ABSTRACT
The presence of T cell reservoirs in which human immunodeficiency virus (HIV) establishes latency by integrating into the host genome represents a major obstacle to an HIV cure and has prompted the development of strategies aimed at the eradication of HIV from latently infected cells. The “shock-and-kill” strategy is one of the most pursued approaches to the elimination of viral reservoirs. Although several latency-reversing agents (LRAs) have shown promising reactivation activity, they have failed to eliminate the cellular reservoir. In this study, we evaluated a novel immune system-mediated approach to clearing the HIV reservoir, based on a combination of innate immune stimulation and epigenetic reprogramming. The combination of the STING agonist cGAMP (cyclic GMP-AMP) and the FDA-approved histone deacetylase inhibitor resminostat resulted in a significant increase in HIV proviral reactivation and specific apoptosis in HIV-infected cells in vitro. Reductions in the proportion of HIV-harboring cells and the total amount of HIV DNA were also observed in CD4+ central memory T (TCM) cells, a primary cell model of latency, where resminostat alone or together with cGAMP induced high levels of selective cell death. Finally, high levels of cell-associated HIV RNA were detected ex vivo in peripheral blood mononuclear cells (PBMCs) and CD4+ T cells from individuals on suppressive antiretroviral therapy (ART). Although synergism was not detected in PBMCs with the combination, viral RNA expression was significantly increased in CD4+ T cells. Collectively, these results represent a promising step toward HIV eradication by demonstrating the potential of innate immune activation and epigenetic modulation for reducing the viral reservoir and inducing specific death of HIV-infected cells.
IMPORTANCE One of the challenges associated with HIV-1 infection is that despite antiretroviral therapies that reduce HIV-1 loads to undetectable levels, proviral DNA remains dormant in a subpopulation of T lymphocytes. Numerous strategies to clear residual virus by reactivating latent virus and eliminating the reservoir of HIV-1 (so-called “shock-and-kill” strategies) have been proposed. In the present study, we use a combination of small molecules that activate the cGAS-STING antiviral innate immune response (the di-cyclic nucleotide cGAMP) and epigenetic modulators (histone deacetylase inhibitors) that induce reactivation and HIV-infected T cell killing in cell lines, primary T lymphocytes, and patient samples. These studies represent a novel strategy for HIV eradication by reducing the viral reservoir and inducing specific death of HIV-infected cells.
INTRODUCTION
The advent of combined antiretroviral therapy (cART) revolutionized the treatment of individuals living with human immunodeficiency virus type 1 (HIV-1). ART suppressed viral replication below the limit of detection in clinical assays, delayed disease progression, restored immune system function, and reduced the risk of HIV transmission (1). Despite these achievements, interruption of ART leads to rapid viral rebound, indicating that lifelong adherence to treatment is required (2). In fact, HIV preferentially establishes latency in CD4+ central memory T (TCM) cells (3–5), where the virus persists in a quiescent state that is essentially invisible to the immune system and ART (6). Among several strategies currently being tested to eradicate HIV infection, the “shock-and-kill” strategy has been intensively studied (7); it consists of pharmacological reactivation of proviral gene expression and replication, followed by killing of infected cells through a virus-induced cytopathic effect or by the immune system. To date, different latency-reversing agents (LRAs) have been identified, including protein kinase C (PKC) agonists, histone deacetylase (HDAC) inhibitors (HDIs), histone methylation inhibitors (HMTi), DNA methyltransferase inhibitors (DNMTi), inhibitors of bromodomain and extraterminal (BET) domain proteins (BETi), and unclassified agents, such as disulfiram (8, 9). Only a limited number of these agents have been studied in clinical trials, and the most promising results were obtained with the HDIs (10–13).
The HDI vorinostat (suberoylanilide hydroxamic acid [SAHA]), approved by the FDA in 2006 for the treatment of cutaneous T cell lymphoma (14), is one of the best-studied LRAs in clinical applications. To date, the use of HDIs as LRAs has demonstrated the potential to reverse HIV latency and increase plasma HIV RNA levels. However, despite reversing HIV latency, the use of HDIs alone during ART treatment did not demonstrate a reduction in the frequency of latently infected cells (8). Several related observations highlight the fact that a single LRA is not sufficient to clear the HIV reservoir, leading to the concept that combination treatment with different classes of LRAs could improve the “kill” side.
The induction of the innate immune response plays a critical role in the early host response to virus infection. Recognition of viral pathogens by the innate immune system through the pattern recognition receptors (PRR), including the Toll-like receptors, the cGAS–STING cytosolic DNA-sensing pathway, and the retinoic acid-inducible gene I (RIG-I) pathway, can induce apoptosis in virus-infected cells (15–19), suggesting that stimulation of innate immunity could improve the shock-and-kill strategy. Immunotherapy has been shown to improve the recovery of CD4+ T cells and to induce an HIV-specific T cell response (20), and several immune modulators have been tested as LRAs, including T cell activators, the cytokine interleukin-2 (IL-2), and a T cell receptor (TCR) agonist: a murine anti-CD3 monoclonal antibody. Despite the ability to induce reactivation, these agents caused severe toxicities without reducing the latent reservoir (7). Furthermore, the RIG-I agonist acitretin, an FDA-approved retinoic acid derivative, was recently shown to reactivate latent HIV and induce the selective apoptosis of latently HIV infected cells in vitro (21). However, a subsequent study that evaluated acitretin as an LRA in latently infected cell lines and patient-derived samples failed to extend these observations (22). A recent study demonstrated that the STING agonists 2′3′-cGAMP and cyclic di-AMP were able to decrease the amount of simian immunodeficiency virus (SIV) Gag in the DNA of peripheral blood mononuclear cells (PBMCs) obtained from monkeys exhibiting natural SIV control at 40 weeks postinfection (23). However, only cyclic di-AMP reactivated latent HIV in a primary CD4+ T cell model of HIV-1 latency established after activation through the T cell receptor and the subsequent return to quiescence.
To date, it remains unclear whether a combination of LRAs and immunotherapy could be the key to clearing HIV reservoirs. In the present study, we demonstrate that the combination of the cGAS-STING agonist cGAMP (cyclic GMP-AMP) and the FDA-approved histone deacetylase inhibitor resminostat resulted in a significant increase in HIV proviral reactivation and specific apoptosis in HIV-infected cells in vitro. These results are encouraging, although further studies are required to determine whether this approach can be used to eliminate latently infected cells in HIV-1 carriers.
RESULTS
cGAMP induces modest reactivation in vitro without affecting cell death.Recent achievements in cancer immunotherapy (24–26) have raised the possibility that the application of immunotherapeutic approaches to other fields, including HIV research, could promote the clearance of the latent HIV-1 reservoir (6, 27, 28). To evaluate the abilities of immunostimulatory biologic agents to induce the reactivation of HIV-1 provirus and to selectively induce the death of latently HIV-1-infected cells, we first analyzed the effects of three different agonists of innate immunity—the RIG-I agonist M8, previously characterized by our group (29), and the STING agonists cGAMP and c-di-GMP (the cyclic dinucleotide of GMP)—on HIV-1 reactivation in J-Lat 10.6 cells, an in vitro model of HIV-1 latency that contains a green fluorescent protein (GFP) gene substitution in the Nef open reading frame (ORF) (30). The HIV-1-free cell line Jurkat E6.1 was used as an uninfected control to test the cytotoxicities of the compounds analyzed.
The activities of M8, cGAMP, and c-di-GMP were compared to that of acitretin, a RIG-I agonist that was previously shown to reactivate latent provirus and selectively kill infected cells (21), while dimethyl sulfoxide (DMSO) and the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) were used as negative and positive controls, respectively (Fig. 1). Briefly, Jurkat and J-Lat cells either were treated with cGAMP, c-di-GMP, or acitretin or were transfected with M8; cells were analyzed by fluorescence-activated cell sorting (FACS) at 24 h to evaluate GFP expression as a marker of viral reactivation; and dead cells were excluded from the analysis by 7-aminoactinomycin D (7-AAD) staining. Interestingly, only the STING agonist cGAMP exhibited the ability to induce a low but significant increase in the proportion of GFP-expressing cells (Fig. 1A), while FACS analysis of cell death failed to show any significant difference between compounds, except for the positive control (P ≤ 0.001) (Fig. 1B). Given the ability of cGAMP to activate STING and thus to stimulate type I interferon (IFN-I) and NF-κB signaling in the modulation of HIV transcription (31), IFN-β, CXCL10, and IL-8 gene expression was measured by quantitative PCR (qPCR) as representative examples of antiviral and NF-κB-regulated inflammatory genes that are activated by the cGAS-STING pathway following cGAMP treatment. Analysis of mRNA showed that cGAMP increased antiviral and NF-κB-related gene expression, which reflected modest increases in the level of viral mRNA (Fig. 1C and D). In addition, dose-dependent activation of NF-κB was observed in cells treated with increasing concentrations of cGAMP, as indicated by the degradation of IκBα (Fig. 1E). IκBα turnover occurs as a consequence of phosphorylation on Ser32 and Ser36 by IκB kinase (IKK), leading to the ubiquitination and proteasome-mediated degradation of IκBα; hence, its turnover is a measure of NF-κB signaling. These results indicate the involvement of the NF-κB pathway in cGAMP-dependent reactivation of proviral DNA transcription.
cGAMP-induced HIV reactivation relies on NF-κB activation. (A) (Left) Percentage of GFP-expressing cells, indicating latent HIV reactivation, measured by flow cytometry. J-Lat 10.6 cells were seeded at a density of 0.5 × 106/ml in 24-well plates and either were treated for 24 h with acitretin (5 μM), c-di-GMP (10 μM), or cGAMP (10 μg/ml) or were transfected with M8 (10 ng/ml) for 48 h. DMSO and TNF-α were used as negative and positive controls, respectively. (Right) FACS analysis of GFP-positive cells at 24 h posttreatment. (B) Viability of J-Lat 10.6 cells, assessed by 7-AAD exclusion at 48 h posttreatment. (Left) Percentage of 7-AAD-positive cells as an indicator of cell death; (right) flow cytometer gating strategy of 7-AAD-positive cells at 48 h posttreatment. (C) Expression levels of IFN-β, CXCL10, and IL-8 genes in J-Lat 10.6 cells assessed by qPCR 12 h after stimulation with cGAMP (10 μg/ml). Data are represented as fold increases over control levels. (D) Expression levels of the 5′ LTR gag and tat/rev genes in J-Lat 10.6 cells, assessed by qPCR 24 h after stimulation with cGAMP (10 μg/ml). Data are represented as fold increases over control levels. (E) Immunoblot analysis of whole-cell extracts (30 μg) obtained from a total of 0.2 × 106 cells treated for 24 h with different concentrations of cGAMP (1, 10, or 50 μg/ml) and then blotted for IκBα. Results were normalized to those for GAPDH. (F) Percentage of GFP-positive J-Lat 10.6 cells seeded at a concentration of 0.5 × 106 in a 48-well plate treated with an antibody against interferon α/β receptor chain 2 (1 μg/ml) or pretreated for 1 h with PS1145 (20 μM) prior to cGAMP (10 μg/ml) treatment for 24 h. Values represent means ± SD for triplicate samples from the J-Lat 10.6 infection model, representative of three independent experiments. Student’s t test was used to compare experimental conditions. **, P ≤ 0.01; ***, P ≤ 0.001.
To determine whether HIV reactivation relied on NF-κB or IFN-I signaling or both, cells were treated for 24 h with cGAMP in the presence or absence of PS1145, an NF-κB inhibitor that prevents IKKβ phosphorylation, and in the presence or absence of an antibody against interferon α/β receptor chain 2 (IFNAR2), to block the type I IFN receptor. Blockade of the type I IFN receptor did not elicit any effect in terms of proviral reactivation, whereas inhibition of the NF-κB pathway resulted in a significant reduction in the proportion of GFP-expressing cells (P ≤ 0.01), thus confirming that cGAMP stimulated HIV reactivation at least in part by triggering NF-κB signaling (Fig. 1F).
cGAMP and resminostat increase HIV reactivation and induce apoptotic cell death in vitro.The role of histone deacetylases (HDACs) in maintaining HIV latency has been well documented (32–34), and likewise, the ability of histone deacetylase inhibitors (HDIs) to modulate the state of chromatin, leading to the accessibility of transcriptional complexes, has emerged as a promising approach to purging the reservoir of persistent infection (35–38). To improve latent provirus reactivation and to determine if the synergistic activity of two LRAs could induce selective killing of infected cells, we tested cGAMP in association with different HDIs, targeting distinct HDACs: the pan-inhibitor SAHA (suberoylanilide hydroxamic acid; also called vorinostat), the HDAC6-selective inhibitor BRD9757, and the FDA-approved HDI resminostat. After 24 h of treatment with different combinations, the levels of GFP-expressing cells were analyzed by flow cytometry and fluorescence microscopy, and synergism between the compounds was measured using the Bliss independence model. A synergistic relationship between cGAMP and resminostat was quantified, and a significant increase (P ≤ 0.01) in reactivation was identified (Fig. 2A and B). Interestingly, the administration of this combination also resulted in a dramatic increase in the proportion of cell death (∼40%) among HIV-infected cells, while only minimal toxicity (∼10%, or 3.5-fold above the control level) was observed in Jurkat cells, and these levels were significantly lower than those in J-Lat cells (P ≤ 0.001) and significantly lower than those obtained with drugs with high reactivation potential, such as the HDI romidepsin (P < 0.001) (13, 39, 40) (Fig. 2C). These results highlight the potential efficacy of this treatment in terms of latency reversal and reduction of the HIV reservoir, suggesting the combination as a promising strategy for overcoming HIV persistence. Surprisingly, SAHA did not exert a significant effect either in terms of reactivation or in terms of cell death. To verify that J-Lat cells were responsive to SAHA, we assessed the acetylation of α-tubulin and histone H3 in the presence of SAHA or resminostat alone or in combination with cGAMP at 24 h. Both HDIs were able to induce acetylation of intranuclear and cytosolic targets without impairing STING activation (Fig. 2D and E), suggesting that the latency reversal activity observed with resminostat was in direct contrast to the effect exerted by SAHA.
Evaluation of HIV reactivation and HIV-infected-cell death. (A) Flow cytometry measurement of GFP-expressing cells after 24 h of treatment with different HDIs alone or in combination with cGAMP (10 μg/ml). Cells were seeded at a concentration of 0.5 × 106 in a 48-well plate and were treated with different concentrations of HDIs: SAHA (0.35 μM), BRD9757 (10 μM), or resminostat (2 μM). DMSO was used as a negative control; TNF-α and romidepsin were used as positive controls (20 ng/ml and 20 nM, respectively). Synergistic interaction between compounds was evaluated by using the Bliss independence model, as described in Materials and Methods. (B) Representative images of GFP-expressing cells. J-Lat 10.6 cells were seeded at a concentration of 0.5 × 106 in a 24-well plate and were treated for 24 h with the indicated compounds. GFP expression was observed under a fluorescence microscope at ×10 magnification. (C) Analysis of cell death in the Jurkat E6.1 (open bars) and J-Lat 10.6 (filled bars) cell lines after 48 h of treatment. A combination of resminostat and cGAMP leads to specific death of infected cells. 7-AAD was used for cell death measurement by flow cytometry. (D) Immunoblot analysis of whole-cell extracts (30 μg) obtained from a total of 0.2 × 106 cells treated for 24 h and blotted for acetyl-α-tubulin, α-tubulin, acetyl-histone H3, and histone H3. Results were normalized to those for GAPDH. Both SAHA and resminostat induce acetylation of α-tubulin and histone H3. (E) Immunoblot analysis of dimerization gels from whole-cell extracts (30 μg) obtained from a total of 0.2 × 106 cells after 7 h of treatment and blotted for IRF3 and STING. Results were normalized to those for GAPDH. The presence of HDIs does not impair cGAMP-induced activation of STING and IRF3. Values represent means ± SD for triplicate samples from the J-Lat 10.6 and Jurkat E6.1 cell models, representative of three independent experiments. Student’s t test was used to compare experimental conditions. *, P < 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.
Resminostat-induced HIV-1 latency reversal is partially regulated through NF-κB stimulation.We next investigated whether the increase in reactivation observed with resminostat plus cGAMP was dependent on activation of the NF-κB pathway. J-Lat cells were treated for 48 h with resminostat and cGAMP, alone or in combination, in the presence or absence of the NF-κB inhibitor PS1145. Blocking the NF-κB signaling significantly (P < 0.05) interfered with HIV transcription and decreased the reactivation induced by resminostat, alone or in combination with cGAMP (Fig. 3A). However, this reduction did not completely abrogate GFP expression, suggesting the involvement of other pathways in this process. To further confirm the impact of NF-κB signaling in the induction of HIV reactivation by resminostat plus cGAMP, an engineered J-Lat 10.6 cell model expressing the NF-κB superrepressor IκBα 2NΔ4 (J-Lat 2NΔ4 cells) (41) was used and was compared to J-Lat NEO control cells, carrying the gene for neomycin resistance, as a control. In J-Lat 2NΔ4 cells, IκBα 2NΔ4 Ser32 and Ser36 were mutated to inert alanine residues (Ala32 and Ala36), and IκBα was not phosphorylated or degraded as a consequence of NF-κB-activating stimuli (42). In addition, a 22-amino-acid deletion (Δ4) in the PEST domain stabilized the protein by reducing its physiological turnover and also distinguished IκBα 2NΔ4 from wild-type (wt) IκBα because of its smaller size (42–44) (Fig. 3B). J-Lat NEO and J-Lat 2NΔ4 cells were treated with resminostat or cGAMP alone or in combination, and HIV reactivation was assessed by flow cytometry at 24 h. The significant reduction (P < 0.05) in the percentage of GFP-expressing cells among J-Lat 2NΔ4 cells further demonstrated the requirement for NF-κB activation in latency reversal induced by resminostat plus cGAMP. Again, blockade of NF-κB was not sufficient to completely abolish HIV reactivation, confirming the hypothesis that other host factors may be involved in latency reversal mediated by resminostat plus cGAMP (45–51) (Fig. 3C). Interestingly, no statistically significant differences in the level of cell death were found between J-Lat NEO and J-Lat 2NΔ4 cells, indicating that the mechanism of cell death triggered by this combination of LRAs is independent of viral reactivation (Fig. 3D).
Inhibition of NF-κB impairs reactivation in J-Lat 10.6 cells. (A) Percentage of GFP-expressing J-Lat 10.6 cells after seeding at a concentration of 0.5 × 106 in a 48-well plate, pretreatment for 1 h with PS1145 (20 μM), and treatment for 24 h with resminostat (2 μM), cGAMP (10 μg/ml), or a combination of resminostat and cGAMP. DMSO was used as a negative control, and TNF-α (20 ng/ml) was used as a positive control. (B) Expression of the NF-κB superrepressor in J-Lat 10.6 cells. Fifty micrograms of whole-cell extracts, from a total of 1 × 106 cells for each experimental point, was subjected to SDS-PAGE on a precast 4%-to-20% Tris-glycine gradient gel and to Western blotting using a specific anti-IκBα antibody. The results were normalized to those for α-tubulin. (C) Percentage of GFP-expressing J-Lat NEO and J-Lat 2NΔ4 cells treated for 24 h with resminostat (2 μM), cGAMP (10 μg/ml), or a combination of resminostat and cGAMP. DMSO was used as a negative control, and TNF-α (20 ng/ml) was used as a positive control. (D) Analysis of cell death in J-Lat NEO and J-Lat 2NΔ4 cells after 48 h of treatment. 7-AAD was used for cell death measurement by flow cytometry. Values represent means ± SD for triplicate samples from the J-Lat 10.6, J-Lat NEO, and J-Lat 2NΔ4 cell models, representative of three independent experiments. Student’s t test was used to compare experimental conditions. *, P < 0.05; ***, P ≤ 0.001.
cGAMP potentiates apoptosis selectively in HIV-harboring cells.Several LRAs have demonstrated a capacity to stimulate HIV provirus reactivation, but with limited reduction of the viral reservoir (6, 10, 52–56). To investigate further whether cell death was triggered by the combination of resminostat and cGAMP, annexin V staining was used to evaluate apoptosis after this treatment. cGAMP dramatically increased the apoptosis initiated by resminostat (Fig. 4A to C), as reflected in the higher levels of cleaved poly(ADP-ribose) polymerase (PARP) (Fig. 4B), a typical marker of caspase involvement in cells undergoing apoptosis. Also, the expression levels of Noxa, PUMA (p53-upregulated modulator of apoptosis), and TRAIL (TNF-related apoptosis-inducing ligand), critical components of the intrinsic and extrinsic activation of apoptosis, were dramatically increased (∼3.5-, ∼9-, and ∼4.5-fold, respectively) by combination treatment (Fig. 4E). Interestingly, cell death occurred selectively in latent J-Lat 10.6 cells, while minimal apoptosis was observed in uninfected Jurkat cells. Pharmacological inhibition of caspases by the pancaspase inhibitor Z-VAD-FMK reduced cell death to ∼5% or ∼20% in cells treated with resminostat alone or resminostat plus cGAMP, respectively, confirming the involvement of the caspase cascade (Fig. 4D) in the death of J-Lat 10.6 cells. Furthermore, both resminostat and cGAMP increased the expression of genes related to intrinsic as well as extrinsic apoptosis in the HIV-1 latency model (Fig. 4E).
Evaluation of apoptosis in J-Lat cells. (A) Percentage of annexin V-positive cells. J-Lat cells were seeded at a concentration of 0.5 × 106 in a 48-well plate and were treated with the indicated compounds. Cells were collected at 16 h after treatment and were stained with an APC-conjugated annexin V antibody. The levels of annexin V on cell surfaces were assessed by flow cytometry. (B) Immunoblot analysis of whole-cell extracts (30 μg) obtained from a total of 0.2 × 106 cells after 20 h of treatment and blotted for PARP. The results were normalized to those for GAPDH. Increased levels of cleaved PARP are noticeable with the addition of cGAMP to resminostat, indicating the triggering of apoptosis. (C) FACS analysis representative of annexin V- and 7-AAD-positive cells at 16 h posttreatment, indicating early stages of apoptosis (cells positive for annexin V only) and late stages, or necrotic death (cells positive for both annexin V and 7-AAD). (D) Viability of J-Lat 10.6 cells measured at 24 h in the presence or absence of the pancaspase inhibitor Z-VAD-FMK (20 μM). Cells were seeded at a concentration of 0.5 × 106 in a 48-well plate and were pretreated with ZVAD-FMK for 1 h before the addition of the indicated compounds. (E) Expression levels of the NOXA, PUMA, and TRAIL genes in J-Lat 10.6 cells assessed by qPCR 16 h after stimulation with the indicated compounds. Data are represented as fold increases over control (DMSO) levels. Values represent means ± SD for triplicate samples, representative of three independent experiments. Student’s t test was used to compare experimental conditions. **, P ≤ 0.01; ***, P ≤ 0.001.
To evaluate the efficacy of cGAMP and resminostat in a different model of HIV latency in vitro, the latently HIV-infected human T cell line ACH-2 was examined (57). ACH-2 cells showed a clear (>80-fold over control) increase in HIV p24 expression after treatment with resminostat plus cGAMP (Fig. 5A), and again, NF-κB inhibition by PS1145 resulted in a reduction in HIV p24 expression, thus confirming the observations with J-Lat cells (Fig. 5B). These results highlighted the ability of the combination of resminostat and cGAMP to stimulate HIV reactivation in different cell models in vitro in an NF-κB dependent manner. Furthermore, analysis of cell death in ACH-2 cells and their parental cell line CEM A3.01 confirmed that high levels of death (>40% in the presence of the combination) were observed in ACH-2 cells, whereas no significant death (<10%) was detected in the parental cell line (P ≤ 0.01); this observation is in contrast with the results obtained with romidepsin, which induced high toxicity in both cell lines (Fig. 5C). In addition, JC-1 staining, used to assess the loss of mitochondrial transmembrane potential during apoptosis, revealed that resminostat triggered apoptosis by inducing depolarization of the mitochondrial membrane and that the addition of cGAMP increased the percentage of cells exhibiting the loss of membrane potential from ≈20% to ≈40% (Fig. 5D). These data complement the results with the J-Lat cell model and confirm the ability of resminostat and cGAMP to reactivate latent HIV and induce specific apoptosis of infected cells in vitro.
Evaluation of HIV reactivation and cell death in ACH-2 cells. (A) Expression of the HIV p24 protein in ACH-2 cells. (Left) Thirty micrograms of whole-cell extracts, from a total of 0.2 × 106 cells for each experimental point, was subjected to SDS-PAGE on a precast 4%-to-20% Tris-glycine gradient gel and to Western blotting using a specific anti-p24 antibody. The results were normalized to those for GAPDH. (Right) Schematic representation of p24 levels, expressed as fold increases over control (DMSO) levels. (B) Expression of HIV p24 in ACH-2 cells in the presence or absence of PS1145. ACH-2 cells were seeded at a concentration of 0.5 × 106 in a 48-well plate and were pretreated for 1 h with PS1145 (20 μM) prior to 48 h of treatment with the indicated compounds. Thirty micrograms of whole-cell extracts, from a total of 0.2 × 106 cells for each experimental point, was subjected to SDS-PAGE on a precast 4%-to-20% Tris-glycine gradient gel and to Western blotting using a specific anti-p24 antibody. The results were normalized to those for GAPDH. (C) Analysis of cell death in the CEM A3.01 (open bars) and ACH-2 (filled bars) cell lines after 48 h of treatment. The combination of resminostat and cGAMP leads to specific death of infected cells, while romidepsin (20 nM) induces high mortality in uninfected cells also. 7-AAD was used for the measurement of cell death levels by flow cytometry. (D) Measurement of mitochondrial membrane potential by a JC-1 staining assay. Twenty-four hours posttreatment, cells were harvested, centrifuged, and resuspended in PBS plus JC-1 (2 μM). After 30 min of incubation at 37°C, cells were washed in PBS, and depolarization of the mitochondrial membrane was assessed by flow cytometry. The percentages of cells that lost membrane potential are shown. Values represent means ± SD for triplicate samples, representative of three independent experiments. Student’s t test was used to compare experimental conditions. *, P < 0.05; **, P ≤ 0.01; ***, P ≤ 0.001.
Resminostat induces selective cell death in CD4+ TCM cells.To further evaluate the in vitro results, the same drug combination was tested in a primary CD4+ central memory T (TCM) cell model of HIV-1 latency, originally described by Bosque and Planelles (58), as a modification of previously described systems (49, 59, 60). TCM cells were infected with a pseudotyped HIV-1 luciferase reporter virus as described previously and were then treated with compounds at 72 h after infection (41). Resminostat alone induced low levels of reactivation at 24 h after treatment, while no latency reversal was observed with cGAMP or the combination (Fig. 6A). While cell death was not detected in HIV-harboring TCM cells at 24 h, significant cell death was observed at 48 h only in infected TCM cells (P < 0.001) (Fig. 6B and C). These results demonstrate that specific killing of latently infected cells was achieved, although proviral reactivation was not obtained.
Evaluation of reactivation and cell death in CD4+ central memory T (TCM) cells. (A) Analysis of latency reversal in TCM cells. A total of 1 × 106 CD4+ TCM cells for each experimental point, latently infected with an HIV-1 luciferase reporter virus, were treated for 24 h or 48 h with resminostat (2 μM), cGAMP (10 μg/ml), or a combination of resminostat and cGAMP. DMSO was used as a negative control, and anti-CD3/CD28 beads (bead-to-cell ratio, 1:1) were used as a positive control. Data are presented as fold luciferase induction, with the histogram plot indicating the average and SD for each experimental condition. Statistical analysis was performed using Student’s t test. (B) Cell death in CD4+ TCM cells that were either left uninfected (open bars) or infected (filled bars) with an HIV-1 luciferase reporter virus was analyzed at 48 h posttreatment. Cells were harvested, centrifuged for 5 min at 300 × g, resuspended in a mixture containing annexin V buffer, annexin V-APC, and Zombie NIR, and incubated for 15 min at RT in the dark. After incubation, 4% PFA was added to each sample, and levels of cell death/apoptosis were assessed by flow cytometry. (C) FACS analysis representative of annexin V- and Zombie NIR-positive cells at 48 h posttreatment, indicating early stages of apoptosis (cells positive for annexin V only) and late stages, or necrotic death (annexin V–Zombie NIR double-positive cells). (D) qPCR measurement of total HIV DNA levels from TCM cells obtained from four healthy donors and infected with an HIV-1 luciferase reporter virus, after 48 h of treatment with the indicated compounds. Values are represented as percentages of HIV DNA expression normalized to expression for the unstimulated control (set at 100%). Values represent means ± SD for triplicate samples, representative of three independent experiments. Student’s t test was used to compare experimental conditions (**, P ≤ 0.01; ***, P ≤ 0.001).
This conclusion was also supported by the decrease in the amount of HIV DNA in TCM cells in 3 of 4 donors in the presence of resminostat or the combination; furthermore, a decrease in the amount of HIV DNA was observed in all four donors treated with cGAMP alone (P < 0.05) (Fig. 6D). It is possible that the absence of reactivation in TCM cells relates to the role of NF-κB in viral reactivation in memory T cells, as observed previously (58). Taking our findings together, selective killing and the reduction in HIV DNA levels demonstrate the efficacy of the cGAMP-resminostat combination even in the absence of viral reactivation.
Reactivation of latent HIV in PBMCs and CD4+ T cells isolated from virologically suppressed patients.To extend these observations of HIV reactivation ex vivo, the combination of cGAMP and resminostat was evaluated in PBMCs obtained from virologically suppressed individuals from Umberto I University Hospital (Table 1). To evaluate latency reversal, cell-associated HIV RNA levels were measured using primers targeting the 5′ long terminal repeat (LTR)-ψ (long LTR) (a surrogate for initiation of transcription and proximal elongation) and tat/rev sequences (a surrogate for productive infection) (61). As shown in Fig. 7A, high levels of proviral DNA transcription (HIV 5′ LTR-ψ expression) were identified (up to 32-fold over control levels). However, no significant differences were detected in RNA levels induced under different conditions, and no tat/rev expression was observed in any of the patients’ PBMCs, indicating that fully spliced mRNA and viral proteins were not produced. In addition, CD4+ T cells isolated from virologically suppressed patients were evaluated ex vivo for the ability of cGAMP plus resminostat to induce viral reactivation. cGAMP increased the levels of HIV RNA (long LTR) alone (P = 0.07) and in combination with resminostat (P < 0.05) (Fig. 7B). Interestingly, resminostat alone did not induce reactivation in CD4+ T cells, in contrast to the reactivation observed in PBMCs, suggesting that the latency reversal effect exerted by resminostat ex vivo is not cell autonomous.
Patient characteristicsa
Measurement of HIV RNA in stimulated PBMCs and CD4+ T cells from ART-treated patients. (A) Levels of reactivation after 48 h of stimulation. PBMCs obtained from 10 ART-treated patients were seeded at a concentration of 1 × 106 for each experimental point and were treated with raltegravir (30 μM) for 1 h prior to the addition of DMSO, resminostat (2 μM), cGAMP (10 μg/ml), or PHA-L (10 μg/ml). HIV RNA levels are expressed as the fold increase in 5′ LTR-ψ (long LTR) expression over the control level under different conditions. (B) Levels of HIV RNA expression measured after 48 h of treatment in CD4+ T cells isolated from virologically suppressed patients. Cells were seeded at a concentration of 5 × 105 for each experimental point and were treated with raltegravir (30 μM) for 1 h prior to the addition of DMSO, resminostat (2 μM), or cGAMP (10 μg/ml). HIV RNA levels are expressed as the fold increase in 5′ LTR-ψ (long LTR) expression over the control level under different conditions. Student’s t test was used to compare experimental conditions. *, P < 0.05; **, P ≤ 0.01.
DISCUSSION
Several LRAs have demonstrated the ability to stimulate HIV provirus reactivation, but with limited reduction of the viral reservoir (6, 10, 52–56). Other factors, such as the impaired cytolytic capacity of CD8+ T cells or the intrinsic resistance of latently infected cells to cytotoxic T lymphocyte (CTL)-mediated cell killing, may also be involved in this complex process. Furthermore, HIV infection can impact both proapoptotic and antiapoptotic pathways, potentially favoring cell death or cell survival, respectively (62). Consequently, manipulation of the apoptotic system to favor cell death may lead to the clearance of latently infected cells after reactivation.
Although combined antiretroviral therapy (cART) is able to suppress the viral burden, HIV establishes latent infection in different cellular and tissue compartments, among which CD4+ central memory T (TCM) cells are considered to be the most important HIV-1 cellular reservoir (3, 63). These viral reservoirs represent the major obstacle to the eradication of HIV from infected patients, and interruption of cART rapidly leads to viral reactivation and rebound from these reservoirs. In recent years, several strategies for purging the viral reservoir have been proposed, and encouraging results have been obtained with the shock-and-kill approach. This two-step strategy consists of an initial reactivation of latent HIV provirus by latency-reversing agents (the “shock” phase), followed by a secondary cell death phase, where reactivated cells are targeted for destruction by the immune system or additional anti-HIV compounds (the “kill” phase).
We evaluated a novel strategy for clearing the HIV reservoir, based on the combination of innate immune stimulation and epigenetic reprogramming. Here we showed that the STING agonist cGAMP induced low levels of reactivation in J-Lat 10.6 cells, an in vitro cell line model of HIV latency. The transcription of the provirus was driven in an NF-κB-dependent fashion, as evidenced by the fact that inhibition of this pathway drastically impaired reactivation. These results also highlighted the fact that the “shock” phase was not associated with an increase in cell death. Thus, to further amplify the magnitude of latency reversal and to induce cell death in HIV-harboring cells, we combined cGAMP with the FDA-approved HDAC inhibitor resminostat. This treatment led to a synergistic potentiation of the latency reversal effect exerted by each single drug, resulting in a significant increase in the percentage of GFP-expressing cells, indicating that the combination of these two LRAs is a valid approach to amplifying viral reactivation in vitro. We also confirmed that this increment relied mainly on NF-κB activation, as demonstrated by the inhibition of this pathway by pharmacological treatment with the IKKβ inhibitor PS1145 or by using a J-Lat cell model expressing the NF-κB superrepressor (J-Lat 2NΔ4). However, neither PS1145 nor expression of the NF-κB superrepressor was able to abrogate the reactivation completely, suggesting that other pathways might be involved in this process. Interestingly, this significant gain in reactivation was associated with a dramatic increment of selective cell death, observed in HIV-infected cells but not in the Jurkat cell line counterpart. Furthermore, high levels of cell death were found in both J-Lat 2NΔ4 cells and their relative control J-Lat NEO cells, despite differences in the levels of viral reactivation. These observations indicate that selective death in HIV-harboring cells occurs independently of latency reversal phenomena. Indeed, cGAMP was able to enhance the basal levels of cell death elicited by resminostat, and further analysis demonstrated that the killing of infected cells occurs through apoptotic mechanisms, triggered at early time points (16 h). The effects exerted by this combination were additionally confirmed in ACH-2 cells, another model of latency in vitro, carrying HIV proviruses defective in the Tat–Tat-responsive element (TAR) axis of HIV transcription. In these cells, the combined treatment resulted in amplified reactivation and selective cell death, the latter mediated by mitochondrial membrane depolarization, indicating the involvement of the intrinsic pathway of the apoptotic process. These results help us to delineate the mechanisms of latency reversal in vitro, demonstrating that reactivation occurs by a mechanism that is in part dependent on NF-κB signaling and independent of Tat protein, whereas the selective killing of HIV-harboring cells is triggered by apoptotic mechanisms.
We also evaluated the response in HIV-infected primary CD4+ TCM cells, which represent a predominant reservoir of HIV in vivo. TCM cells exhibited low levels of reactivation at 24 h after treatment with resminostat, whereas combination with cGAMP reduced this effect. Interestingly, at 48 h, a marked increase in the mortality of HIV-infected cells was observed in the presence of resminostat, alone or in combination with cGAMP. In support of this result, total HIV DNA was reduced in infected TCM cells, and latent provirus levels decreased after cGAMP treatment alone in 4 out of 4 donors (P < 0.05) and after resminostat treatment alone or with the combination in 3 out of 4 donors. One possible explanation for the disparity between latency reactivation and cell death in primary TCM cells may be that NF-κB induction does not occur in memory T cells (58); in its absence, prosurvival activities associated with NF-κB signaling fail to restrict apoptosis triggered by cGAMP and resminostat.
Finally, the ability of cGAMP and resminostat to prime proviral transcription was assessed in a small-scale analysis of PBMCs or CD4+ T cells isolated from ART-treated individuals. In PBMCs, resminostat, cGAMP, and the combination stimulated HIV reactivation to similar levels. Measurement of cell-associated HIV RNA indicated the presence of early viral transcripts (HIV 5′ LTR-ψ), but no evidence of mature or multispliced RNA was obtained, and, perhaps as expected, a high variability of response was observed in different patients. Possibly, the small amount of RNA obtained from PBMCs affected the results by increasing the variability of the response and limiting the detection of multiply spliced RNA species or a replication-competent virus, which is usually present at very low levels (∼5%) in ART-treated patients (64). In CD4+ T cells, statistically significant reactivation was observed only with the combination of resminostat and cGAMP (P < 0.05), whereas increased levels of the HIV LTR were detected in the presence of cGAMP alone, but the increase was not statistically significant (P = 0.07).
Taken together, these results highlight the therapeutic potential of combining innate immune and epigenetic modulators as a strategy for HIV eradication. The combination of the HDI resminostat with the induction of the cGAS-STING antiviral response not only amplified latency reactivation but also induced specific death of HIV-infected cells. Further investigations are required to increase the magnitude of reactivation ex vivo and to evaluate whether this combination will elicit a specific immune response against latently HIV-infected cells.
MATERIALS AND METHODS
Cell lines and culture conditions.The Jurkat E6.1, J-Lat 10.6, CEM A3.01, and ACH-2 cell lines were provided by Marco Sgarbanti, Istituto Superiore di Sanità, Rome, Italy. J-Lat full-length cells, clone 10.6, are human lymphoblastic cells derived from Jurkat cells infected with an HIV provirus containing the green fluorescent protein (GFP) in place of the nef open reading frame (ORF) and a frameshift mutation in env. ACH-2 is a human lymphocytic T cell line that was developed by infecting the A301 cell line with HIV-1; the latter cells were derived from a 4-year-old patient with acute lymphoblastic leukemia. ACH-2 cells possess a defect in the Tat–Tat-responsive element (TAR) axis due to a single point mutation in the TAR region at nucleotide 37 whereby a cytosine is replaced by a thymine. This mutation is located near the loop of the TAR hairpin. Since this region is critical for Tat activity, this mutation renders the integrated provirus unresponsive to Tat. J-Lat NEO and IκBα 2NΔ4 cells were transfected with plasmid pMSCVneo for neomycin resistance and with plasmid pMSCVneo IκBα 2NΔ4, respectively, as described elsewhere (41). Cells were cultured in RPMI 1640 medium (EuroClone) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 1% antibiotics (EuroClone), and 1% l-glutamine (Life Technologies).
CD4+ TCM cell isolation.TCM cells were isolated, grown, and infected as described elsewhere (23). Human peripheral blood mononuclear cells (PBMCs) from healthy donors were isolated by Ficoll-Hypaque (Lympholyte; Cedarlane) gradient centrifugation. CD4+ central memory T (TCM) cells were obtained in two steps with the CD4+ central memory T cell isolation kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Briefly, in the first step, human memory CD4+ T cells are isolated by depletion of non-CD4+ T cells and naïve CD4+ T cells (negative selection); in the second step, CD4+ central memory T cells are isolated by positive selection with a phycoerythrin (PE)-conjugated CD197 (CCR7) antibody. After isolation, cells were maintained at 4°C for 18 h in RPMI 1640 medium (BioWhittaker; Cambrex Bio Science) containing 10% FBS and antibiotics to minimize potential T cell activation induced by CCR7-mediated positive selection. Then the cells were seeded at 2 × 106/ml and were cultured in RPMI medium containing 20% FBS, antibiotics, and recombinant IL-7 (PeproTech EC Ltd., London, United Kingdom) added at 5 ng/ml for 72 h before infection. The signature of TCM cells after isolation and subsequently, after IL-7 stimulation prior to HIV-1 infection, was assessed by flow cytometry (FACSCanto II; BD Biosciences) using V450-conjugated CD4, allophycocyanin (APC)-H7-conjugated CD27 (BD Biosciences), PE-Cy7-conjugated CD197 (CCR7), Brilliant Violet 510 (V500)-conjugated CD45RA (BioLegend, San Diego, CA, USA), and APC-conjugated CD62L (ImmunoTools GmbH, Germany) antibodies. Data were analyzed using FlowJo, version X.0.7. Surface markers on TCM cells reached the following purities after isolation (after IL-7 stimulation prior to HIV-1 infection): CD4, >97% (99%); CD27, >92% (95%); CCR7, >88% (>90%); CD45RA, <2% (7%).
Infection of CD4+ TCM cells and reactivation experiments.CD4+ TCM cells were infected with a pseudotyped HIV-1 luciferase reporter virus, able to complete only a single round of infection, as described elsewhere (41). A total of 1 × 104 50% tissue culture infective doses (TCID50) of virus were used to infect 5 × 105 cells. Spinoculations were performed in 15-ml conical Falcon tubes in volumes of 200 μl or less. Cells and virus were centrifuged at 1,200 × g for 2 h at 20°C, washed twice to remove the unbound virus, and resuspended in fresh RPMI 1640 medium supplemented with 20% FBS, antibiotics, and IL-7 for 72 h before reactivation experiments. Cells were plated in 48-well plates at a concentration of 5 × 105 in the presence of 30 μM raltegravir (AstaTech Inc.) for 1 h. Then cells were treated with resminostat (2 μM) and cGAMP (10 ng/ml), and anti-CD3/CD28 beads (1 U/cell) were used as a positive control. Cells were harvested, washed once with phosphate-buffered saline (PBS), and lysed in 100 μl of Bright-Glo reagent. Luminescence was measured using a Victor luminometer (Perkin-Elmer Life Science). Wells producing relative luminescence units (RLU) of >2.5× background were scored as positive. For apoptosis/cell death analysis, cells were harvested, washed once in PBS, resuspended in annexin V binding buffer (Becton, Dickinson, NJ, USA) containing a saturating concentration of an APC-conjugated annexin V antibody and Zombie NIR (BioLegend), and incubated for 15 min at room temperature (RT) in the dark. After incubation, cells were fixed with 4% paraformaldehyde (PFA), and apoptosis/cell death levels were analyzed by flow cytometry.
Reactivation in PBMCs and CD4+ T cells from HIV-infected patients.Human PBMCs from blood samples of 10 HIV-infected patients from Umberto I University Hospital were isolated by Ficoll-Hypaque (Lympholyte; Cedarlane) gradient centrifugation. Cells were seeded at a concentration of 1 × 106/ml in 6-well plates and were treated with raltegravir (30 μM) for 1 h prior to the addition of DMSO, resminostat (2 μM), cGAMP (10 μg/ml), or phytohemagglutinin-L (PHA-L) (10 μg/ml). After 48 h, cells were harvested, and total RNA was isolated as described below for qPCR analysis. The same experimental protocol was performed for CD4+ T cells obtained from three virologically suppressed patients; cells were isolated from PBMCs with a CD4+ T cell isolation kit (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) and were used at a concentration of 5 × 105 per condition. The study was approved by the ethics committee of the Policlinico Umberto I Hospital, Sapienza University of Rome (ethical approval code reference no. 5340), and was performed in accordance with the ethical standards of the 1964 Declaration of Helsinki and later amendments. All patients signed an informed consent for the use of their clinical and laboratory data in aggregated and anonymous form.
Reagents and antibodies.SAHA and PS1145 were purchased from Sigma-Aldrich. Acitretin, resminostat, BRD9757, and romidepsin were purchased from Cayman Chemicals and were dissolved in DMSO. c-di-GMP was purchased from Biolog Life Science Institute. TNF was purchased from Miltenyi Biotec. PHA-L was purchased from Sigma-Aldrich. The Zombie NIR Fixable Viability kit was purchased from BioLegend, and the contents were dissolved in sterile water. For cell death inhibition, Z-VAD-FMK (Santa Cruz Biotechnology) was used at a final concentration of 20 μM. To block IFN-I signaling, an anti-interferon-α/β receptor chain 2 (anti-IFNAR2) antibody (clone MMHAR-2; Merck Millipore) was added to the culture medium at a final concentration of 1 μg/ml. All the reagents were added to the culture immediately before treatment except for Z-VAD-FMK and PS1145, which were added 1 h before treatment. Anti-IκBα (L35A5), anti-acetyl-α-tubulin (Lys40) (6-11B-1), anti-α-tubulin, anti-acetyl-histone H3 (Lys27) (D5E4), anti-histone H3 (1B1B2), anti-STING (D2P2F), anti-IRF3 (D6I4C), and anti-PARP were purchased from Cell Signaling; anti-p24 (M01-16/4/1) was purchased from Polymun Scientific; anti-glyceraldehyde-3-phosphate dehydrogenase (anti-GAPDH) (0411) was purchased from Santa Cruz Biotechnology.
Cell viability and apoptosis analyses.Cell surface expression of phosphatidylserine was measured using an APC-conjugated annexin V antibody, as recommended by the manufacturer (BioLegend, San Diego, CA). Briefly, specific annexin V binding was achieved by incubating cells in annexin V binding buffer (Becton, Dickinson, NJ, USA) containing a saturating concentration of an APC-conjugated annexin V antibody and 7-aminoactinomycin D (7-AAD) (Becton, Dickinson, NJ, USA) for 15 min in the dark. The binding of APC-annexin V and 7-AAD to the cells was analyzed by flow cytometry. The mitochondrial membrane depolarization assay was performed on ACH-2 cells using the MitoProbe JC-1 assay kit (Life Technologies). Cells were centrifuged for 5 min at 300 × g and were resuspended in a mixture containing 100 μl warm PBS and 2 μM JC-1 (5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide) per condition. Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a positive control at a final concentration of 50 μM. Cells were then incubated at 37°C under 5% CO2 for 30 min. After incubation, cells were washed in warm PBS, centrifuged for 5 min at 300 × g, and then resuspended in 100 μl warm PBS plus Zombie NIR (BioLegend). Finally, the percentage of cells exhibiting mitochondrial depolarization was measured by flow cytometry with 488-nm excitation using emission filters appropriate for Alexa Fluor 488 dye and R-phycoerythrin (fluorescein isothiocyanate [FITC]). Ten thousand events were acquired (BD FACSCanto II; BD Biosciences), and the percentages of apoptotic and dead cells were analyzed by using FlowJo software, version 10.
qPCR analysis.Total RNA was isolated from cells using an RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA was reverse transcribed using the SuperScript VILO cDNA synthesis kit according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Reverse transcription was performed on a LightCycler 480 system using LightCycler 480 Probes Master (Roche, Penzberg, Germany). Quantitative PCR (qPCR) was then performed using TaqMan Fast advanced master mix on a StepOnePlus real-time PCR system (Thermo Fischer Scientific). PCR primers were designed using the Universal ProbeLibrary Assay Design Center (Roche). The primers used in this study were as follows: for Gag, forward primer TGCATGGGTAAAAGTAGTAGAAGAGA and reverse primer AATGCTGAAAACATGGGTATCAC; for Tat/Rev, forward primer CTTAGGCATCTCCTATGGCAGGAA and reverse primer GGATCTGTCTCTGTCTCTCTCTCCACC; and for 5′ LTR-ψ (long LTR), forward primer AGGGACCTGAAAGCGAAAG and reverse primer CTTCAGCAAGCCGAGTCCT.
All data are presented as relative quantifications with efficiency corrections based on the relative expression of the target gene versus GAPDH as the invariant control. The n-fold differential mRNA expression of genes in samples was expressed as 2–ΔΔCT.
Quantification of total HIV DNA in TCM cells.DNA was extracted from pellets using the DNeasy blood and tissue kit (Qiagen, Hilden, Germany). HIV-1 DNA was quantified by qPCR, using a 5′ nuclease assay for the LTR gene as described previously (65). Briefly, 1 μg DNA was amplified with the sense primer NEC152 (GCCTCAATAAAGCTTGCCTTGA) and the reverse primer NEC131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (6-carboxyfluorescein [FAM] and 6-carboxytetramethylrhodamine [TAMRA]) labeled NEC LTR probe (AAGTAGTGTGTGCCCGTCTGTTRTKTGACT). The first PCR cycle allowing fluorescence detection permitted us to quantify HIV-1 DNA by the level of expression relative to that of the endogenous control (β-globin). All samples were tested in the same assay, and results were expressed as the percentage of HIV DNA expression relative to that of the unstimulated control, set at 100%.
Protein extraction and immunoblot analysis.Cells were washed twice in ice-cold PBS and were lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl [pH 8], 0.5% sodium deoxycholate, 1% NP-40, 5 mM EDTA, 150 mM NaCl, 0.1% sodium dodecyl sulfate) in the presence of protease and phosphatase inhibitors, and the insoluble fraction was removed by centrifugation at 17,000 × g for 20 min (4°C). The protein concentration was determined using the Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, Rockford, IL). Proteins were resolved by SDS-PAGE on 4%-to-20% precast Novex Tris-glycine gradient gels (Thermo Fisher Scientific) and were electrophoretically transferred to a nitrocellulose membrane (0.22 μM; GE Healthcare) for 1 h at 100 V in a buffer containing 30 mM Tris, 200 mM glycine, and 20% methanol. The membrane was blocked with 5% milk in 1% Tween 20–Tris-buffered saline (TBST) for 1 h at RT and was then incubated with a primary antibody overnight at 4°C. The membrane was washed and was then incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 h at RT. The protein blots were incubated with enhanced chemiluminescence (ECL) substrates (Pierce Thermo Fisher) for 5 min at RT, and proteins were then detected on a ChemiDoc imaging system (Bio-Rad).
Statistical analysis.Values are expressed as means ± standard deviations (SD). Graphs and statistics were computed using GraphPad Prism, version 6. An unpaired, two-tailed Student t test was used to determine the significance of the difference between the control and each experimental condition. The statistical analysis of the luciferase experiments was performed using one-way analysis of variance (ANOVA), followed by an appropriate post hoc test. To evaluate the synergistic effect of an LRA combination, the Bliss independence model was used. The interaction between two compounds is defined by the equation Fp12 = fa1 + fa2 – (fa1)(fa2), where Fp12 is the predicted fraction affected by a combination of drug 1 and drug 2, given the experimentally observed fractions affected for drug 1 (fa1) and drug 2 (fa2) individually. The experimentally observed fraction affected by a combination of drug 1 and drug 2 (Fo12) can be related to the predicted fraction affected as follows: ΔF12 = Fo12 – Fp12. If the observed fraction rate Fo12 at the combination dose (d1, d2) of drug 1 and drug 2 is greater than the Bliss-predicted fraction rate Fp12, the drug combination effect is considered synergistic at that specific (d1, d2) dose combination. If ΔF is 0, then the drug combination follows the Bliss model for independent action, and the combined effect is additive. If ΔF is <0 with statistical significance, then the combined effect of the two drugs is less than that predicted by the Bliss model, and the drug combination displays antagonism. Statistical significance for ΔF was calculated using a ratio paired t test comparing Fo12 with Fp12 for each combination. P values of <0.05 were considered statistically significant (***, P ≤ 0.001; **, P ≤ 0.01; *, P ≤ 0.05).
ACKNOWLEDGMENTS
This research was supported by grants from the Fondazione Cenci Bolognetti, NIH (grant 7R21CA192185), and the Italian Association for Cancer Research (grant IG16901).
Many thanks to Ivano Mezzaroma for providing patients’ samples and clinical data.
FOOTNOTES
- Received 18 July 2019.
- Accepted 3 August 2019.
- Accepted manuscript posted online 14 August 2019.
- Copyright © 2019 American Society for Microbiology.
