Article Figures & Data
Figures
- FIG 1
Antarctic sampling locations. Approximately equivalent numbers of Adelie penguins were sampled adjacent to Arctowski Station, Admiralty Bay, on King George Island and on Isla Kopaitik, adjacent to O’Higgens Base, Rada Covadonga. Chinstrap and gentoo penguins were also sampled at Isla Kopaitik. Pie charts depict the differences in proportions and occurrence of the four AAvVs identified in this study. The sizes of the pie charts are proportional to the number of isolates retrieved at each location. The relief map was sourced from Wikipedia, developed by user Kikos, and is distributed under a CC-by-SA 3.0 attribution.
- FIG 2
Maximum-likelihood tree for the full genomes of avian avulaviruses. Strain names from GenBank have been retained and, as such, reflect old taxonomic nomenclature. More than one reference virus for each species has been included (if available) to demonstrate interspecies diversity. Viruses isolated in this study are denoted by their designations and paired with metadata, displayed as colored boxes. The first box indicates the age (light green, chick; dark green, adult), and the second the location (light blue, Admiralty Bay; dark blue, Rada Covadonga). Penguin pictograms are placed at the most recent common ancestors (MRCA) of entire lineages which have been detected in penguins, and branches are colored blue if corresponding to a penguin virus in this tree. No penguin viruses for AAvV/avian paramyxovirus 2 (APMV-2) and AAvV/APMV-8 are shown in this tree; AAvV/APMV-2 has been isolated from penguins and only partially sequenced, as shown in Fig. S7 in the supplemental material, and AAvV/APMV-8 antibodies have been detected by HI. Viruses described by Neira et al. (5) as Antarctic Penguin Viruses A to C have recently been designated avian avulaviruses 17 to 19. Bovine parainfluenza virus and Sendai virus are set as the outgroup. The scale bar represents the number of nucleotide substitutions per site. Individual gene trees are presented in Fig. S1 to S6. The phylogeny of the partial L gene containing additional penguin sequences is presented in Fig. S7.
- FIG 3
Results of hemagglutination inhibition (HI) assay demonstrating fold differences between reference viruses and four isolates recovered in this study, representing four different avian avulavirus species (AAvV-17, AAvV-18, AAvV-19, and AAvV-10-like). Viral species have been plotted in phylogenetic order, with a cladogram depicting phylogenetic relationships. HI titers are shown, and fold differences from the homologous titer are shown as a colored heatmap. The homologous antigen-antiserum titer is in boldface. Importantly, AAvV-10 and AAvV-10-like/Adelie penguin/Antarctica/121/2013, outlined by a black box, are 4-fold different, regardless of the antigen-antiserum combination. Viral species abbreviations are presented using the new nomenclature, i.e., AAvV rather than APMV. Antigens used in this study include APMV-1/chicken/Queensland/V4/66, APMV-2/chicken/California/Yucaipa/56, APMV-3/turkey/England/1087/82, APMV-4/chicken/WA/5030/84, APMV-6/duck/WA/694/78, APMV-7/dove/Tennessee/4/75, APMV-8/goose/Delaware/1053/75, APMV-9/duck/New York/22/78, APMV-10/Falkland Islands/penguin/EC324/2007, and APMV-12/wigeon/Italy/3920_1/05.
- FIG 4
Electron micrographs of AAvV-10-like/Adelie penguin/Antarctica/121/2013 showing spherical (A) and pleomorphic (B) shapes. Herring bone-shaped nucleocapsids are visible, indicated by black arrows in panel B.
- FIG 5
Detection of virus shedding in swab samples collected from chickens inoculated with avian avulaviruses isolated in this study. Viral copy number is presented as number of copies of viral RNA per qRT-PCR reaction mixture volume. Each virus was inoculated into 5 chickens, and oral and cloacal samples collected daily. Chickens in each infection group were shown to be negative for antibodies to the corresponding virus inoculum (HI titers of <4) prior to inoculation. Seroconversion data indicate the postinfection HI antibody titer for each individual chicken in each group at 21 days postinfection and are also presented as a heat map.
Tables
- TABLE 1
Prevalence of avian avulaviruses in penguins sampled in Antarctica, 2013
Location Age Penguin species No. of samples % AAvV prevalence (95% CI)a No. of isolates (% prevalence) AAvV-17 AAvV-18 AAvV-19 AAvV-10-like Admiralty Bay Adult Adelie 110 <0.001 0 0 0 0 Chick Adelie 40 30 (18–45) 8 (20) 2 (5) 1 (2.5 ) 1 (2.5) Rada Covadonga Adult Adelie 111 2.7 (0.9–7.6) 2 (1.8) 0 1(0.9) 0 Chick Adelie 40 20 (10–35) 8 (20) 0 0 0 Adult Gentoo 10 <0.001 0 0 0 0 Chick Gentoo 64 <0.001 0 0 0 0 Adult Chinstrap 18 5.56 (1–26) 0 0 1 (5.55) 0 Total 393 18 (6) 2 (0.7) 3 (0.7) 1 (0.3) ↵a Viruses were screened by isolation in embryonated chicken eggs to determine prevalence. 95% CI, 95% confidence interval.
- TABLE 2
Details of primers and probes used to detect avian avulaviruses in specimens collected from chickens inoculated with representative isolates from this study
Virus Primer/probea Sequence (5′→3′) Amplicon size (bp) AAvV-17/Adelie penguin/Antarctica/130/2013 APMV-130F AGCATACCCAGAGAGTCTTATTCGA 76 AMPV-130-R CTCTCACCGTCCTCTGCATACA AMPV-130-Probe HEX-TGCTCAAATCCCCTCCTCTCCGGT-BHQ1 AAvV-18/Adelie penguin/Antarctica/132/2013 APMV-132F CGCAGCGCCACTTTGG 76 APMV-132R GGGACCTGGGCCTGGATA AMPV-132-probe FAM-CCAGCTCCGGTGCAGTTCATCGA-BHQ1 AAvV-19/chinstrap penguin/Antarctica/661/2013 AMPV-661F GGCCTCAATCGACGGAATC 105 AMPV-661R CGACTGATACCGCCAGTTAGTG APMV-661-Probe HEX-AAAGCACGAGTTGCCACATTCCTAACCAC-BHQ1 AAvV-10-like/Adelie penguin/Antarctica/121/2013 APMV-121F CACTCTGTGCTGACCCTTATGC 83 APMV-121R TGCCCGCTGGGTATGTTT APMV-121-Probe FAM-CTCAACATCCCGTATACTCAGCTCCCCA-BHQ1 ↵a Primers and probes are specific for the viral polymerase (L) gene.
Supplemental material
- Supplemental file 1 -
Fig. S1 (Maximum likelihood tree of the N gene of avian avulaviruses.)
Fig. S2 (Maximum likelihood tree of the P gene of avian avulaviruses.)
Fig. S3 (Maximum likelihood tree of the M gene of avian avulaviruses.)
Fig. S4 (Maximum likelihood tree of the F gene of avian avulaviruses.)
Fig. S5 (Maximum likelihood tree of the HN gene of avian avulaviruses.)
Fig. S6 (Maximum likelihood tree of the L gene of avian avulaviruses.)
Fig. S7 (Maximum likelihood of partial L gene of avian avulaviruses.)
PDF, 1.0M
- Supplemental file 1 -
