Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Virology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Genome Replication and Regulation of Viral Gene Expression

Production of Infectious Hepatitis C Virus by Using RNA Polymerase I-Mediated Transcription

Takahiro Masaki, Ryosuke Suzuki, Mohsan Saeed, Ken-ichi Mori, Mami Matsuda, Hideki Aizaki, Koji Ishii, Noboru Maki, Tatsuo Miyamura, Yoshiharu Matsuura, Takaji Wakita, Tetsuro Suzuki
Takahiro Masaki
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ryosuke Suzuki
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mohsan Saeed
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
4 Graduate School of Medicine, The University of Tokyo, Tokyo 113-0033, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ken-ichi Mori
2 Advanced Life Science Institute, Wako, Saitama 351-0112, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mami Matsuda
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hideki Aizaki
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Koji Ishii
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Noboru Maki
2 Advanced Life Science Institute, Wako, Saitama 351-0112, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tatsuo Miyamura
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yoshiharu Matsuura
3Department of Molecular Virology, Research Institute for Microbial Diseases, Osaka University, Suita-shi, Osaka 565-0871, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takaji Wakita
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tetsuro Suzuki
1Department of Virology II, National Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: tesuzuki@hama-med.ac.jp
DOI: 10.1128/JVI.02397-09
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Determination of the nucleotide sequences at the 5′-and 3′ ends of HCV RNA produced by the Pol I system. (A and B) 5′RACE and sequence analysis. A synthesized RNA adapter was ligated to RNA extracted from cells transfected with pHHJFH1. The positive-strand HCV RNA was reverse transcribed, and the resulting cDNA was amplified by nested PCR. The amplified 5′-end cDNA was separated by agarose gel electrophoresis (A), cloned, and sequenced (B). (C and D) 3′RACE and sequence analysis. RNA extracted from pHHJFH1-transfected cells, the culture supernatant of transfected cells, and the culture supernatant of H751JFH1/Zeo cells were polyadenylated, reverse transcribed, and amplified by PCR. The amplified 3′-end cDNA was separated by agarose gel electrophoresis (C), cloned, and sequenced (D).

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    HCV RNA replication and protein expression in cells transfected with Pol I-driven plasmids. (A and B) Assessment of HCV RNA replication by RPA. Pol I-driven HCV-expression plasmids were transfected into Huh-7 cells. Total RNA was extracted from the cells on day 5 p.t. and positive (A)- and negative (B)-strand HCV RNA levels were determined by RPA as described in Materials and Methods. In the RNase (−) lanes, yeast RNA mixed with RNA probes for HCV and human β-actin were loaded without RNase A/T1 treatment. In the yeast RNA lanes, yeast RNA mixed with RNA probes for HCV and human β-actin were loaded in the presence of RNase A/T1. (C) Northern blotting of total RNAs prepared from the transfected cells. Huh-7 cells transfected with pHHJFH1 or pHHJFH1/GND were harvested for RNA extraction through days 1 to 4 p.t. Control RNA, given numbers of synthetic HCV RNA; Huh-7, RNA extracted from naive cells. Arrows indicate full-length HCV RNA and β-actin RNA. (D) HCV protein expression in the transfected cells. Pol I-driven HCV-expression plasmids were transfected into Huh-7 cells, harvested, and lysed on day 6 p.t. The expression of NS5B, core, and GAPDH was analyzed by Western blotting as described in Materials and Methods. The asterisk indicates nonspecific bands.

  • FIG. 3.
    • Open in new tab
    • Download powerpoint
    FIG. 3.

    HCV released from cells transfected with Pol I-driven plasmids. (A) HCV particle secretion from the transfected cells. The culture supernatant of Huh-7 cells transfected with Pol I-driven plasmids containing wild-type or mutated HCV genome were harvested on days 2, 4, and 6 and assayed for HCV core protein levels. The data for each experiment are averages of triplicate values with error bars showing standard deviations. (B) Sucrose density gradient analysis of the culture supernatant of pHHJFH1-transfected cells. Culture supernatant collected on day 5 p.t. was cleared by low-speed centrifugation, passed through a 0.45-μm-pore-size filter, and concentrated ∼30-fold by ultrafiltration. After fractionating by sucrose density gradient centrifugation, the core protein level and viral infectious titer of each fraction were measured. (C) Kinetics of core protein secretion from cells transfected with pHHJFH1 or with JFH-1 genomic RNA. A total of 106 Huh-7 cells were transfected with 3 μg of pHHJFH1 or the same amount of in vitro-transcribed JFH-1 RNA by electroporation. The cells were passaged every 2 to 3 days before reaching confluence. Culture supernatant collected on the indicated days was used for core protein measurement. The level of secreted core protein (pmol/liter) is expressed on a logarithmic scale. The data for each experiment are averages of triplicate values with error bars showing standard deviations.

  • FIG. 4.
    • Open in new tab
    • Download powerpoint
    FIG. 4.

    Indirect immunofluorescence analysis of H751JFH1/Zeo cells. (A and B) H751JFH1/Zeo cells (A) and parental Huh7.5.1 cells (B) were immunostained with an anti-NS5A antibody. (C to F) The subcellular colocalization of de novo-synthesized HCV RNA and NS5A in H751JFH1/Zeo cells was analyzed. The cells were stained with DAPI (C), an anti-bromodeoxyuridine antibody (D), and an anti-NS5A antibody (E). The merge panel is shown in panel F.

  • FIG. 5.
    • Open in new tab
    • Download powerpoint
    FIG. 5.

    Loss of CD81 expression in H751JFH1/Zeo cells. The cell surface expression of CD81 on Huh7.5.1 cells (A), H751JFH1/Zeo clone H751-1 (B), and clone H751-50 (C) was analyzed by flow cytometry after being stained with anti-CD81 antibody.

  • FIG. 6.
    • Open in new tab
    • Download powerpoint
    FIG. 6.

    Genome mutations of HCV secreted from H751JFH1/Zeo cells. (A) RT-PCR of HCV genome extracted from the culture supernatant of H751JFH1/Zeo cells. Viral RNA sequences were reverse transcribed [RT (+)] or not [RT (−)], followed by amplification with primer pairs encompassing the specified HCV genome regions. (B) Comparison of the genome mutations of HCV secreted from H751JFH1/Zeo cells cultured for 120 days (upper panel) and JFH-1 RNA-transfected cells cultured for 36 days (lower panel). The positions of original (wild-type) and mutated (day 120, day 36) nucleotides are indicated under the schematic diagram of the HCV genome. Amino acid residues and their positions are marked in parentheses. Del, deletion.

  • FIG. 7.
    • Open in new tab
    • Download powerpoint
    FIG. 7.

    Effects of glycosylation inhibitors on HCV production from H751JFH1/Zeo cells. (A and B) Effects of glycosylation inhibitors on the secretion of HCV core protein. H751JFH1/Zeo cells were seeded at a density of 1 × 104 cells/well in a 96-well culture plate (A) or 3 × 104 cells/well in a 12-well cell culture plate (B). One day later, each compound was added to the cell culture supernatant at the indicated concentrations. The culture supernatant was collected after a further 3-day culture and processed by core protein-specific ELISA. The control represents an untreated cell culture. The level of secreted core protein was normalized by setting the control value at 100%. The data for each experiment are averages of triplicate values with error bars showing standard deviations. (C) Effects of NN-DNJ and KIF on infectious HCV production. The culture supernatant obtained in panel B was used to infect naive Huh7.5.1 cells. At 72 h after infection, the inoculated cells were fixed and immunostained as described in Materials and Methods for titration of virus infectivity. The infectious titer was normalized by setting the control value at 100%. Cells were treated with INF-α at 100 IU/ml as a positive control. The data for each experiment are averages of triplicate values with error bars showing standard deviations. The control represents an untreated cell culture. (D) After 1 year of culturing H751JFH1/Zeo cells, antiviral effects of NN-DNJ and BILN 2061 were evaluated. H751JFH1/Zeo cells were seeded at a density of 3 × 104 cells/well in a 12-well cell culture plate. One day later, each compound was added to the cell culture supernatant at the indicated concentrations. The culture supernatant was collected after a further 3-day culture and processed by core protein-specific ELISA. The control represents an untreated cell culture. The level of secreted core protein was normalized by setting the control value at 100%. The data for each experiment are averages of triplicate values with error bars showing standard deviations.

  • FIG. 8.
    • Open in new tab
    • Download powerpoint
    FIG. 8.

    Establishment of a trans-packaging system involving two-plasmid transfection. (A) Schematic representation of the plasmids used for the production of HCV-LP. HCV polyproteins are indicated by the open boxes. Bold lines indicate the HCV UTR. EMCV IRES is denoted by gray bars. The firefly luciferase gene (F Luc) is depicted as a gray box. CAG, CAG promoter; Pol I P, Pol I promoter; dC, 5′ region of Core gene; Pol I T, Pol I terminator. (B) Luciferase activity in Huh7.5.1 cells inoculated with culture supernatant from cells transfected with the indicated plasmids. Luciferase activity is expressed in terms of relative luciferase units (RLU). The data for each experiment are averages of triplicate values with error bars showing standard deviations. (C) Culture supernatant from cells cotransfected with pHH/SGR-Luc and the indicated plasmids were collected 4 days p.t. The luciferase activity in Huh7.5.1 cells inoculated with culture supernatant was determined 3 days postinoculation and expressed as relative luciferase units (RLU). The RLU was normalized according to the luciferase activity observed in the pCAG/C-NS2-transfected sample (C-NS2), which was set at 100%. The data for each experiment are averages of triplicate values with error bars showing standard deviations. (D) Huh7.5.1 cells were inoculated with HCVLP in the absence (−) or presence of 5 μg of anti-CD81 or anti-FLAG antibody/ml. The luciferase activity was determined 72 h postinoculation and is expressed as relative luciferase units (RLU). The RLU was normalized to the level of luciferase activity observed in the antibody-untreated sample (−), which was set at 100%. The data for each experiment are averages of triplicate values with error bars showing standard deviations.

Tables

  • Figures
  • TABLE 1.

    Oligonucleotides used for RT-PCR and RACE of the JFH-1 genome

    Method or segmentOligonucleotideSequences (5′-3′)
    5′RACERTGTACCCCATGAGGTCGGCAAAG
    45-nt RNA adapterGCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA
    5′RACEouter-SGCTGATGGCGATGAATGAACACTG
    5′RACEouter-RGACCGCTCCGAAGTTTTCCTTG
    5′RACEinner-SGAACACTGCGTTTGCTGGCTTTGATG
    5′RACEinner-RCGCCCTATCAGGCAGTACCACAAG
    3′RACECAC-T35CACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
    3X-10SATCTTAGCCCTAGTCACGGC
    nt 129-236744S (1st PCR)CTGTGAGGAACTACTGTCTT
    2445RTCCACGATGTTCTGGTGAAG
    17S (2nd PCR)CGGGAGAGCCATAGTGG
    2367RCATTCCGTGGTAGAGTGCA
    nt 2285-46652099S (1st PCR)ACGGACTGTTTTAGGAAGCA
    4706RTTGCAGTCGATCACGGAGTC
    2285S (2nd PCR)AACTTCACTCGTGGGGATCG
    4665RTCGGTGGCGACGACCAC
    nt 4574-70024547S (1st PCR)AAGTGTGACGAGCTCGCGG
    7027RCATGAACAGGTTGGCATCCACCAT
    4594S (2nd PCR)CGGGGTATGGGCTTGAACGC
    7003RGTGGTGCAGGTGGCTCGCA
    nt 6949-96346881S (1st PCR)ATTGATGTCCATGCTAACAG
    3X-75RTACGGCACTCTCTGCAGTCA
    6950S (2nd PCR)GAGCTCCTCAGTGAGCCAG
    3X-54RGCGGCTCACGGACCTTTCAC
PreviousNext
Back to top
Download PDF
Citation Tools
Production of Infectious Hepatitis C Virus by Using RNA Polymerase I-Mediated Transcription
Takahiro Masaki, Ryosuke Suzuki, Mohsan Saeed, Ken-ichi Mori, Mami Matsuda, Hideki Aizaki, Koji Ishii, Noboru Maki, Tatsuo Miyamura, Yoshiharu Matsuura, Takaji Wakita, Tetsuro Suzuki
Journal of Virology May 2010, 84 (11) 5824-5835; DOI: 10.1128/JVI.02397-09

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Virology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Production of Infectious Hepatitis C Virus by Using RNA Polymerase I-Mediated Transcription
(Your Name) has forwarded a page to you from Journal of Virology
(Your Name) thought you would be interested in this article in Journal of Virology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Production of Infectious Hepatitis C Virus by Using RNA Polymerase I-Mediated Transcription
Takahiro Masaki, Ryosuke Suzuki, Mohsan Saeed, Ken-ichi Mori, Mami Matsuda, Hideki Aizaki, Koji Ishii, Noboru Maki, Tatsuo Miyamura, Yoshiharu Matsuura, Takaji Wakita, Tetsuro Suzuki
Journal of Virology May 2010, 84 (11) 5824-5835; DOI: 10.1128/JVI.02397-09
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

biotechnology
hepacivirus
RNA Polymerase I
Transcription, Genetic
virus replication

Related Articles

Cited By...

About

  • About JVI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jvirology

@ASMicrobiology

       

 

JVI in collaboration with

American Society for Virology

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0022-538X; Online ISSN: 1098-5514