Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Virology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Virus-Cell Interactions

Interaction of a Host Protein with Core Complexes of Bacteriophage Φ6 To Control Transcription

Xueying Qiao, Yang Sun, Jian Qiao, Leonard Mindich
Xueying Qiao
Public Health Research Institute Center of UMDNJ, Newark, New Jersey 07103
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yang Sun
Public Health Research Institute Center of UMDNJ, Newark, New Jersey 07103
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jian Qiao
Public Health Research Institute Center of UMDNJ, Newark, New Jersey 07103
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Leonard Mindich
Public Health Research Institute Center of UMDNJ, Newark, New Jersey 07103
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: mindicle@umdnj.edu
DOI: 10.1128/JVI.00026-10
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

Bacteriophages of the family Cystoviridae have genomes consisting of three double-stranded RNA (dsRNA) segments, L, S, and M, packaged within a polyhedral capsid along with RNA polymerase. Transcription of genomic segment L is activated by the interaction of host protein YajQ with the capsid structure. Segment L codes for the proteins of the inner capsid, which are expressed early in infection. Green fluorescent protein (GFP) fusions with YajQ produce uniform fluorescence in uninfected cells and in cells infected with viruses not dependent on YajQ. Punctate fluorescence develops when cells are infected with YajQ-dependent viruses. It appears that the host protein binds to the infecting particles and remains with them during the entire infection period.

Bacteriophage Φ6 is a member of the family Cystoviridae. The virion contains a genome of three segments (S, M, and L) of double-stranded RNA (dsRNA), which are enclosed in a polyhedral core along with polymerase molecules (20). The core is covered by a shell of a single protein species, P8, and this assemblage is enclosed in a lipid-containing membrane (5, 21). The virus propagates in plant pathogen Pseudomonas syringae. Genomic segment L codes for proteins P1, P2, P4, and P7, which are expressed early in infection and assemble to form the core particles (9). Transcripts of segment L along with those of segments S and M are observed early in infection. At later times, the amount of L transcript increases somewhat, while the amounts of S and M increase greatly. Most of the late-period L transcripts are found in packaged RNA, while the S and M transcripts are primarily found as free plus strands. The S and M segments code for proteins that are expressed later in infection (8). Core particles of the virus have in vitro transcriptase activity for genomic segments S and M (12, 13). The polymerase of Φ6 shows a preference for G as opposed to U for the second nucleotide in its transcripts (1, 19). Segments S and M begin with GG, while segment L begins with GU. Incubation with host protein YajQ results in the transcription of segment L (15). Previous work has shown that productive infection is dependent upon the presence of YajQ in the host cells and that the protein binds to P1, which is the major structural protein of the virus core particle (15). Mutants of Φ6 that are not dependent on YajQ were isolated and were shown to have changes in P1 and in P2, the virion polymerase. Our working model for the activity of YajQ is as follows. The virus attaches to the host type IV pilus, which retracts so as to bring the virion to the surface of the outer membrane, where the viral membrane fuses so as to allow the nucleocapsids to enter the periplasmic space. The virion muramidase P5 digests a pathway in the cell wall so as to allow the entry of the nucleocapsid into the cell. Protein P8 is removed from the particle by an unknown mechanism and is eventually digested (16). The core particle is capable of transcribing genomic segments S and M, but it is covered by YajQ, which activates the transcription of genomic segment L. The amount of YajQ in the cell is limited, and as new particles are formed and filled, a few are covered by YajQ, but most of the new core particles are covered by protein P8 after minus-strand synthesis on the templates of packaged transcripts. Transcription of L continues during the late period of infection, but most of the L transcript is found in packaged particles and little L transcript is seen as single-stranded RNA (15).

In this study, we attempted to visualize the in vivo interaction of YajQ with virus particles to facilitate an understanding of the amount and the extent of binding, the timing, and the specificity of the interaction. The interaction of YajQ with core particles was originally apparent when it was found associated with carrier state particles. The amount of the protein associated with core particles was difficult to measure, since the affinity of the interaction was diminished by salt concentrations necessary for the maintenance of the structure of filled core particles (15). To that end, we have constructed green fluorescent protein (GFP) fusions of YajQ so that the interaction of YajQ with virus particles in vivo could be seen.

The gfp gene was copied from plasmid ED430 (4) by using oligonucleotides 588 and 1255, with the sequences CCCGGATCCTAAGAAGGAGATATACATATGAGTAAAGGAGAAGAACTTTTCAC and CCCCCTGCAGTTTGTATAGTTCATC, respectively. The PCR product was inserted into plasmid pLM350 with a 5′ BamHI site and a 3′ PstI site to form plasmid pLM3653. Plasmid pLM350 is a shuttle vector for Escherichia coli and pseudomonads derived from plasmid pLM254 (10). The yajQ gene was copied from plasmid pLM3556 (15) by using oligonucleotides 1256 and 1258, which placed a PstI site and a His tag sequence at the 5′ end and a HindIII site at the 3′ end. The sequences were CCCCCTGCAGCACCACCATCATCACCAC for 1256 and CCCCAAGCTTAGTCGCGGAAGTTGTT for 1258. The resulting PCR product was inserted into pLM3653 by using a 5′ PstI site and a 3′ HindIII site to form plasmid pLM3654. Plasmid pLM3654 was transferred to strain LM4470, which is P. syringae rough-lipopolysaccharide (LPS) strain LM2489 with a knockout of gene yajQ. The resulting strain is LM4622. Plasmid pLM3653, which codes for GFP without the fusion to YajQ, was transferred to strain LM2489 to make strain LM4624.

Strain LM4624 is a P. syringae strain carrying a plasmid that expresses GFP that is not fused to any other protein and shows uniform fluorescence even during infection with Φ6 or other members of the Cystoviridae (Fig. 1A). Strain LM4622 expresses a fusion protein that contains GFP at its N terminus and YajQ at its C terminus. The chromosomal yajQ gene is knocked out, but the plasmid expressing the fusion protein is able to complement the knockout with respect to the replication of Φ6 and its close relatives. Infection of strain LM4622 with phages such as Φ2954 and Φ2544 (which is Φ13 with the host attachment proteins of Φ6), which are distantly related to Φ6, did not change the uniform fluorescence of the cells (Fig. 1B and C). Neither of these phages is dependent upon YajQ for plaque formation (15). However, infection with Φ6 or Φ9 (11), a close relative, results in the appearance of punctate fluorescence (Fig. 1D and 2A). The number of particles entering cells when exposed to high multiplicities of virus is limited due to the attachment to the pili. At high multiplicities of infection, only three or four virions enter the cells and about 25% of the cells are not infected (16). Cells of LM4622 showed one to four fluorescent spots, and these developed during the first 30 min of the infection (Fig. 3). It might be that the period before the punctate pattern emerges is due to the time for the P8 shell to be removed. Infection with a mutant of Φ6 that has a deletion in gene 2, coding for the polymerase, resulted in one to three punctate forms (not shown). Since this phage is not capable of producing new particles filled with dsRNA, it is clear that the punctate forms are due to the infecting phage particles and that these forms are composed of single core particles. Particles that do not contain dsRNA do not bind YajQ in vitro (15). The fluorescent spots remained throughout the infection and moved slightly. The yield of Φ6 in a normal infection is several hundred particles per cell, but the number of core particles that are covered by P8 or without this middle shell at any given time has not been determined. On the basis of the small number of punctate forms and their stability, we propose that YajQ remains with the infecting particles and that only a few of the new particles have YajQ on them. The amount of YajQ in each cell would limit the number of particles that can bind substantial amounts of the protein. This would explain why early transcription of L is followed by late transcription primarily of S and M. Infection by a Φ6 virion with the attachment proteins of Φ13 results in a larger initial number of punctate forms (Fig. 2B). Φ13 attached to the rough LPS, and at high multiplicities of infection, the number of particles entering each cell was higher than that in the case of Φ6. It was even possible to see signs of premature lysis from without in these cases.

We determined the ratio of fluorescence in whole, uninfected cells to that of individual punctate forms. It appears that the amount of the YajQ fusion protein per cell is about six times that of the amount bound to a single particle. In addition, we determined the amount of GFP-YajQ fusions per cell by comparing the strength of the band produced by cells in a Western reaction to the strength of the band produced by dilutions of purified protein whose concentrations were determined by measuring optical density. In this case, we found that cultures of LM4622 contained an average of 1,500 molecules per cell. We suggest that approximately several hundred molecules of the YajQ fusion molecules are bound to each particle. This does not seem to be enough molecules to form a complete shell around the particle. The shell formed by protein P8 has an estimated 600 molecules (7). However, it seems clear that the number of molecules is substantial enough to cause a conformational change in the structure of the core particle.

Temporal regulation of gene expression is an important feature of bacteriophage infection programs. This is manifested by regulation of transcription or by regulation of message stability (14, 15). We have found that the replication of bacteriophage Φ6 is dependent upon the presence of host protein YajQ, a protein of unknown function that is highly conserved in Gram-negative bacteria (17). YajQ is necessary for the activation of the transcription of genomic segment L in vitro as well as in vivo (15). The mechanism of this activation is currently a mystery in that the protein binds to the major structural protein P1 of the viral core, yet it changes the activity of the polymerase which is inside the core (18). There are, however, precedents for such activity. In the case of Φ6, we have shown that polymerase is inactive during the packaging of the plus-strand transcripts of the genome until all three are inside the core (3). According to the working model, the expansion of the core changes the conformation of the polymerase so as to turn it on. In the case of rotavirus, the core particle that contains polymerase and genomic segments is not activated for transcription until viral protein VP6 binds and forms a shell structure around the core (2). In the case of reovirus, transcription is not activated until delta protein is removed from the entering core particle by the activity of host protein Hsc70 (6). Although we had found YajQ associated with viral core particles and done studies of the binding of YajQ to core particles, we could not be sure that substantial amounts of the protein were bound to infecting particles and whether they remained bound to these particles in vivo. The present study with GFP fusions has enabled us to demonstrate that the host protein is bound to incoming virions and that the association continues until lysis. Most fluorescent particles remain throughout infection; some disappear, and some new ones appear. This is consistent with the observation that about 20% of the incoming virion cores seem to recycle into mature virions but most of the infecting particles do not end up in mature virions again (16). The punctate pattern did not appear immediately upon infection; under the conditions of these experiments, it seemed to take approximately 30 min for the infecting particles to show fluorescence. This was seen with a phage that has a nonsense mutation in gene 2, resulting in no new functional particles being formed. We suggest that the delay is due to the time for protein P8 to be removed from the incoming nucleocapsids. Experiments to follow the fate of P8 have shown that it is removed from infecting particles and almost completely digested by 45 min after infection (16). The achievement of maximum levels of dot formation takes about 60 min postinfection and seems to involve the covering of a small number of new particles that does not increase further until the onset of lysis beginning at 120 min after infection. This might involve the binding of YajQ to incoming particles that have lost P8 and to a small number of newly filled particles.

FIG. 1.
  • Open in new tab
  • Download powerpoint
FIG. 1.

Images of cells carrying plasmids expressing green fluorescent protein (GFP) or N-terminal GFP fusions with YajQ. Cells infected with Φ6 showed a punctate pattern at 75 min after adsorption (D), while cells infected with Φ2954 (B) or Φ2544 (Φ13 with M segment of Φ6) (C) showed uniform fluorescence. (A) Normal cells infected with Φ6 but lacking the fusion protein showed uniform fluorescence. Cells were deposited on 1.2% agarose pads containing LB medium. Images were collected in a Nikon 90i microscope using a TIRF Plan Neo-Fluor 100× oil immersion objective (numerical aperture, 1.45). The filter set was BrightLine GFP-3035B-NTE-ZERO from Semrock Optical. Version 4 of the Volocity application (Improvision) was used for the acquisition and quantification of fluorescence intensities.

FIG. 2.
  • Open in new tab
  • Download powerpoint
FIG. 2.

(A) Infection of LM4622 with Φ9, a close relative of Φ6. (B) Infection of LM4622 with Φ2554, a derivative of Φ6 with the host attachment proteins of Φ13 enabling binding to rough LPS and consequently an increased number of entering particles and some lysis from without.

FIG. 3.
  • Open in new tab
  • Download powerpoint
FIG. 3.

Time course of infection with bacteriophage Φ6. Cells of LM4622 were infected with Φ6 and visualized at 34 min (A), 45 min (B), 60 min (C), and 75 min (D) after infection.

ACKNOWLEDGMENTS

This work was supported by NIH grant GM34352 to L.M.

We are grateful to Jeanette Hahn and members of the D. Dubnau laboratory for instruction in the techniques of fluorescence microscopy.

FOOTNOTES

    • Received 6 January 2010.
    • Accepted 9 February 2010.
  • Copyright © 2010 American Society for Microbiology

REFERENCES

  1. 1.↵
    Butcher, S. J., J. M. Grimes, E. V. Makeyev, D. H. Bamford, and D. I. Stuart. 2001. A mechanism for initiating RNA-dependent RNA polymerization. Nature410:235-240.
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.↵
    Charpilienne, A., J. Lepault, F. Rey, and J. Cohen. 2002. Identification of rotavirus VP6 residues located at the interface with VP2 that are essential for capsid assembly and transcriptase activity. J. Virol.76:7822-7831.
    OpenUrlAbstract/FREE Full Text
  3. 3.↵
    Frilander, M., P. Gottlieb, J. Strassman, D. H. Bamford, and L. Mindich. 1992. Dependence of minus strand synthesis upon complete genomic packaging in the dsRNA bacteriophage Φ6. J. Virol.66:5013-5017.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    Hahn, J., B. Maier, B. J. Haijema, M. Sheetz, and D. Dubnau. 2005. Transformation proteins and DNA uptake localize to the cell poles in Bacillus subtilis. Cell122:59-71.
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Huiskonen, J. T., F. de Haas, D. Bubeck, D. H. Bamford, S. D. Fuller, and S. J. Butcher. 2006. Structure of the bacteriophage phi6 nucleocapsid suggests a mechanism for sequential RNA packaging. Structure14:1039-1048.
    OpenUrlCrossRefPubMed
  6. 6.↵
    Ivanovic, T., M. A. Agosto, K. Chandran, and M. L. Nibert. 2007. A role for molecular chaperone Hsc70 in reovirus outer capsid disassembly. J. Biol. Chem.282:12210-12219.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    Jäälinoja, H. T., J. T. Huiskonen, and S. J. Butcher. 2007. Electron cryomicroscopy comparison of the architectures of the enveloped bacteriophages phi6 and phi8. Structure15:157-167.
    OpenUrlCrossRefPubMed
  8. 8.↵
    Mindich, L. 1988. Bacteriophage Φ6: a unique virus having a lipid-containing membrane and a genome composed of three dsRNA segments, p. 137-176. In K. Maramorosch, F. A. Murphy, and A. J. Shatkin (ed.), Advances in virus research, vol. 35. Academic Press, New York, NY.
    OpenUrlCrossRefPubMed
  9. 9.↵
    Mindich, L., and R. D. Abelson. 1980. The characterization of a 120 S particle formed during Φ6 infection. Virology103:386-391.
    OpenUrlCrossRefPubMed
  10. 10.↵
    Mindich, L., G. MacKenzie, J. Strassman, T. McGraw, S. Metzger, M. Romantschuk, and D. Bamford. 1985. cDNA cloning of portions of the bacteriophage Φ6 genome. J. Bacteriol.162:992-999.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    Mindich, L., X. Qiao, J. Qiao, S. Onodera, M. Romantschuk, and D. Hoogstraten. 1999. Isolation of additional bacteriophages with genomes of segmented double-stranded RNA. J. Bacteriol.181:4505-4508.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    Olkkonen, V. M., P. Ojala, and D. H. Bamford. 1991. Generation of infectious nucleocapsids by in vitro assembly of the shell protein onto the polymerase complex of the dsRNA bacteriophage Φ6. J. Mol. Biol.218:569-581.
    OpenUrlCrossRefPubMedWeb of Science
  13. 13.↵
    Partridge, J. E., J. L. Van Etten, D. E. Burbank, and A. K. Vidaver. 1979. RNA polymerase activity associated with bacteriophage Φ6 nucleocapsid. J. Gen. Virol.43:299-307.
    OpenUrlCrossRef
  14. 14.↵
    Qiao, X., Y. Sun, J. Qiao, and L. Mindich. 2009. Temporal control of message stability in the life cycle of dsRNA bacteriophage phi8. J. Virol.83:633-639.
    OpenUrlAbstract/FREE Full Text
  15. 15.↵
    Qiao, X., Y. Sun, J. Qiao, and L. Mindich. 2008. The role of host protein YajQ in the temporal control of transcription in bacteriophage Phi6. Proc. Natl. Acad. Sci. U. S. A.105:15956-15960.
    OpenUrlAbstract/FREE Full Text
  16. 16.↵
    Romantschuk, M., V. M. Olkkonen, and D. H. Bamford. 1988. The nucleocapsid of bacteriophage Φ6 penetrates the host cytoplasmic membrane. EMBO J.7:1821-1829.
    OpenUrlPubMedWeb of Science
  17. 17.↵
    Saveanu, C., S. Miron, T. Borza, C. T. Craescu, G. Labesse, C. Gagyi, A. Popescu, F. Schaeffer, A. Namane, C. Laurent-Winter, O. Barzu, and A. M. Gilles. 2002. Structural and nucleotide-binding properties of YajQ and YnaF, two Escherichia coli proteins of unknown function. Protein Sci.11:2551-2560.
    OpenUrlCrossRefPubMedWeb of Science
  18. 18.↵
    Sen, A., J. B. Heymann, N. Cheng, J. Qiao, L. Mindich, and A. C. Steven. 2008. Initial location of the RNA-dependent RNA polymerase in the bacteriophage phi 6 procapsid determined by cryo-electron microscopy. J. Biol. Chem.283:12227-12231.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    van Dijk, A. A., M. Frilander, and D. H. Bamford. 1995. Differentiation between minus- and plus-strand synthesis: polymerase activity of dsRNA bacteriophage Φ6 in an in vitro packaging and replication system. Virology211:320-323.
    OpenUrlCrossRefPubMed
  20. 20.↵
    Van Etten, J. L., L. Lane, C. Gonzalez, J. Partridge, and A. Vidaver. 1976. Comparative properties of bacteriophage Φ6 and Φ6 nucleocapsid. J. Virol.18:652-658.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    Vidaver, A. K., R. K. Koski, and J. L. Van Etten. 1973. Bacteriophage Φ6: a lipid-containing virus of Pseudomonas phaseolicola. J. Virol.11:799-805.
    OpenUrlAbstract/FREE Full Text
View Abstract
PreviousNext
Back to top
Download PDF
Citation Tools
Interaction of a Host Protein with Core Complexes of Bacteriophage Φ6 To Control Transcription
Xueying Qiao, Yang Sun, Jian Qiao, Leonard Mindich
Journal of Virology Apr 2010, 84 (9) 4821-4825; DOI: 10.1128/JVI.00026-10

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Virology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Interaction of a Host Protein with Core Complexes of Bacteriophage Φ6 To Control Transcription
(Your Name) has forwarded a page to you from Journal of Virology
(Your Name) thought you would be interested in this article in Journal of Virology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Interaction of a Host Protein with Core Complexes of Bacteriophage Φ6 To Control Transcription
Xueying Qiao, Yang Sun, Jian Qiao, Leonard Mindich
Journal of Virology Apr 2010, 84 (9) 4821-4825; DOI: 10.1128/JVI.00026-10
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Bacterial Proteins
Bacteriophage phi 6
Capsid Proteins
Pseudomonas syringae
RNA-binding proteins
Transcription, Genetic

Related Articles

Cited By...

About

  • About JVI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jvirology

@ASMicrobiology

       

 

JVI in collaboration with

American Society for Virology

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0022-538X; Online ISSN: 1098-5514