and facilitating IBDV release.
miRNAs can serve as a type of guiding molecules through base pairing with their target mRNAs, thereby leading to posttranscriptional splicing or translation inhibition by targeting the 3′ UTR of mRNA in target genes. Some host miRNAs inhibit viral replication by directly targeting the viral genome or activating antiviral factors (47–49), while others facilitate viral growth via antagonizing innate immune responses or host antiviral factors (50–52). Up to now, several chicken miRNAs have been reported to be involved in the regulation of IBDV replication by targeting viral genome or host proteins. For example, gga-miR-130b inhibited IBDV replication by targeting the specific sequence of IBDV segment A and enhanced the expression of beta interferon (IFN-β) by targeting SOCS5 (31). Similarly, gga-miR-454 suppressed IBDV replication by directly targeting IBDV genomic segment B and SOCS6 (53), gga-miR-21 suppressed IBDV replication through downregulating IBDV VP1 expression (54), and gga-miR-155 enhanced IFN-β expression and suppressed IBDV replication by targeting SOCS1 and TANK (32), suggesting that miRNAs inhibit IBDV replication by directly targeting the viral genome and/or targeting the negative regulators for the antiviral signaling pathways. Thus, gga-miR-130b, gga-miR-454, and gga-miR-155 play crucial roles in the host defense against IBDV infection. In contrast, gga-miR-9* inhibited IFN production by targeting IRF-2 to promote IBDV replication (55), gga-miR-2127 downregulated chicken p53 (chp53) expression by targeting its 3′ UTR, dampened the chp53-mediated anti-IBDV response, and facilitated IBDV replication (56), and gga-miR-142-5p attenuated IRF7 signaling and promoted IBDV replication by directly targeting the chMDA5’s 3′ untranslated region (57), suggesting that gga-miR-9*, gga-miR-2127, and gga-miR-142-5p inhibit the host defense and favor viral replication. It seems that different miRNAs may have varied or even opposite effects on the host response to IBDV infection.
In the present study, our data show that gga-miR-16-5p is involved in IBDV-induced apoptosis by targeting Bcl-2 in host cells, favoring viral replication. However, it was reported that has-miR-16-5p induced apoptosis and inhibited replication of enterovirus 71 (EV71) by targeting CCND1 and CCNE1 (36). It seems that miR-16-5p can regulate apoptosis by targeting multiple signaling pathways in the host response to viral infections, and its role in viral replication may vary depending on different viruses. It has been reported that DNA hypomethylation and hypermethylation are common and important epigenetic processes regulating gene expression by regulating the binding of transcription factors or recruitment of methyl binding proteins (58, 59). Our data suggest that upregulation of miR-16-5p expression is associated with DNA demethylation caused by IBDV infection. In this case, the following questions need to be addressed. (i) Since IBDV infection results in epigenetic demethylation of the pre-miR-16-2 promoter, is there any demethylase involved in the process? (ii) If so, how is the relevant demethylase regulated by IBDV infection? (iii) Can the epigenetic regulation of a microRNA promoter by IBDV infection be generalized to other pathogenic infections? More efforts will be required to elucidate the mechanism underlying IBDV-induced expression of gga-miR-16-5p.
Apoptosis, or programmed cell death, is a controlled physiological process of the host to eliminate unwanted cells, including those infected by a virus. Thus, apoptosis is a defense mechanism of the host in response to viral infection. In the case of IBDV, it is not surprising that IBDV inhibits apoptosis at the early stage of viral infection but triggers apoptosis at the late stage of infection for viral release, as shown in our previous studies (16). In the present study, our results show that IBDV infection induces expression of gga-miR-16-5p that triggers apoptosis by targeting Bcl-2. We found that inhibition of gga-miR-16-5p or caspase-3 markedly inhibited IBDV replication, suggesting that apoptosis is required for IBDV growth and release, favoring viral replication in host cells. Thus, from an evolutionary point of view, it is very important for IBDV to have the capability of inducing apoptosis in the host at both the protein and RNA levels.
It is well known that miRNAs exert functions by complementing target mRNAs in a seed region (60, 61). Using bioinformatics analysis, we found that the 3′ UTR of Bcl-2 contains a target site for gga-miR-16-5p. The interaction between miR-16-5p and Bcl-2 has been reported in various cells (42, 62, 63). The Bcl-2 gene is a proto-oncogene that inhibits apoptosis (64). It was found that Bcl-2 could inhibit cell death in blood lymphocytes (64) and other cells (65). Thus, Bcl-2 is known as an antiapoptotic protein. It was reported that hsa-miR-16 could control cell proliferation and apoptosis by regulating Bcl-2 expression (42, 66). In mammalian cells, Bcl-2 is localized in the outer membrane of mitochondria. It was found that Bcl-2, Bcl-xL, and Bax could affect VDAC, which may have a positive effect on cytochrome c release (41, 43, 44). In this study, we found that IBDV infection decreased Bcl-2 expression and that this decrease could be blocked by inhibition of endogenous gga-miR-16-5p, indicating that IBDV induces apoptosis by epigenetic upregulation of gga-miR-16-5p that targets Bcl-2. Thus, gga-miR-16-5p plays a critical role in IBDV-induced apoptosis by targeting Bcl-2.
In conclusion, our data show that IBDV infection upregulates gga-miR-16-5p expression, which enhances IBDV-induced apoptosis associated with increased cytochrome c release and caspase-9 and -3 activation. Importantly, our results demonstrate that gga-miR-16-5p, by targeting Bcl-2, triggers Bcl-2-mediated apoptosis, which directly contributes to IBDV-induced apoptosis in host cells, facilitating viral replication. Thus, IBDV growth requires miRNA-induced apoptosis, which might be used as a potential target for intervening IBDV infection. These findings contribute to an understanding of the mechanisms underlying IBDV-induced apoptosis at an RNA level.
MATERIALS AND METHODS
Cells and virus.DF-1 cells (immortal chicken embryo fibroblast) were obtained from the ATCC. Cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher, USA) supplemented with 10% fetal bovine serum (FBS) in a 5% CO2 incubator at 37°C. Lx, a cell culture-adapted IBDV strain, was kindly provided by Jue Liu (Beijing Academy of Agriculture and Forestry, Beijing, China).
Reagents.Monoclonal antibody against IBDV VP2 (product EU0205) was obtained from CAEU Biological Company (Beijing, China). Polyclonal antibodies against chicken Bcl-2 were obtained from Proteintech Group (USA). Anti-cytochrome c antibodies were purchased from Merck (Germany). Anti-β-actin (AC026) rabbit antibodies and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (AC002) mouse antibodies were obtained from ABclonal Technology (Wuhan, China). Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG were purchased from Dingguo Company (Beijing, China). Lipofectamine 2000 reagent was obtained from Invitrogen (USA). A phycoerythrin (PE)–annexin-V apoptosis detection kit was purchased from BD Pharmingen (USA). Caspase-3 and caspase-9 colorimetric assay kits were obtained from BioVision (USA). A dual-specific luciferase assay kit was purchased from Promega (USA). The caspase-3 inhibitor Z-DEVD-FMK (product A1920) was obtained from ApexBio Technology (USA).
Sequences of miRNA mimics or inhibitors.Mimics/inhibitors for miRNA were synthesized by GenePharma (Shanghai, China). The sense sequences are as follows: for gga-miR-16-5p mimics, 5′-UAGCAGCACGUAAAUAUUGGUG-3′; for gga-miR-16-5p inhibitors, 5′-CACCAAUAUUUACGUGCUGCUA-3′; for mimic negative controls, 5′-UUCUCCGAACGUGUCACGUTT-3′; for inhibitor negative controls, 5′-CAGUACUUUUGUGUAGUACAA-3′.
miRNA target prediction.miRNA targets in host cells were predicted by RNA22, version 2 (https://cm.jefferson.edu/rna22), TargetScan (http://www.targetscan.org/vert_70/), miRanda (http://www.microrna.org/microrna/home.do), and PicTar (https://pictar.mdc-berlin.de) (67).
RNA isolation and qRT-PCR analysis.Total RNA and miRNAs were prepared from DF-1 cells using an EASYspin Plus kit and RNA microRNA Mini kit (Aidlab, China), respectively, per the manufacturer’s instructions. Quantitative reverse transcription-PCR (qRT-PCR) analysis was performed using a PrimeScript RT reagent kit (TaKaRa) on a LightCycler 480II (Roche, USA). qRT-PCR analysis of gga-miR-16-5p was performed with an RT-PCR quantitation kit (GenePharma, China). Thermal cycling parameters for miRNAs were as follows: 95°C for 3 min; 40 cycles of 95°C for 12 s and 62°C for 40 s; and 1 cycle of 95°C for 30 s, 60°C for 30 s, and 95°C for 30 s. The final step was to obtain a melt curve for the PCR products to determine the specificity of the amplification, and the U6 snRNA was utilized as the reference gene. The expression levels of gga-miR-16-5p were calculated relative to the expression of U6 snRNA and presented as fold increases or decreases relative to levels of the control samples. All samples were carried out in triplicate on the same plate.
DNA methylation assay.DF-1 cells were mock infected or infected with IBDV at a multiplicity of infection (MOI) of 0.1 or 1 for 24 h, and then genomic DNA, isolated from DF-1 cells by using a DNA extraction kit (Aidlab, China) according to the manufacturer’s instructions, was treated with an EZ DNA Methylation-Gold kit (Zymo Research, USA). The 3-kb regions upstream of the pre-miR-16-1 and pre-miR-16-2 precursor genes were determined as promoter regions using the Ensembl Genome Browser (http://asia.ensembl.org/index.html). Two amplicons were detected in promoter regions of the precursors using bisulfite sequencing PCR (BSP) analysis, and the primer sequences used for BSP were as follows: pre-miR-16-1 amplicon, GTTGAAAAGGGTGGTAGTGAATAG (forward) and AAATTCATAACAACACCAACTCCA (reverse); pre-miR-16-2 amplicon, TTAGAAGGTTGAGTTGAAAGTTGT (forward) and TCCACAAAACAACTCTAAATATCC (reverse). Finally, the PCR products were cloned into the pLB-Simple vector (Tiangen Biotech, China). Methylation levels of each CpG site were analyzed by randomly sequencing 50 clones of pLB-pre-miR-16-1/2 amplicon transformed Escherichia coli.
Indirect immunofluorescence antibody (IFA) assay.DF-1 cells were transfected with miRNA mimics or controls for 24 h at a concentration of 100 nM, followed by infection with IBDV at an MOI of 0.1 for 24 h. The cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, blocked with 1% bovine serum albumin (BSA), and incubated with anti-IBDV VP2 monoclonal antibody, followed by incubation with FITC-conjugated goat anti-mouse IgG antibodies. The cells were examined with a fluorescence microscope (Nikon, Japan).
Examination of the effects of gga-miR-16-5p mimics or inhibitors on IBDV replication and Bcl-2 expression by Western blot assay.DF-1 cells were seeded on 12-well plates and cultured for 24 h before transfection with miRNA controls or gga-miR-16-5p mimics or inhibitors using Lipofectamine 2000. To examine the effect of miR-16-5p on IBDV replication, DF-1 cells were transfected with miRNAs. Twenty-four hours after transfection, cells were mock infected or infected with IBDV at an MOI of 0.1 for 24 h. Cell lysates were prepared using a lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP-40, 10% glycerol, 1× complete cocktail protease inhibitor), boiled with SDS loading buffer for 10 min, and fractionated by electrophoresis on 12% SDS-PAGE gels; the resolved proteins were then transferred onto polyvinylidene difluoride (PVDF) membranes. After being blocked with 5% skimmed milk, the membranes were incubated with anti-VP2 or anti-GAPDH antibodies, followed by incubation with HRP-conjugated secondary antibodies. To determine the effect of miR-16-5p on its target in host cells, DF-1 cells were transfected with miRNAs. Forty-eight hours after transfection, the cell lysates were harvested for Western blot analysis using anti-Bcl-2 or anti-β-actin antibodies, followed by detection with HRP-conjugated secondary antibodies. Blots were developed using an enhanced chemiluminescence (ECL) kit (Millipore) per the manufacturer’s instructions. Data are presented as means ± standard deviations (SD) of three independent experiments.
Measurement of IBDV growth in DF-1 cells.Normal cells or cells receiving miRNA controls, miR-16-5p mimics (100 nM per well), or inhibitors (200 nM per well) were infected with IBDV at an MOI of 0.1, and cell cultures were collected at different time points (12, 24, 48 and 72 h) postinfection. Cell cultures were subjected to three freeze-thaw cycles and centrifuged at 6,000 × g for 10 min. The viral contents in the supernatants and total cell lysates were titrated using 50% tissue culture infective doses (TCID50s) in DF-1 cells. Briefly, the viral solution was serially diluted by 10-fold in DMEM. A 100-μl aliquot of each diluted sample was added to the well of 96-well plates, followed by addition of 100 μl of DF-1 cells at a density of 5 × 105 cells/ml. Cells were cultured for 7 days at 37°C in a 5% CO2 incubator. Tissue culture wells with cytopathic effect (CPE) were determined to be positive. The titer was calculated based on a previously described method (68).
Apoptosis assay.DF-1 cells were seeded on 12-well plates and cultured for 24 h, followed by transfection with miRNA controls, miR-16-5p mimics, or inhibitors for 24, 48, or 72 h; cells were trypsinized and stained with PE–annexin-V alone or doubly stained with PE–annexin-V and 7-amino-actinomycin D (7-AAD) using an apoptosis detection kit per the manufacturer’s instructions, and the cells were gated for further analysis of apoptosis by flow cytometry. The cells positive for annexin-V–PE were gated for further analysis of apoptotic cells with CellQuest software (BD). To determine the effect of miR-16-5p on IBDV-induced apoptosis, DF-1 cells were cultured and transfected as described above. Twenty-four hours after transfection, cells were infected with IBDV at an MOI of 0.1 and harvested at different time points (24, 48, and 72 h). Samples were subjected to flow cytometry analysis as described above. Data were presented as means ± standard deviations (SD) of three independent experiments.
Dual-luciferase reporter gene assays.DF-1 cells were seeded on 24-well plates and cultured overnight, followed by transfection with luciferase reporter gene plasmids (pGL3-target-bcl-2 mutant or pGL3-target-bcl-2 wt) and miRNA mimics, inhibitors, or miRNA controls. To normalize for transfection efficiency, a plasmid expressing another pRL-TK Renilla luciferase reporter gene was added to each transfection as a control. Forty-eight hours posttransfection, luciferase reporter gene assays were performed with a dual-luciferase reporter assay system. Firefly luciferase activities were normalized on the basis of Renilla luciferase activities. Data are presented as means ± standard deviations (SD) of three independent experiments.
Measurement of cytochrome c release.The isolation of mitochondria and cytosol was performed using a cell mitochondrion isolation kit (Beyotime Biotechnology, China). Briefly, DF-1 cells were transfected with miRNAs for 24 h, followed by mock infection or infection with IBDV at an MOI of 0.1 for 24 and 48 h. Untreated cells or cells receiving miRNAs were incubated in 100 μl of ice-cold mitochondrion lysis buffer on ice for 15 min, and cell suspensions were homogenized on ice with a Dounce grinder. The homogenates were centrifuged at 600 × g for 10 min at 4°C, and the supernatant was obtained and then centrifuged again at 12,000 × g for 20 min at 4°C. The supernatant was examined for cytochrome c release by Western blotting using anti-cytochrome c antibodies.
Caspase-3 and -9 activity assays.DF-1 cells were seeded on six-well plates before being transfected with miR-16-5p mimics, inhibitors, or controls. Twenty-four hours after transfection, cells were mock infected or infected with IBDV at an MOI of 0.1. Twenty-four or 48 h after infection, cell lysates were prepared and examined for caspase-3 and -9 activities using caspase-3 and -9 activity assay kits per the manufacturer’s instructions. Samples were measured at 405 nm with a microplate reader (Tecan; Sunrise) using the fluorescent substrate DEVD-pNA (synthetic caspase-3 substrate) or LEHD-pNA (synthetic caspase-9 substrate). Data are representative of three independent experiments and presented as means ± SD.
Statistical analysis.The significance of the differences between results with IBDV infection and those with mock controls and between gga-miR-16-5p mimics/inhibitors and those with the miRNA controls in gene expression, apoptosis, cytochrome c release, caspase activity, and viral growth was determined by a Mann-Whitney test or analysis of variance (ANOVA) accordingly.
The results of the deep sequencing assay are available in the GEO database under accession number GSE90095 (31, 32).
ACKNOWLEDGMENTS
We thank Jue Liu and Wenhai Feng for their kind assistance.
This work was supported by grants from the National Natural Science Foundation of China (grant no. 31430085) and Earmarked Fund for Modern Agro-industry Technology Research System (grant no. NYCYTX-40).
FOOTNOTES
- Received 6 October 2019.
- Accepted 22 October 2019.
- Accepted manuscript posted online 6 November 2019.
- Copyright © 2020 American Society for Microbiology.
