Article Figures & Data
Figures
- Fig 1
The TUX-MS method. (A) 4-Thiouracil can be exclusively incorporated into poliovirus RNA in vivo. HeLaUPRT cells were incubated with actinomycin D (Act D), poliovirus, or 4TU (30 min after addition of Act D or PV) as indicated. Total RNA was isolated and cross-linked to a thio-reactive biotin (lanes 1 to 5), separated on a denaturing formaldehyde-agarose gel, transferred to a membrane, and probed with streptavidin-HRP to detect thio-containing RNAs (top). Total RNA was visualized by ethidium bromide staining of the gel (bottom) prior to transfer to the membrane. (B) Diagram of the TUX-MS method. HeLaUPRT cells are mock infected or PV infected in the presence of 4TU and Act D. 4sU is exclusively incorporated into PV viral RNA. UV cross-linking of bound proteins to the thio-containing viral RNA (represented as dark gray balls or lines) is shown. Proteins that are bound to the non-thio-containing mRNA are not cross-linked (represented as light gray balls or lines). Poly(A) RNA is isolated using oligo(dT)25 magnetic beads under denaturing conditions. The RNA is degraded with RNase A releasing the proteins from the complex. The proteins are trypsinized, and the peptides are identified by LC-MS/MS. (C) Prior to RNase A digestion, mock-infected (lanes M) and PV-infected samples are normalized to one another based on levels of cellular transcripts. RNA from mock- and PV-infected cells was isolated either by TRIzol or by the TUX-MS method, and either equal micrograms (total mRNA) or equal volumes [poly(A) selected] of RNA were subjected to β-actin Northern analysis. Band intensities were quantified on a PhosphorImager, and relative mRNA levels are indicated. Similar results were obtained with α-tubulin (data not shown). (D) Cells were infected with PV in the presence or absence of 4TU. At 8 hpi, virus was harvested and the titer was determined by plaque assay.
- Fig 2
PV proteins identified by TUX-MS. (A) The PV genome encodes a polyprotein that is cleaved by viral proteases into functional precursors and mature proteins. The PV polyprotein is shaded to represent the location of the identified peptides (gray) that were detected by TUX-MS in samples from PV-infected cells. The cleavage of the precursor and mature PV proteins is shown below. The PV proteins that are shaded gray were experimentally identified in panel B. (B) Detection of PV proteins that cross-link to the viral RNA in cells. Cells were mock infected (lanes 1 to 4) or PV infected (lanes 5 to 8) in the presence of Act D and 4TU. Proteins were pulse-labeled with [35S]methionine for 2 h prior to cross-linking at 5 hpi, and cells were lysed. Mock-infected (lane 4) and PV-infected (lane 5) lysates were purified using oligo(dT)25 magnetic beads, RNase A treated, separated by SDS-PAGE, and visualized by autoradiography (lanes 4 and 5). Increasing amounts of whole-cell [35S]methionine-labeled lysates were obtained from mock-infected (lanes 1 to 3) and PV-infected (lanes 6 to 8) cells. PV proteins detected in the infected whole-cell lysate are indicated (right); asterisks indicate the PV proteins that cross-linked to the viral RNA (lane 5).
- Fig 3
Functional analysis of known and putative host factors reveals shared cellular functions in nucleocytoplasmic shuttling, spliceosome assembly, and pre-mRNA editing. (A) Venn diagrams were constructed based on the subcellular localization(s) of known (left) and TUX-MS (right) host factors classified by gene ontology annotation. (B) STRING functional association network representing 54/81 host proteins (see Tables 1 and 2). Nodes are labeled with the proteins' primary gene names. Bold node outlines indicate proteins previously identified as PV host factors (Table 1). Node colors represent a range of average spectral count fold enrichment (1.0- to ≥5-fold) in PV-infected versus mock-infected samples (n = 2). Red nodes correspond to host factors detected only in PV-infected samples. Node shape corresponds to its cellular localization: circles, nucleus; diamonds, cytoplasm; squares, both. Functional associations were retained with a combined score of >0.5. Associations represented by multiple lines of evidence were collapsed to a single edge. (C) Proteins identified as unique or enriched in PV-infected samples (n = 82) were uploaded to ProteinCenter (version 3.7). Functional overrepresentation was determined versus the Swiss-Prot reference gene set (35,613 entries). The most statistically significant terms for molecular function (GO MF), biological processes (GO BP), and Pfam domains are indicated as percentages of annotated genes. RRM_1, RNA recognition motif, RNP-1. FDR-corrected P values were 1.8e−60, 5.7e−39, and 2.7e−47, respectively. (D) Proteins from panel C were analyzed by ClueGO functional clustering. The network highlights functional clusters of ribonucleoprotein, spliceosomal, and CRD-mediated mRNA stability complexes.
- Fig 4
Depletion of host proteins found to interact with PV RNA has an impact on PV amplification. HeLa cells were transfected with either control or specific siRNAs as indicated. (A) Quantitative Western analysis of PCBP2 and hnRNP U knockdown. (Top) A β-actin Western blot is shown as a loading control. (Middle) qRT-PCR of mRNA levels following knockdowns normalized to both β-actin and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNA levels. (Bottom) Cell viability was measured using an MTT assay 48 h following knockdown by the indicated siRNAs; the amount of mRNA remaining following knockdown as determined by qRT-PCR is indicated. (B) Knockdown cells were infected at an MOI of 0.1 with PV (white bars) or adenovirus 5 (dark gray bars), and the virus titer after a single round of amplification (6 or 30 hpi, respectively) was determined by plaque assay. (C) Cells were mock infected (lanes 1 to 4) or PV infected (lanes 5 to 8) in the presence of Act D and 4TU. Cross-linking with long-wavelength UV light was performed at 5 hpi prior to cell lysis. RNA-protein complexes were isolated using oligo(dT25) magnetic beads, and then RNA was degraded with RNase A and the proteins were separated by SDS-PAGE (lanes 4 and 5) along with total protein whole-cell lysates from mock-infected (lanes 1 to 3) and poliovirus-infected (lanes 6 to 8) cells. hnRNP U was detected by Western analysis. (D) PV RNA immunoaffinity purifies with NONO. PV-infected HeLaUPRT cells were harvested at 5 hpi and subject to immunoprecipitation with NONO, c-myc, or no antibody (No-Ab). RNA was isolated from input, supernatant (Sup), and immunoprecipitation (IP) and detected by reverse transcription and PCR. Shown is a representative result (n = 3).
- Fig 5
Knockdown of NONO or CNBP affects PV replication or translation but not mengovirus amplification. (A). HeLaUPRT cells were transfected with scrambled control, NONO, or PCBP2 siRNAs. Forty-eight hours posttransfection of the siRNA, the cells were infected with PV at an MOI of 0.1. Virus was harvested at 4 hpi, and the titer was determined by plaque assay on HeLaUPRT cells. (B) HeLaUPRT cells were transfected with scrambled control, NONO, CNBP, or PCBP2 siRNAs, and 48 h posttransfection, the cells were transfected with a dicistronic reporter plasmid containing the PV IRES in the intercistronic region and a control plasmid expressing a cap-dependent β-galactosidase. Twenty-four hours later, luciferase and β-galactosidase activities were determined. The amount of mRNA remaining following knockdown was determined by qRT-PCR (CNBP, 9.9%; NONO, 30%; and PCBP2, 23%). IRES-driven translation was normalized to β-galactosidase activity and expressed as a percentage of the control siRNA. (C and D) HeLaUPRT cells were transfected with scrambled control, NONO, or PCBP2 siRNA. Forty-eight hours posttransfection, the cells were infected with PV at an MOI of 0.1. qRT- PCR was used to determine the number of plus-strand (C) and minus-strand (D) RNAs at 4 hpi. Copy numbers were determined using an in vitro-transcribed template of a known amount (plus strand, control, 7.7 × 109, NONO, 5.4 × 108, and PCBP2, 1.4 × 109 copies/ng RNA; minus strand, control, 3.0 × 104, NONO, 1.3 × 104, and PCBP2, 2 × 104 copies/ng RNA). (E) Knockdown cells were infected at an MOI of 0.1 with mengovirus (MV), and the virus titer after a single round of amplification (5.5 hpi) was determined by plaque assay (left). mRNA levels after qRT-PCR of mRNA following knockdown were normalized to β-actin (right). The same results were obtained by normalization to GAPDH mRNA levels. qRT-PCR and titer results are percentages relative to the control siRNA (represented by the horizontal dotted lines). Errors bars are standard errors for n ≥ 3. The P value for viral amplification compared to the control siRNA is indicated. **, P < 0.005.
Tables
- Table 1
The gene product and primer designations, accession numbers, and primer sequences used in this study
Gene product or primer designation Accession no. Primer sequence (5′→3′) Forward Reverse ACTB NM_001101.3 GCACTCTTCCAGCCTTCC TGTCCACGTCACACTTCATG GAPDH NM_002046.3 ACATCGCTCAGACACCATG TGTAGTTGAGGTCAATGAAGGG HNRNPL NM_001533.2 TCAGTGAATCCCGGAACAATCGGT TCCCAGCTCATCGCAGATCTCAAA RSL1D1 NM_015659.2 AGAGAAGTGGGAGAGCGTGAAACT CAGCAATTGGGATGAAGCCACCAA XRCC6 NM_001469.3 GTCTTCTGTCCAAGTTGGTCGCTT GGCGATGAAGAAGCAGAGGAAGAA DDX17 NM_006386.4 CAACAGGATAGGGACATCAGA CACTGCATTCTTTGGCTAAGG DDX5 NM_004396.3 AGCGTGACTGGGTTCTAAATG AGGAGTTAGGGTAGTCATAATTGATG NONO NM_001145408.1 AAGAAGAAATGATGCGGCGACAGC TGGGAGGTGCTATGGGCATAAACA CNBP NM_001127192.1 GCCATCAACTGCAGCAAGACAAGT TTGCACGGGAATGCACAATTGAGG PVpos V01148.1 ATGTTCCTGTCGGTGCTGTG CACTGTCCTGCTCTGGTTGG PVneg V01148.1 GCGGGAACACAAAGGCATTC ACTCCTGACAACAACCAGACATC PV_pRF V01148.1 TACGAATTCACTCCGGTATTGCGGTACCCTTGTACG ATACATGTTGATACAATTGTCTGATTGAAATAACTG - Table 2
Known picornaviral host factors identified by TUX-MS
Protein name Designation Accession no.a Fold increase (no. of spectra)b Cellular localizationc Function(s) Reference Cellulard Virale Nucleolin NCL P19338 50 (50) N/C RNA binding Translation 79 Lupus La protein SSB P05455 11 (11) N RNA binding Translation 13 Interleukin enhancer-binding factor 2 (NF45) ILF2 Q12905 3.9 (16) N/C Transcriptional regulation Translation, inhibition 80 ATP-dependent RNA helicase A DHX9 Q08211 3.3 (56) N/C RNA helicase Replication 81 Splicing factor, arginine/serine-rich 3 (SRP20) SFRS3 P84103 3.3 (20) N RNA binding Translation 82 Interleukin enhancer-binding factor 3 (DRBP76) ILF3 Q12906 2.1 (65) N/C Transcriptional regulation Translation, inhibition 80 Heterogeneous nuclear ribonucleoprotein K HNRNPK P61978 2.1 (54) N/C RNA binding Replication 56 Poly(rC)-binding protein 2 PCBP2 Q15366 1.9 (21) N/C RNA binding Translation, replication 83 Poly(rC)-binding protein 1 PCBP1 Q15365 1.7 (22) N/C RNA binding Replication 60 Heterogeneous nuclear ribonucleoproteins C1/C2 HNRNPC P07910 1.6 (28) N RNA binding Replication 84 Cold shock domain-containing protein E1 (UNR) CSDE1 O75534 1.2 (32) C RNA binding Translation 85 Polypyrimidine tract-binding protein 1 PTBP1 P26599 1.2 (25) N RNA binding Translation 86 Far upstream element-binding protein 2 KHSRP Q92945 1.1 (28) N/C RNA binding Translation 87 Polyadenylate-binding protein 1 PABPC1 P11940 0.8 (55) N/C Poly(A) binding Translation 88 Proliferation-associated protein 2G4 (ITAF45) PA2G4 Q9UQ80 N/A (3) N/C RNA binding Translation 89 ↵a UniProt-SwissProt accession number.
↵b Average fold increase in total spectra for PV-infected sample versus mock-infected control.
↵c Cellular localization is indicated as nuclear (N) or cytoplasmic (C). N/C, proteins known to shuttle between the nucleus and the cytoplasm.
↵d General cellular functions of the protein.
↵e Stage of the virus life cycle in which the protein is active.
- Table 3
The 66 TUX-MS-identified host factors that have not been previously implicated in the enteroviral life cyclea
Protein name Designation Accession no.b Mol mass (kDa) No. of unique peptidesc Total no. of spectrad Fold incorporatede Gene ontologyf Cellular localizationg Relative abundanceh Interaction Reference(s) Virusi IRESj Non-POU domain-containing octamer-binding protein NONO Q15233 54.2 14 21 INF RRM N ++++ HIV-1, HDV c-Myc 90–92 Nucleolar RNA helicase 2 DDX21 Q9NR30 87.3 15 17 INF RBP N +++ BDV 93 Ribosomal L1 domain-containing protein 1 RSL1D1 O76021 55.0 13 15 INF RBP N/C +++ Ribonucleases P/MRP protein subunit POP1 POP1 Q99575 114.7 12 14 INF RBP N/C ++ Myb-binding protein 1A MYBBP1A Q9BQG0 148.9 12 12 INF DBP N/C +++ SAFB-like transcription modulator SLTM Q9NWH9 117.2 8 11 INF RRM N ++ KH domain-containing, RNA-binding, signal transduction-associated protein 1 KHDRBS1 Q07666 48.2 10 11 INF RBP N ++++ HIV-1 94 TATA-binding protein-associated factor 2N TAF15 Q92804 61.8 4 10 INF RRM N/C +++ Cellular nucleic acid-binding protein (ZNF9) CNBP P62633 19.5 7 9 INF RBP N/C ++++ JCV ODC 95–97 Putative rRNA methyltransferase NOP2 NOP2 P46087 89.3 8 9 INF RBP N ++ Fragile X mental retardation syndrome-related protein 1 FXR1 P51114 69.7 7 7 INF RBP N/C +++ Fragile X mental retardation syndrome-related protein 2 FXR2 P51116 74.2 4 7 INF RBP N/C ++ X-ray repair cross-complementing protein 5 XRCC5 P13010 82.7 6 7 INF DBP N/C ++++ X-ray repair cross-complementing protein 6 XRCC6 P12956 69.8 5 6 INF DBP N/C ++++ PDGF2, VEGF 98 Heterogeneous nuclear ribonucleoprotein L-like HNRPLL Q8WVV9 60.1 4 5 INF RRM N ++ RNA-binding protein 28 RBM28 Q9NW13 85.7 5 5 INF RRM N/C ++ Bcl-2-associated transcription factor 1 BCLAF1 Q9NYF8 106.1 5 5 INF DBP N/C +++ Histone H2B type 1-D HIST1H2BD P58876 13.9 2 5 INF DBP N +++++ RNA-binding protein EWS EWSR1 Q01844 68.5 4 5 INF RRM N/C +++ HCV HCV 99 Splicing factor, arginine/serine-rich 5 SFRS5 Q13243 31.3 3 4 INF RRM N +++ Importin subunit alpha-2/karyopherin alpha 2 KPNA2 P52292 57.9 4 4 INF RBP N/C ++++ A-kinase anchor protein 8 AKAP8 O43823 76.1 4 4 INF DBP N/C ++ Nucleolysin TIA-1 isoform p40 TIA1 P31483 43.0 3 10 INF RRM N/C ++ RNA-binding protein FUS FUS P35637 53.4 12 26 25.5 RRM N/C +++ Polyubiquitin-B UBB P0CG47 25.8 7 25 25 N/C ++++ Splicing factor, proline- and glutamine-rich (PSF) SFPQ P23246 76.1 15 21 21.0 RRM N ++++ HDV c-Myc 92, 100 Zinc finger protein 326 ZNF326 Q5BKZ1 65.7 10 12 11.5 DBP N +++ Zinc finger RNA-binding protein ZFR Q96KR1 117.0 10 11 11.0 RBP N/C ++ Zinc finger protein 638 ZNF638 Q14966 220.6 15 18 8.8 RRM N/C + Heterogeneous nuclear ribonucleoprotein U-like protein 2 HNRNPUL2 Q1KMD3 85.1 15 21 7.0 RBP N +++ Heterogeneous nuclear ribonucleoprotein G RBMX P38159 42.3 18 35 5.8 RRM N +++ Ras GTPase-activating protein-binding protein 2 G3BP2 Q9UN86 54.1 5 6 5.5 RRM C +++ rRNA 2′-O-methyltransferase fibrillarin FBL P22087 33.8 5 6 5.5 RBP N +++ Transcriptional activator protein Pur-alpha PURA Q00577 34.9 5 5 5.0 DBP N/C +++ RNA-binding protein 4 RBM4 Q9BWF3 40.3 8 9 4.3 RRM N/C +++ Probable ATP-dependent RNA helicase DDX17 DDX17 Q92841 72.4 23 50 4.1 RBP N +++ Heterogeneous nuclear ribonucleoprotein R HNRNPR O43390 70.9 22 65 4.0 RRM N/C ++++ Zinc finger CCCH-type antiviral protein 1 ZC3HAV1 Q7Z2W4 101.4 11 12 4.0 RBP N/C +++ RNA viruses 65 Heterogeneous nuclear ribonucleoprotein U (SAF-A) HNRNPU Q00839 90.5 55 138 3.8 RBP N/C ++++ Heterogeneous nuclear ribonucleoprotein L HNRNPL P14866 64.1 25 102 3.5 RRM N/C ++++ HDV, HSV, HCV HCV, Cat-1 67–69, 91, 101 RNA-binding protein 39 RBM39 Q14498 59.4 4 4 3.5 RRM N/C +++ Splicing factor 3B subunit 4 SF3B4 Q15427 44.4 3 4 3.5 RRM N ++ Heterogeneous nuclear ribonucleoprotein A0 HNRNPA0 Q13151 30.8 9 11 3.5 RRM N ++++ Protein FAM98A FAM98A Q8NCA5 55.4 3 4 3.5 +++ Peptidyl-prolyl cis-trans-isomerase A PPIA P62937 18.0 3 4 3.5 N/C +++++ Probable ATP-dependent RNA helicase DDX5 DDX5 P17844 69.1 28 51 3.4 RBP N +++ HCV, IAV 66, 102 Heterogeneous nuclear ribonucleoprotein D0 (AUF1) HNRNPD Q14103 38.4 17 31 3.4 RRM N/C ++++ Ubiquitin-associated protein 2-like UBAP2L Q14157 114.5 9 14 3.4 DBP N +++ La-related protein 1 LARP1 Q6PKG0 123.5 9 10 3.3 RBP N/C ++ Serine/arginine-rich splicing factor 10 SFRS13A O75494 31.3 5 7 3.3 RRM N/C ++ Splicing factor, arginine/serine-rich 7 SFRS7 Q16629 27.3 8 13 3.3 RRM N ++++ HSV-1 103 RNA-binding protein 47 RBM47 A0AV96 64.1 5 6 3.0 RRM N + Serine/arginine-rich splicing factor 2 SFRS2 Q01130 25.5 3 9 3.0 RRM N +++ RNA-binding protein Raly RALY Q9UKM9 32.5 5 6 3.0 RRM N +++ Splicing factor, arginine/serine-rich 9 SFRS9 Q13242 25.5 6 9 2.8 RRM N +++ Nuclease-sensitive element-binding protein 1 YBX1 P67809 35.9 17 51 2.6 RBP N/C ++++ DEN c-Myc 92, 104 Splicing factor U2AF 65-kDa subunit U2AF2 P26368 53.5 6 8 2.5 RRM N ++++ Nucleolysin TIAR TIAL1 Q01085 41.6 13 18 2.5 RRM N/C + Heterogeneous nuclear ribonucleoprotein D-like HNRPDL O14979 46.4 13 29 2.4 RRM N/C ++++ NRF 105, 106 Heterogeneous nuclear ribonucleoprotein A3 HNRNPA3 P51991 39.6 25 43 2.4 RRM N ++++ Serine/arginine-rich splicing factor 1 (ASF-1, SF2-P33) SFRS1 Q07955 27.7 11 19 2.3 RRM N/C ++++ HDV 91 Heterogeneous nuclear ribonucleoprotein U-like protein 1 HNRNPUL1 Q9BUJ2 96.0 15 23 2.3 RBP N +++ Adenovirus 107 Transformer-2 protein homolog beta TRA2B P62995 33.7 6 9 2.3 RRM N +++ Serine/arginine-rich splicing factor 6 SFRS6 Q13247 39.6 8 11 2.2 RRM N +++ Heterogeneous nuclear ribonucleoprotein Q SYNCRIP O60506 69.6 30 64 2.2 RRM N/C ++++ HCV HCV, BiP 108–110 Plasminogen activator inhibitor 1 RNA-binding protein SERBP1 Q8NC51 45.0 17 22 2.2 RBP N/C ++++ ↵a The mass spectroscopy was performed on two poliovirus-infected samples, and the data presented represent an average of results between those data sets. The data sets were highly reproducible (see Data Set S1 in the supplemental material).
↵b UniProt-SwissProt accession number.
↵c Average number of unique peptides identified by MS.
↵d Average total number of spectra that were assigned to that protein from the MS analysis.
↵e Average fold increase in total spectra for PV-infected versus mock-infected control. For proteins only detected in the PV-infected samples, fold change is indicated as “infinite” (INF).
↵f Most of the identified host factors are RNA binding proteins (RBP) or have RNA recognition motifs (RRMs), which are indicated in the gene ontology column. Some are DNA binding proteins (DBP). Blank table cells indicate they are not known to bind either RNA or DNA to date.
↵g Cellular localization is indicated as nuclear (N) or cytoplasmic (C). N/C, proteins known to shuttle between the nucleus and the cytoplasm.
↵h Protein abundances according to the Protein Abundance Across Organisms Database (pax-db.org). Abundances are expressed relative to β-actin (5,120 ppm). +++++ represents the range of 9,999 to 1,000 ppm. Stepwise 10-fold decreases down to 0.99 to 0.1 ppm (+) are indicated.
↵i Viruses whose life cycle has been shown to be impacted in some manner by the host factor. HCV, hepatitis C virus; HDV, hepatitis D virus; BDV, Borna disease virus; JCV, JC virus; HSV, herpes simplex virus; IAV, influenza A virus; DEN, dengue virus.
↵j Host factors that have been implicated as an IRES-trans-acting factor (ITAF) for other IRESs are indicated. ODC, ornithine decarboxylase; PDGF2, platelet-derived growth factor 2; VEGF, vascular endothelial growth factor; NRF, nuclear respiratory factor.
Files in this Data Supplement:
- Supplemental file 1
-
Data set 1 (Host factors identified using TUX-MS.)
XLS, 112K
- Supplemental file 1
-
