A Safe Foot-and-Mouth Disease Vaccine Platform with Two Negative Markers for Differentiating Infected from Vaccinated Animals

Viruses and cells.FMDV type A₂₄ Cruzeiro was derived from the infectious cDNA clone, pA₂₄Cru (referred to here as A₂₄WT for simplicity [39]). A plasmid containing the BRV-2 (pBRV2, accession number EU236594) sequence from poly(C) to poly(A) described previously (20) was used as a source of bovine rhinitis virus 2 genetic material. The baby hamster kidney strain 21, clone 13, cell line (BHK-21) was maintained in Eagle basal medium (BME; Life Technologies, Gaithersburg, MD) supplemented with 10% calf serum (HyClone, South Logan, UT), 10% tryptose phosphate broth, and antibiotic/antimycotic. Cells were grown at 37°C with 5% CO₂ in a humidified atmosphere.

Derivation of A₂₄LL negative marker FMDVs.The 3D^pol region of pA₂₄Cru (A₂₄WT) was modified by PCR utilizing the mutagenic oligonucleotides P1266 (5′-ACCGTTGCGTACGGTGTGTTCCGTCCTGAGTTCGGG) and P1267 (5′-CCCGAACTCAGGACGGAACACACCGTACGCAACGGT) engineered to introduce mutations at codons 27 and 31 of 3D^pol protein (see Fig. 1B). The deletion of L^pro and the introduction of FseI at the beginning of the coding region for the capsid viral protein VP4 and NheI site in 2A were generated by overlap PCR fusion, created by mixing PCR amplified fragments, and reamplifying through the product of the fusion of these two fragments. This was accomplished by using the oligonucleotides P819 (5′-CGAGCCACAGGAAGGATGGGGGCCGGCCAATCCAG) and P820 (5′-CTGGATTGGCCGGCCCCCATCCTTCCTGTGGCTCG) containing an FseI site added by silent mutation in VP4 and sense (5′-GACCTGCTTAAGCTAGCCGGAGACGTTGA) and antisense (5′-TCAACGTCTCCGGCTAGCTTAAGCAGGTC) oligonucleotides containing a silent mutation that introduces NheI in 2A. To introduce these unique restriction sites and the deletion of the functional L^pro into pA₂₄Cru, two mutant PCR products (PCR-LLfseI and PCR-NheI) were generated. PCR-LLfseI (a 1,315-bp product) lacking the L^pro and containing the unique restriction sites XbaI, FseI, and SpeI was digested with XbaI and SpeI and cloned into pA24Cru digested with the same enzymes to generate pA24-LLNheI. The PCR-SacII/MfeI fragment (2,333 bp) containing unique restriction sites SacII, NheI and MfeI was digested with SacII and MfeI, and this mutant product was cloned into pA24-LLNheI plasmid digested with the same restriction enzymes. Although all leaderless plasmids generated in the present study lack the functional leader protein, they do contain the 84-nt region between the first and the second AUG codons of the leader-coding region. The generated plasmids pA₂₄Cru, pA₂₄WT3D_YR, pA₂₄LL, and pA₂₄LL3D_YR all contain a T7 promoter sequence in front of a hammerhead ribozyme at the 5′ terminus of the S fragment of the FMDV genome, terminate with a poly(A) tract of 15 residues, and possess a unique restriction site (SwaI) that can be used for linearization. The double-negative epitope mutants, A₂₄WT3B_PVKV3D_YR and A₂₄LL3B_PVKV3D_YR, were derived from plasmids pA₂₄WT3D_YR and pA₂₄LL3D_YR, respectively, and lack one of the 3B (3B₁; also known as VPg₁) proteins but contain a substitution in 3B₂ that abolishes reactivity with monoclonal antibody (MAb) F83B (a gift from Alfonso Clavijo, National Centre for Foreign Animal Disease, Winnipeg, Manitoba, Canada). The cDNA template corresponding to the 3B₁ deletion mutant virus, A₂₄WT-5853, arose from transfection of a RNA that contained a transposon insertion in 3B₁ at position 5853 (33). This virus has been shown to grow in vitro and produce signs of FMD in cattle similar to A₂₄WT. Therefore, to derive these double mutant plasmids, a PCR product spanning sequences between the unique restriction sites SalI and AgeI was produced that lacked 3B₁ and harbored a substitution in 3B₂ RQKP_9-12 with PVKV found at a similar position in BRV-2. The sequence encoding 3B₂ was modified by utilizing mutagenic sense (5′-GCCCGATGGAGAGACCAGTTAAAGTTAAAGTGAAAGCAAAAGCC) and antisense (5′-GGCTTTTGCTTTCACTTTAACTTTAACTGGTCTCTCCATCGGGC) oligonucleotides to introduce mutations in 3B₂ (also known as VPg₂; see Fig. 1B). Full-length genomic clones were linearized with SwaI and were in vitro transcribed using the T7 Megascript system (Ambion, Austin, TX). Transcript RNAs were transfected into BHK-21 cells by electroporation as previously described (38). The transfected cells were seeded in six-well plates and incubated for 24 to 48 h at 37°C. All six viruses were passaged up to four times in BHK-21 cells, and complete viral genomes were verified by sequence analysis. Virus stocks at passage 4 were stored at −70°C. Passage 4 virus stocks were used in animal experiments and for the production of inactivated vaccines. Virus titers were determined by plaque assays as described below.

Rescue of parental and mutant viruses, viral growth, and plaque assays.For virus growth curves, BHK-21 monolayers were infected with A₂₄WT, A₂₄WT3D_YR, A₂₄LL, A₂₄LL3D_YR, A₂₄WT3B_PVKV3D_YR, and A₂₄LL3B_PVKV3D_YR at a multiplicity of infection (MOI) of 5 PFU/cell. After 1 h of adsorption at 37°C, the monolayers were rinsed once with MES buffer (morpholine ethanesulfonic acid [25 mM], 145 mM NaCl [pH 5.5]) and then twice with phosphate-buffered saline (PBS), followed by the addition of fresh BME containing no serum. At various times postinfection, virus titers were determined by plaque assays (38) using 0.6% gum tragacanth overlay and incubated for 48 to 72 h at 37°C. Plates were fixed and then stained with crystal violet (0.3% in Histochoice; Amresco, Solon, OH), and the plaques were counted. Titers were expressed as PFU/ml and determined in duplicate.

Western blotting.BHK-21 cells were either mock infected or infected with A₂₄WT, A₂₄WT3D_YR, A₂₄LL, A₂₄LL3D_YR, A₂₄WT3B_PVKV3D_YR, or A₂₄LL3B_PVKV3D_YR at an MOI of 5. The following day, cells were lysed with radioimmunoprecipitation assay buffer (PBS supplemented with 1% NP-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], and protease inhibitors). Next, 10 μl of each cell lysate was run under denaturing conditions in a SDS–12% PAGE gel (Invitrogen) and transferred onto nitrocellulose membranes using an XCell II transfer system (Invitrogen). The blots were blocked with 5% skim milk in PBS-Tween (PBS-T) for 1 h at room temperature, followed by an additional incubation of 1 h with 1:200 FMDV-specific MAbs (MAb F32-44, MAb F19-2, and MAb F83B) in PBS-T and 1% skim milk. Blots were then washed twice with PBS-T for 5 min each and incubated for an additional hour with goat anti-mouse IgG antibody conjugated to horseradish peroxidase (HRP; Bethyl Laboratories) at 1:20,000 diluted in PBS-T and 1% skim milk. The blots were subsequently washed three times with PBS-T and developed with SuperSignal West Dura extended duration substrate (Thermo Scientific). Mouse anti-tubulin IgG conjugated to HRP (Abcam) was used at a dilution of 1:2,000 for a loading control.

Immunohistochemistry assay.The MAbs used in the present study were the MAbs F19-2 and F32-44 directed against the FMDV 3D^pol (49) and MAb F83B directed against the 3B nonstructural protein (19). Briefly, cell monolayers grown in 24-well plates were infected with A₂₄WT, A₂₄WT3D_YR, A₂₄LL, A₂₄LL3D_YR, A₂₄WT3B_PVKV3D_YR, or A₂₄LL3B_PVKV3D_YR at an MOI of 5. The following day, the infected cells were fixed with cold acetone-methanol (50/50) mix for 20 min, followed by two washes with PBS. Fixed cells were stained using FMDV-specific MAbs according to the manufacturer's instructions in a Vectastain ABC alkaline phosphatase kit (Vector Labs).

Antigen production and vaccine formulation.The A₂₄LL3D_YR and A₂₄LL3B_PVKV3D_YR vaccine antigens were harvested from infected BHK-21 monolayers (a total of 3 × 10⁸ cells) and inactivated with 5 mM BEI for 24 h at 25°C. The inactivated antigens were then concentrated and partially purified with 8% polyethylene glycol 8000. The yield of the inactivated antigens ranged between 18 and 23 μg. The vaccines were prepared as water-in-oil-in-water (WOW) emulsion with Montadine ISA 206 (Seppic, Paris, France) according to the manufacturer's instructions. Briefly, the oil adjuvant was mixed into the aqueous antigen phase (50:50) at 30°C for 15 min and stored at 4°C for 24 h, followed by another brief mixing cycle for 10 min. The integrity of 146S particles and antigen concentration present in the experimental vaccines (15 μg/dose of chemically inactivated A₂₄LL3D_YR or A₂₄LL3B_PVKV3D_YR antigen) were determined by 10 to 30% sucrose density gradient and 260 nm densitometry. The commercial vaccine used for comparison was a polyvalent vaccine (Biogenesis-Bagó, Bioaftogen series 565 composed of O₁ Campos, A₂₄ Cruzeiro, A Arg 2001, and C₃ Indaial) with an antigen load of 4 to 6 μg/dose.

Virulence study in cattle.Groups of Holstein steers—two animals each for A₂₄WT, A₂₄WT3B_PVKV3D_YR, and A₂₄LL3B_PVKV3D_YR viruses and three animals each for A₂₄WT3D_YR and A₂₄LL3D_YR viruses—were marked and housed in a single room for a week of acclimation. Prior to infection, the animals were moved to separate rooms, and each of them was inoculated by aerosol with either 1 × 10⁷ 50% tissue culture infective dose(s) (TCID₅₀) (for live A₂₄WT) or 1 × 10⁶ to 3 × 10⁶ TCID₅₀ (for live A₂₄WT3D_YR, A₂₄LL3D_YR, and A₂₄WT3B_PVKV3D_YR mutants) using a method previously described (32). A dose of 7 × 10⁶ TCID₅₀ of live A₂₄LL3B_PVKV3D_YR virus was inoculated intradermolingually into cattle. Sera and oral secretions were collected daily for up to 9 days for A₂₄WT and for up to 21 days for A₂₄WT3D_YR, A₂₄LL3D_YR, A₂₄WT3B_PVKV3D_YR, and A₂₄LL3B_PVKV3D_YR, and temperature and clinical evaluation were recorded for the same period of time. Shedding of virus in the air was also monitored using a dry filter unit model 1000 air pump developed by the Program Executive Office for Chemical Biological Defense (PEO-CBD), as previously published (34). Clinical signs were scored as one credit for each affected foot and one credit for the affected head (vesicles in mouth, nostrils, tongue, or lips). FMDV RNA was measured in sera, swabs, and air samples by real-time reverse transcription-PCR (rRT-PCR) as described below.

Swine study.Mutant (A₂₄LL3D_YR) virus was tested for its virulence in swine. Briefly, two 20-kg pigs were inoculated intradermally in the heel bulb of the foot with 10⁵ TCID₅₀ of live virus, and 24 h later two naive pigs were added in direct contact. Sera and nasal and oral secretions were collected daily for up to 9 days postinoculation (dpi) and twice a week thereafter. Infected animals underwent clinical evaluation, and rectal temperature was determined daily throughout the experiment. Shedding of virus in the air was also monitored as described above. FMDV RNA was measured in sera, swabs, and air samples by rRT-PCR as described below.

Vaccination and challenge of cattle.Sixteen Holstein steers, between 250 and 300 kg, were allowed to acclimatize from shipping for 1 week before testing was initiated. Groups of four steers were vaccinated intramuscularly in the neck with the commercial vaccine (cattle 863, 864, 865, and 866), with chemically inactivated A₂₄LL3D_YR/water-in-oil-in-water (WOW, cattle 867, 868, 869, and 870) vaccine or A₂₄LL3B_PVKV3D_YR/water-in-oil-in-water (WOW, cattle 1018, 1019, 1020, and 1021) vaccine. Cattle 871, 872, 1022, and 1023 were vaccinated with sterile PBS to be used as unvaccinated controls. On day 21 postvaccination (dpv), all 16 cattle were challenged intradermolingually with 10⁴ BTID₅₀ (50% bovine tongue infectious doses [10]) of parental A₂₄WT. The animals were then monitored at 0, 4, 7, and 10 days postchallenge (dpc) for the appearance of localized and generalized lesions. Sera, nasal swabs (cotton tip, immersed in 2 ml of minimum essential medium with 25 mM HEPES and 1% fetal bovine sera), and temperature data were collected daily. Clinical signs were scored as one credit for each affected foot, and the presence of vesicles in the head was not considered due to lingual inoculation of challenge. FMDV RNA was measured in sera, swabs, and air samples by rRT-PCR as described below.

Foot-and-mouth disease virus RNA detection and DNA sequence analysis.Sera and swabs were processed for RNA extraction and rRT-PCR as previously described (2, 32). Briefly, 50 μl of each sample (sera, nasal, or oral swab suspension) for each cow was transferred to 96-well plates (King Fisher no. 97002540) containing 150 μl of lysis/binding solution. RNA was then extracted using MagMax-96 viral RNA isolation kit (Ambion, catalog no. 1836) on a King Fisher-96 magnetic particle processor (Thermo Electron Corp.). After an initial 5-min lysis/binding step, the RNA samples underwent a series of four washing steps, a drying step, and a final elution step. RNA was eluted in a final volume of 25 μl. At each of the above steps, RNA was magnetically bound to the beads contained in the lysis/binding solution and was transferred to the different extraction solutions. For filters containing the air samples, 1/4 of the filters were processed with 600 μl of RLT/β-mercaptoethanol and 106-μm acid-washed glass beads (Sigma). The sample was then disrupted using a Retsch tissue Mixer Mill (model MM400) at 30 beats/s for 3 min, and the liquid suspension was used for RNA extraction with the standard RNeasy RNA extraction. RNA extracted from all of the previous described samples was analyzed by rRT-PCR using 2.5 μl of RNA on the ABI 7000 as previously described (36). The cutoff to consider a positive value for preclinical samples (sera and swabs) was 10^2.69 RNA copies/ml, while the cutoff for air samples was 10^0.8 RNA copies number/1,000 liters of air. When necessary, PCR amplicons were sequenced using gene-specific primers, BigDye termination cycle sequencing kits (Applied Biosystems, Foster City, CA) and a Prism 3700 automated sequencer (Applied Biosystems). Primers and probes were designed using Primer Express software (Applied Biosystems).

Expression of recombinant FMDV 3D^pol protein.Expression clone for 3D^pol was prepared by using standard recombinant DNA methods. Briefly, PCR was used to amplify the 3D^pol-coding sequence of a type A FMDV. Forward primer P727 (5′-GCGGAATTCCCGCGGTGGAGGGTTAATCGTTGATAC) containing a SacII restriction site was designed to fuse the three amino acids of C terminus of ubiquitin (48) to the coding sequence for 3D^pol. The antisense primer, P728 (5′- GCGGAATTCGGATCCTGCGTCACCGCACACGGCGTTCACCC), encoding the C-terminal residues of 3D^pol also contains a BamHI restriction site for cloning purposes. The PCR product was cloned into pET26cHis, and the protein was expressed and purified from E. coli.

Serology and antigen differentiation assays.Serum samples from all animals were tested for the presence of neutralizing antibodies against FMDV in a serum neutralization assay. Neutralizing titers were reported as the reciprocal of the last serum dilution to neutralize 100 TCID₅₀ of homologous FMDV in 50% of the wells (17). To study the anti-3D^pol response in the animals, we utilized sera collected from cattle following aerosol inoculation with live A₂₄WT (bovines 7109 and 7110), A₂₄WT3D_YR (bovines 7199, 1, and 2), and A₂₄WT3B_PVKV3D_YR (bovines 9143 and 9144) viruses and four animals introdermolingually inoculated with live A₂₄WT virus (bovines 871, 872, 1022, and 1023). A competitive ELISA (cELISA) was performed according to the protocol of Yang et al. (49) with minor modifications. Briefly, recombinant 3D^pol was diluted in buffer carbonate-bicarbonate (pH 9.6) to obtain 0.25 μg/ml, and 100 μl/well was used to coat Nunc Maxisorp plates (Fisher Scientific). After 2 h of incubation at 37°C on a rotary shaker, the plates were washed four times with 0.01 M PBS and 0.05% Tween 20 (PBS-T). Triplicates of 50 μl of test sera/well (1/15 in PBS-T) and 50 μl of F32-44 hybridoma culture supernatant/well (1/5 in PBS-T) were applied to the coated plates, followed by incubation at 37°C for 1 h on a rotary shaker. After four washes, 100 μl of peroxidase labeled goat antibody to mouse-IgG (H+L) (KPL)/well diluted 1:2,000 in 5% skim milk in PBS-T was added, followed by incubation for 1 h at 37°C. After four additional washes, the antigen-antibody complexes were detected by the addition of 100 μl/well of SureBlue Reserve (KPL) and stopped in 25 min with 50 μl of TMB BlueSTOP solution (KPL)/well. The optical density (OD) was determined at 630 nm on an automated ELISA plate reader. For cELISA based on MAb F83B, a similar protocol was utilized with minor modifications. In particular, the antigen consisted of a peptide encoding the 3B sequence GPYAGPLETQKPLK and was applied at a concentration of 0.5 μg/well. Test sera were assayed at a 1/15 dilution in PBS-T, and MAb F83B was used at a 1/125 dilution. The results were expressed as the percentage of inhibition using mean OD values of test sera as well as known FMDV-positive and -negative bovine sera. The percent inhibition (PI) of samples was derived according to the following formula: PI = [(negative reference serum OD − test sample OD)/(negative reference serum OD − positive reference serum OD)] × 100.