ABSTRACT
Several therapeutic strategies targeting Epstein-Barr virus (EBV)-associated tumors involve upregulation of viral lytic gene expression. Evidence has been presented that the unfolded protein response (UPR) leads to EBV lytic gene expression. Clofoctol, an antibacterial antibiotic, has been reported to upregulate the UPR in prostate cancer cell lines and to slow their growth. We investigated the effects of clofoctol on an EBV-positive Burkitt lymphoma cell line and confirmed the upregulation of all three branches of the UPR and activation of EBV lytic gene expression. While immediate early, early, and late EBV RNAs were all upregulated, immediate early and early viral proteins but not late viral proteins were expressed. Furthermore, infectious virions were not produced. The use of clofoctol in combination with a protein kinase R-like endoplasmic reticulum kinase inhibitor led to expression of late viral proteins. The effects of clofoctol on EBV lytic protein upregulation were not limited to lymphoid tumor cell lines but also occurred in naturally infected epithelial gastric cancer and nasopharyngeal cancer cell lines. An agent that upregulates lytic viral protein expression but that does not lead to the production of infectious virions may have particular value for lytic induction strategies in the clinical setting.
IMPORTANCE Epstein-Barr virus is associated with many different cancers. In these cancers the viral genome is predominantly latent; i.e., most viral genes are not expressed, most viral proteins are not synthesized, and new virions are not produced. Some strategies for treating these cancers involve activation of lytic viral gene expression. We identify an antibacterial antibiotic, clofoctol, that is an activator of EBV lytic RNA and protein expression but that does not lead to virion production.
INTRODUCTION
Epstein-Barr virus (EBV) is a ubiquitous virus associated with the development of lymphoid, epithelial, and mesenchymal malignancies (1). It establishes latency in B cells and in tumor cells. We have a long-standing interest in pharmacologic viral activation, believing that lytic viral gene expression may lead directly to the death of host cells or facilitate the selective targeting of cells that harbor virus (2). In previous investigations, 5-azacytidine, bortezomib, histone deacetylase inhibitors, chloroquine, and other agents have been studied as lytic activators (3–11). However, concerns have been raised that lytic viral gene activation leading to infectious virion production might exacerbate virus-induced illness or contribute to tumorigenesis (5, 6, 8, 12, 13).
Clofoctol {[2-(2,4-dichlorobenzyl)-4-(tetramethyl-1,1,3,3-butyl)phenol]}, a synthetic antibacterial used in France and Italy for treating mild upper respiratory tract infections (14, 15), was recently identified to be an inhibitor of prostate cancer cell line growth in vitro at clinically achievable concentrations (16–18). Further study suggested that clofoctol activated the unfolded protein response (UPR) in the prostate cancer cell line used for screening. The UPR is a stress pathway that extends from the endoplasmic reticulum (ER) to the nucleus. It is triggered by three sensors in the ER, illustrated in Fig. 1A (19). These are the protein kinase RNA-like ER kinase (PERK), activating transcription factor 6 (ATF6), and inositol-requiring protein 1α (IRE1α). PERK activation leads to the phosphorylation of downstream targets, including the alpha subunit of eukaryotic translation initiation factor 2 (eIF2α), and the attenuation of global translation initiation but increased translation of ATF4, a transcription factor for stress response genes, including C/EBP homologous protein (CHOP), GADD34, and Trb3 (20). ATF6 activation leads to translocation from the ER to the Golgi apparatus, where it is cleaved to produce an active transcription factor which upregulates the expression of ER chaperones (including BiP) and ER-associated protein degradation (ERAD) components. IRE1 activation leads to splicing of XBP1 mRNA, yielding an active transcription factor that upregulates the expression of genes involved in protein folding and in ERAD.
Clofoctol induces the UPR in a Burkitt lymphoma cell line. (A) Schematic representation of UPR signaling pathways. ATF6(N), an N-terminal fragment of ATF6. (B) qRT-PCR assays of the UPR markers. BX1-Akata cells were treated with 20 μM clofoctol, RNA was isolated at the indicated time points, and reverse-transcribed cDNA was used for CHOP, BiP, and XBP1s RNA quantification. (C) Immunoblots of the UPR markers. BX1-Akata cells were treated with 20 μM clofoctol, proteins were extracted at the indicated time points, and immunoblotting was performed with antibodies against ATF4, XBP1s, ATF6, and actin. (D) Immunoblot of an assay with two different antibodies showing expression of ubiquitinated (Ub) proteins 6 h after the treatment of BX1-Akata cells with clofoctol and bortezomib.
Previous work in the Ambinder laboratory and others has suggested that UPR activation leads to EBV lytic gene expression (21, 22). Here we investigated the effects of clofoctol on the UPR, EBV lytic gene expression, and infectious virion production. We found that clofoctol activates EBV lytic gene expression, including the expression of immediate early and early proteins, but not the production of infectious virus.
RESULTS
Clofoctol induces the UPR in a Burkitt lymphoma cell line.We treated an EBV-positive (EBV+) Burkitt lymphoma cell line (Akata) with clofoctol and assessed all three branches of the UPR. As shown in Fig. 1B and C, clofoctol led to an increase in ATF4 protein as well as the induction of CHOP RNA, cleavage of the ATF6 protein, activation of BiP RNA expression, and an increase in the spliced form of XBP1 (XBP1s) RNA and the XBP1s protein. Clofoctol did not lead to the accumulation of ubiquitinated proteins, as assessed by immunoblotting with two different antibodies (Fig. 1D). In contrast, bortezomib, which activates the UPR by inhibiting the proteasome, does lead to such an accumulation. Thus, the mechanism of UPR induction by clofoctol likely differs from that of bortezomib.
Clofoctol induces EBV lytic gene expression.Following clofoctol treatment, RNAs corresponding to Zta (an immediate early viral gene), BMRF1 (an early viral gene), and gp350 (a late viral gene) all increased (Fig. 2A). Bortezomib yielded a similar EBV gene activation profile. Zta antigen expression was confirmed by immunofluorescence (Fig. 2B), and a modest increase in viral DNA copy number per cell was demonstrated by PCR (Fig. 2C). The Akata cell line has been widely studied in part because of the highly efficient induction of virion production associated with anti-IgG treatment. In the BX1-Akata cell line, green fluorescent protein (GFP) expression correlates with EBV lytic induction (23). Baseline GFP expression in BX1-Akata cells varies from 2 to 6%. The level of GFP induction achieved with clofoctol was always comparable to or exceeded that associated with anti-IgG treatment (Fig. 2D). However, the fold induction varied between 3- and 9-fold as a function of baseline GFP expression, with higher baseline expression being associated with lower fold increases in expression following induction.
Clofoctol induces EBV lytic replication in BX1-Akata cells. (A) Time course of EBV lytic RNA induction. BX1-Akata cells were treated with clofoctol (20 μM) or bortezomib (20 nM), and RNA was isolated at the indicated time points to perform qRT-PCR to detect Zta, BMRF1, and gp350 transcript levels. (B) The expression of Zta proteins by BX1-Akata cells was measured by immunofluorescence 24 h after clofoctol treatment. (C) qPCR performed on BX1-Akata cells after treatment with the indicated doses of clofoctol for 24 h. (D) BX1-Akata cells were treated with clofoctol or anti-IgG as a control. Fluorescence microscopy was used to determine the number of cells expressing GFP at 24 h after treatment.
Late viral lytic proteins are not expressed, and infectious virions are not produced.Whereas the immediate early protein Zta was induced by clofoctol, two late viral proteins (gp110 and gp350) were not (Fig. 3A), although their RNAs were expressed (Fig. 3B). Furthermore, in an assay for infectious virions that utilize GFP-marked virus to infect Raji cells, we found that clofoctol blocked infectious virus production in the Raji cell assay. This assay relies on the observation that infection of the Raji Burkitt lymphoma cell line with GFP-marked virus followed by lytic induction with 12-O-tetradecanoylphorbol-13-acetate (TPA) and sodium butyrate (NaB) leads to GFP expression. As can be seen in Fig. 3C, virus could be detected in the supernatant from anti-IgG- or TPA-NaB-treated BX1-Akata cells by the high levels of GFP expression in Raji cells. However, the supernatant from BX1-Akata cells treated with clofoctol was indistinguishable from the supernatant from control untreated BX1-Akata cells. Thus, although clofoctol leads to early lytic antigen expression, it does not lead to late viral antigen expression or the production of infectious virions.
Clofoctol abolished late lytic protein expression and inhibited virion production. (A) Expression of the gp110 and gp350 proteins by BX1-Akata cells was detected by immunofluorescence 24 h after clofoctol (20 μM) or anti-IgG treatment. (B) A qRT-PCR assay was performed to measure gp350 and gp110 RNA levels after clofoctol or anti-IgG treatment. (C) A Raji cell infection assay was performed to determine infectious viral titers according to the indicated schedule. BX1-Akata cells were treated with anti-IgG (10 μg/ml), TPA (20 ng/ml)-NaB (3 mM), or clofoctol (20 μM). Raji cells were exposed to the cell-free BX1 cell virus supernatants of each drug treatment, and GFP-positive Raji cells were imaged and counted.
The PERK pathway is important for clofoctol effects.The observations that clofoctol induction of late viral RNA was not accompanied by the production of late viral proteins or infectious virus suggested that clofoctol interfered with translation. In prostate cancer cell lines, clofoctol induction of the PERK-eIF2α-ATF4-CHOP pathway was demonstrated (18). The phosphorylation of eIF2α leads to the attenuation of most translation but allows some RNAs, particularly those with short open reading frames in their 5′ untranslated region, notably, ATF4, to be translated. Trb3 RNA, which is induced by ATF4, is often used as a reporter for PERK activity (20, 24). To investigate whether PERK activation also mediates clofoctol effects in the Burkitt lymphoma cell line, we studied a PERK short hairpin RNA (shRNA) knockdown with a pool of 3 target-specific constructs. Knockdown reduced but did not eliminate PERK RNA and diminished clofoctol induction of Trb3 RNA and Zta RNA (Fig. 4A), as well as GFP expression (Fig. 4B). The contribution of PERK to the phenomena being studied was further evaluated with a PERK inhibitor (Pi). The inhibitor reduced the effects of clofoctol on Zta, BMRF1, and gp350 RNA expression (Fig. 4C) and GFP fluorescence in BX1-Akata cells (Fig. 4D).
PERK and IRE1-XBP1s pathways mediate clofoctol-induced lytic activation. (A and B) BX1-Akata cells were transduced with a pool of lentiviral particles containing 3 different shRNA constructs targeting PERK or a scrambled control lentiviral particle and selected with puromycin. (A) qRT-PCR was performed to confirm PERK knockdown and to measure Trb3 and Zta RNA levels after 24 h of clofoctol treatment. (B) Fluorescence microscopy was used to detect GFP-positive cells after 24 h of clofoctol treatment, and the cell counts were compared to those after no treatment (control [ctrl]). (C and D) BX1-Akata cells were pretreated with a PERK inhibitor (Pi), with an XBP1s inhibitor (4u), or with both (Pi + 4u), which was followed by clofoctol (CLF) treatment. (C) qRT-PCR for Zta, BMRF1, and gp350 RNA quantification was performed 24 h after treatment. (D) Fluorescence microscopy was used to detect GFP-positive cells at 24 h after treatment, and cell counts were compared to those for the control.
XBP1s is also important for clofoctol effects.Previously, we had shown that XBP1s activates Zta transcription (21). In the present investigation, we examined the effects of an inhibitor of XBP1 splicing (4u) and, as expected, saw that Zta RNA levels decreased, as did BMRF1 and gp350 RNA levels (Fig. 4C). The combination of Pi and 4u was much more effective in suppressing viral RNA expression than either inhibitor alone. Similarly, expression of GFP in Akata cells was further suppressed by the combination (Fig. 4D). These results suggest that clofoctol effects are mediated by both PERK and XBP1s.
Complex effects of PERK inhibition on viral protein expression.The combination of Pi with clofoctol diminished Zta protein expression but enhanced expression of the gp350 viral protein (Fig. 5A). Use of the combination of shRNA for PERK with clofoctol had a similar effect (Fig. 5B). Neither Pi alone nor the PERK shRNAs alone affected lytic gene expression. BMRF1 and BHRF1 mRNA and protein expression paralleled Zta expression, and gp110 expression paralleled gp350 expression.
Differential effect of PERK inhibition on viral protein expression. (A) BX1-Akata cells were pretreated with 7.5 μM a PERK inhibitor (Pi), followed by 20 μM clofoctol treatment for 24 h, and immunofluorescence was performed to detect Zta and gp350 protein expression. Cy3-positive cells were counted, and the number of cells was compared to the number of positive cells in an untreated control sample. *, P < 0.05; **, P < 0.01. (B) BX1-Akata cells with control or PERK shRNA were treated with clofoctol, and immunofluorescence was performed to detect Zta and gp350 protein expression. Cy3-positive cells were counted, and the number of Cy3-positive cells was compared to the number of Cy3-positive cells in an untreated control sample. *, P < 0.05; **, P < 0.01. (C) Table describing the effect of PERK inhibition and clofoctol on viral RNA and protein expression. −, +, and ++ indicate the levels of expression.
PERK activation.We investigated whether activation of PERK with CCT020312 (25) would activate EBV lytic infection. As shown in Fig. 6A, BX1-Akata cells were treated with the activator, and RNA transcripts for Zta, BMRF1, and gp350 were all seen to increase by quantitative reverse transcription-PCR (qRT-PCR). Furthermore, the effects were substantially blunted by transduction of the cells with a pool of lentiviral particles containing 3 different shRNA constructs targeting PERK but not by transduction with a scrambled control (Fig. 6B).
PERK activation increases EBV lytic gene expression. (A) BX1-Akata cells were treated with a PERK activator (CCT020312), and RNA was isolated to measure the levels of expression of Zta, BMRF1, and gp350 transcripts by qRT-PCR. (B) BX1-Akata cells were transduced with a pool of lentiviral particles containing 3 different shRNA constructs targeting PERK or a scrambled control lentiviral particle and selected with puromycin. qRT-PCR was performed to measure the Zta RNA level after 24 h of PERK activator (CCT020312) treatment.
Lytic induction in epithelial cancer cell lines and LCLs.In order to see whether the effects of clofoctol were limited to lymphoma cell lines, we investigated the EBV-gastric cancer cell line SNU719, the nasopharyngeal cancer cell line C666-1, and lymphoblastoid cell line (LCLs). Across the board, clofoctol induced Zta RNA expression and an increase in the viral DNA copy number (Fig. 7). However, the increase in Zta protein expression was quite modest. Just as in the Burkitt lymphoma cell line Akata, Pi alone did not lead to lytic activation by any measure. However, Pi inhibition led to late protein expression when used in combination with clofoctol.
Clofoctol activates lytic viral infection in EBV-infected cell lines. The cell lines were treated with either clofoctol or TPA-NaB, and lytic activation was assessed after 24 h. (A) After the lytic activation of SNU719 gastric cancer cells, Zta RNA was assessed by qRT-PCR, viral DNA was assessed by qPCR, and Zta and gp350 were assessed by immunofluorescence. Quantitation of the immunofluorescence is shown adjacent to the photomicrographs. (B, C) Lytic activation was assessed in C666-1 nasopharyngeal carcinoma cells (B) and LCLs (C). Only the quantification of immunofluorescence is shown. The percentage of cells expressing the Zta protein is shown above the bar graphs.
DISCUSSION
These investigations show that clofoctol leads to the UPR, activates EBV lytic gene transcription, and yields a modest increase in viral DNA replication. However, translation of late viral gene products is restricted and infectious virions are not produced. These phenomena are not limited to a particular cell line or tissue type but occur in naturally infected lymphoma and epithelial cancer cell lines. Our results confirm and extend the previous report that clofoctol activates the UPR (18). The mechanisms by which clofoctol induces the UPR remain unknown. However, insofar as we observed no accumulation of ubiquitinated proteins, its mode of action is likely different from that of bortezomib, a known proteasome inhibitor. Mechanistic questions aside, the functional activity of clofoctol in activating the UPR is clear.
A variety of strategies to induce lytic viral gene expression so as to facilitate the killing of EBV-associated tumors have been investigated for many years (3–5, 7, 26–31). In some approaches, the hope is that a lytic inducer will activate a viral thymidine kinase or protein kinase that will phosphorylate ganciclovir, poisoning the cellular DNA polymerase such that mitotic cells will be killed (5, 7, 31–33). Other strategies have aimed at the upregulation of immunodominant viral antigens recognized by cytotoxic T cells or the selective concentration of radiopharmaceuticals in tumor tissue (3, 4).
There has been ongoing debate as to whether activation of EBV replication might itself be dangerous (12). In humanized mouse models, induction of the lytic cycle has been shown to be a prerequisite for lymphomagenesis (34, 35). Lytic infection may contribute to tumor development by expanding the population of latently infected cells (30). Clofoctol is of special interest as a lytic activator because no infectious virus is produced. There is upregulation of immediate early and early lytic viral proteins but not of late proteins. Our understanding of this phenomenon is quite limited, but our finding that late protein expression can be enhanced by PERK inhibition suggests that it may ultimately be possible to fine-tune lytic protein upregulation to achieve the desired effects, perhaps by the use of combinations of agents. We note that other compounds that induce immediate early and early lytic viral gene expression without late viral gene expression have been identified in screens (11). Insofar as clofoctol has been used in Europe to treat bacterial infection without serious adverse reactions (achieving levels higher than those required for the viral effects described here), we anticipate that clofoctol would be well tolerated in other clinical settings, whereas other compounds with these characteristics have not been previously evaluated in the clinical setting.
A curious and rather unexpected finding in this study was the upregulation of translation of late gene products in cell lines treated with clofoctol and Pi. Concerns that late gene protein expression might reflect an artifact or epiphenomenon were addressed, insofar as the late protein expression also followed PERK shRNA inhibition and the phenomenon was not restricted to one cell line or cancer type (Fig. 5 and 7). We note that the regulation of transcription of late proteins in gammaherpesvirus infection is complex and appears to reflect changes in histones, CpG methylation, and the formation of replication centers in productively infected cells, as recently reviewed (36). An important role for PERK in inhibiting the translation of viral proteins has been detailed in other systems (37). Clofoctol leads to the phosphorylation/activation of PERK and the transcription of immediate early, early, and late viral RNAs. However, late protein translation is inhibited either directly or indirectly by PERK. Only when this inhibitory effect of PERK is blocked with either Pi or shRNAs are the late proteins made.
Another drug with interesting effects on EBV gene expression that appear to be unrelated to its clinical use is spironolactone (38). This aldosterone antagonist has off-target effects that inhibit expression of EBV late lytic genes, including tegument proteins, glycoproteins, the major viral capsid antigen, and the minor capsid gene (BDLF1). Spironolactone, like clofoctol, prevents the production of infectious EBV particles. Unlike clofoctol, spironolactone does not upregulate lytic gene expression. The proposed mechanism involves the ability of spironolactone to inhibit the function of an EBV gene that encodes an RNA-binding protein, BSLF2/BMLF1, which is a posttranscriptional regulator (39). We also note that the newly identified off-target effects of spironolactone include its induction of degradation of the XPB subunit of the general transcription factor TFIIH, which causes inhibition of RNA polymerase II-mediated transcription as well as nucleoside excision repair. It is possible that this may explain the inhibitory effect of spironolactone on EBV gene expression (40–42).
In conclusion, clofoctol joins a list of drugs that activate EBV lytic gene expression. Clofoctol is distinctive insofar as it both stimulates lytic gene expression and inhibits virion production. The effects are complex but can be modulated in interesting ways; i.e., the use of a Pi in combination with clofoctol leads to late protein expression, whereas the use of clofoctol alone does not. Drugs that induce lytic gene expression offer interesting opportunities for pharmacologic interventions for a targeted therapeutic strategy in the treatment of EBV-associated malignancies.
MATERIALS AND METHODS
Cell culture.The Akata and Raji cell lines were derived from EBV+ Burkitt lymphomas (43). BX1-Akata cells, an engineered derivative of the Akata cell line which carries a recombinant EBV that constitutively expresses a green fluorescent protein (GFP), was a gift from L. Hutt-Fletcher (Louisiana State University) (44). SNU719, a naturally derived EBV+ gastric cancer cell line, was a gift from J. M. Lee (Yonsei University) (45). C666-1 is an EBV+ nasopharyngeal carcinoma cell (46). The lymphoblastoid cell line (LCL) was established by infecting normal B lymphocytes with EBV strain B95-8. All cell lines were cultured in RPMI 1640, 2 mM l-glutamine, 100 IU/ml penicillin, 100 μg/ml streptomycin, and 10% (vol/vol) fetal bovine serum (FBS). The BX1-Akata cell line was maintained in 500 μg/ml G418 (Geneticin; Life Science Technologies).
Reagents.Clofoctol, anti-IgG, an XBP1s inhibitor (4u), a PERK inhibitor (GSK2606414), and an EIF2AK3 activator (CCT020312) were purchased from MilliporeSigma; bortezomib was from Millennium Pharmaceuticals.
Quantitative PCR (qPCR).DNA was extracted from cells using a QIAamp DNA minikit (Qiagen). Real-time PCR was performed with EBV BamH-W primers and a fluorescent probe [primers 5′-CCCAACACTCCACCACACC-3′ and 5′-TCTTAGGAGCTGTCCGAGGG-3′ and probe 5′-(FAM)CACACACTACACACACCCACCCGTCTC(BH1)-3′, where FAM is 6-carboxyfluorescein and BH1 is black hole fluorescence quencher]. EBV copy numbers were assessed with serially diluted Namalwa cell DNA standards. Each reaction mixture was 20 μl in total and included 2 μl DNA at 50 ng/ml, the 2 EBV primers at 500 nM, the probe at 200 nM, and SsoAdvance supermix (Bio-Rad). DNA was amplified at 95°C for 2 min for 1 cycle and 95°C for 5 s and 60°C for 10 s for a total of 40 cycles in a CFX96 real-time thermocycler (Bio-Rad).
qRT-PCR.RNA was extracted using an RNeasy minikit (Qiagen) and reverse transcribed into cDNA by using an iScript reverse synthase kit (Bio-Rad). Reverse transcription was performed using a CFX96 real-time thermocycler (Bio-Rad). SsoFast Evagreen supermix (Bio-Rad) with 500 nM primers and cDNA corresponding to 25 ng of the RNA were used for each reaction. cDNA was amplified at 95°C for 30 s for 1 cycle and 95°C for 5 s and 60°C for 10 s for a total of 40 cycles in a CFX96 real-time thermocycler. The primers used were specific for EBV Zta (ACATCTGCTTCAACAGGAGG, AGCAGACATTGGTGTTCCAC), EBV BMRF1 (CTAGCCGTCCTGTCCAAGTGC, AGCCAAACGCTCCTTGCCCA), EBV gp350 (GTCAGTACACCATCCAGAGCC, TTGGTAGACAGCCTTCGTATG), EBV gp110 (AACCTTTGACTCGACCATCG, ACCTGCTCTTCGATGCACTT), XBP1s (TGCTGAGTCCGCAGCAGGTG, GCTGGCAGGCTCTGGGGAAG), CHOP10 (AAGATGAGCGGGTGGCAGCG, ACCTGCTTTCAGGTGTGGTGATG), BiP (GTTCTTGCCGTTCAAGGTGG, TGGTACAGTAACAACTGCATG), Trb3 (CGTGATCTCAAGCTGTGTCG, AGCTTCTTCCTCTCACGGTC), and GAPDH (glyceraldehyde-3-phosphate dehydrogenase; TCTTTTGCGTCGCCAGCCGA, AGTTAAAAGCAGCCCTGGTGACCA) (21). The PERK primer set was purchased from Santa Cruz Biotechnology.
Immunoblotting.For protein extraction, 1.5 × 107 cells were washed in phosphate-buffered saline (PBS), and the pellets were resuspended in a buffer containing 10 mM HEPES (pH 7.9), 10 mM KCl, 100 μM EDTA, and 1× protease/phosphatase inhibitor cocktail (Cell Signaling Technologies). After 15 min of incubation in ice, 0.6% NP-40 was added and the mixture was vortexed for cell lysis. The cytosolic proteins were separated by centrifugation at 10,000 rpm for 30 s and collected by removing the supernatant. The pellet containing the nuclear proteins was resuspended in a buffer containing 20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, and 1× protease/phosphatase inhibitor cocktail. After 15 min of rotation at 4°C, the nuclear proteins were isolated by centrifugation at 13,000 rpm at 4°C for 5 min and collected by removing the supernatant. SDS-PAGE and Western blotting were performed with equal amounts of proteins per sample, and enhanced chemiluminescent detection reagents (GE Healthcare) were used in conjunction with autoradiography film (Denville Scientific) detection. The antibodies used included ubiquitin antibody (FL-76; catalog number sc-9133; Santa Cruz), ubiquitin antibody (clone P4D1; catalog number sc-8017; Santa Cruz), ATF6 antibody (catalog number 65880; Cell Signaling Technology), XBP1s antibody (catalog number 12782; Cell Signaling Technology), ATF4 (catalog number 11815; Cell Signaling Technology), and β-actin antibody (catalog number A5441; Sigma-Aldrich).
Immunofluorescence.Cells (1.5 × 105) were spun onto microscope slides with a Cytospin centrifuge, fixed and permeabilized with ice-cold methanol for 15 min, blocked in PBS with 5% bovine serum albumin (BSA) for 30 min, incubated with anti-EBV Zta (catalog number sc-53904; Santa Cruz), gp110 (catalog number sc-56980; Santa Cruz), or gp350 (catalog number sc-57724; Santa Cruz) mouse antibody (Santa Cruz Biotechnology) at 1:50 for 1 h, and washed three times for 10 min each time with 5% BSA, 0.1% Tween 20 in PBS, and Cy3 goat anti-mouse antibody (Jackson Immunoresearch) was applied to the cells for 1 h at room temperature. After 3 washes, Vectashield mounting medium with DAPI (4′,6-diamidino-2-phenylindole; Vector Laboratories) was applied. A ZOE fluorescent cell imager (Bio-Rad) was used for detection.
shRNA knockdown.A pool of lentiviral particles containing 3 different shRNA constructs targeting PERK and scrambled control lentiviral particles from Santa Cruz Biotechnology were used according to the manufacturer’s protocol. Stable cell lines expressing the shRNA were selected with puromycin.
Raji cell infection assay.BX1-Akata cells were treated with anti-immunoglobulin G (10 μg/ml; MilliporeSigma), TPA (20 ng/ml)-NaB (3 mM), or clofoctol (20 μM) and incubated for 4 days. After spinning the cells, the supernatant was passed through a Millex-HV syringe filter unit (pore size, 0.45 μm; MilliporeSigma) and concentrated with a centrifugal filter (Amicon Ultra-15 centrifugal filter unit; MilliporeSigma). Raji cells were exposed to concentrated supernatant, and TPA and NaB were added 24 h after the infection. The GFP-positive cells were counted 24 h after TPA-NaB treatment.
Quantitation.All quantified results are from experiments that were repeated at least 3 times. The numbers presented reflect the averages from 3 experiments, while the images reflect the result of a representative experiment in each case.
ACKNOWLEDGMENTS
This work was supported by NIH grant P30CA006973 and by a FAMRI grant (to J.O.L.).
FOOTNOTES
- Received 14 June 2019.
- Accepted 18 July 2019.
- Accepted manuscript posted online 24 July 2019.
- Copyright © 2019 American Society for Microbiology.
