Analysis of the Differential Host Cell Nuclear Proteome Induced by Attenuated and Virulent Hemorrhagic Arenavirus Infection

Cell culture and viruses.P388D1 (murine macrophage-like) cells were maintained in RPMI medium supplemented with 5% fetal bovine serum and 2 mM glutamine. Cells were infected with purified P2 or P18 PICV at a multiplicity of infection of 1 or mock infected with an equivalent fraction of virus purification medium. Cells were harvested at various times postinfection, and cytoplasmic and nuclear extracts prepared. Time points are relative to the time of initial virus addition to the culture medium.

Viruses were from serially spleen-passaged stocks from inbred strain 13 guinea pigs infected with PICV Munchique strain CoAn 4763 (72). Virus was quantified in a standard plaque assay on Vero cells as described previously (5). Viruses were purified by using polyethylene glycol gradients to remove potential contamination from cytokines and other soluble factors.

Cell extract preparation.Cytoplasmic and nuclear extracts were prepared from P388D1 cells as previously described (23), with the addition of a nuclear purification step using Optiprep (Axis-Shield) gradients. Briefly, lysates were underlayered with 10 ml 30% Optiprep and 5 ml 35% Optiprep and centrifuged at 4°C for 30 min at 4,300 × g. The interface was removed and placed in a fresh tube which was filled with sucrose buffer I as previously described (27), plus 1.5 mM CaCl₂. Following centrifugation at 4°C for 15 min at 1,900 × g, the pellet was resuspended in sucrose buffer I and the centrifugation repeated. Nuclear lysis was completed by following the referenced protocol. Protein concentrations were determined by using a bicinchoninic acid assay kit (Pierce Biotechnology, Rockford, IL).

Electrophoresis and immunoblotting.Protein samples were denatured in sodium dodecyl sulfate (SDS)-PAGE loading buffer (100 mM Tris, pH 6.8, 4% SDS, 5% 2-mercaptoethanol [vol/vol], 30% glycerol) and boiled for 5 min. A 5-μg sample per lane was loaded onto Invitrogen Novex 10% gels (Invitrogen, Carlsbad, CA); the gels were electrophoresed, and then transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA) and immunodetected following standard protocols. Antibodies to hnRNP A2/B1 and A1 were purchased from Abcam (Kendall, MA).

Separations and differential analysis.Nuclear extracts were used for proteomics analysis. Samples with a low protein concentration were concentrated on Microcon 10-kDa molecular-weight-cutoff (Millipore, Billerica MA) spin filters, according to the manufacturer's protocol, prior to 2D-gel electrophoresis. All samples were desalted on spin desalting columns (Pierce Biotechnology, Rockford, IL) prior to isoelectric focusing (IEF). A 200-μg amount of protein was used for each sample replicate. DeStreak rehydration buffer and 0.5% immobilized pH gradient (IPG) buffer, pH 3 to 10, (GE Healthcare) were added to each replicate for rehydration of 11-cm, pH 3 to 10 IPG strips (GE Healthcare). IEF was accomplished in a stepwise fashion by first applying 50 V for 11 h to assist in rehydration of the IPG strips, followed successively by 250 V for 1 h, 500 V for 1 h, 1,000 V for 1 h, 8,000 V for 2 h, and, finally, 8,000 for 6 h.

Following IEF, the strips were frozen at −80°C. Strips were then thawed in 4 ml 6 M urea, 50 mM Tris, 2% SDS, 20% glycerol, and 5 mM Tris (2-carboxyethyl) phosmine for 15 min. The strips were then incubated in the same buffer and 25 mg/ml iodoacetamide for 15 min. The strips were rinsed in running buffer and placed in IPG wells of 8-to-16% Tris Criterion polyacrylamide gels (Bio-Rad, Hercules, CA). Agarose 0.5% was overlaid, and the second dimension was run at 150 V for 2.25 h at 4°C. The running buffer was 25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3. The gels were fixed overnight in 50% methanol, 10% acetic acid. The gels were stained with Pro Q Diamond stain, followed by Sypro ruby gel stain (Molecular Probes, Eugene, OR), according to the manufacturer's protocol. The gels were imaged either on a Fuji FLA-5100 laser scanner or a Perkin Elmer ProXpress proteomics imaging system.

Forty-five nuclear extracts from mock-, P2-, and P18-infected cells at 2 h, 4 h, 8 h, 12 h, and 16 h in triplicate were prepared for 2D electrophoresis. However, five samples had insufficient protein for 2D analysis. This led to the exclusion of the 12-h time point from further analysis. The 40 2D gels were analyzed by using Progenesis Discovery software, version 2005 (Nonlinear Dynamics Ltd., Newcastle upon Tyne, United Kingdom). The software automatically detects spots on each gel based upon a proprietary algorithm. Spot filtering and editing is then manually performed to remove those spots whose intensity values are insufficient for identification via mass spectrometry. Average gels were created from the four gels of each type of treatment, and the maximum number of gels where the spots may be absent was one in four. The automatic matching of spots between the gels was manually reviewed and adjusted as necessary. Due to the large number of gels in this experiment, the analysis for each time point was performed separately for all the conditions to ensure that the maximum number of spots were accurately matched between gels and conditions. Normalization of spot volumes was then performed on the gels based on total spot volume for each gel. The ratio of normalized spot volumes was then calculated across all relevant average gels.

Spots for subsequent identification were selected based upon a relative abundance of more than twofold. The protein gel spots were excised and prepared for matrix-assisted laser desorption ionization (MALDI) MS-MS analysis by using ProPic and ProPrep robotic instruments (Genomic Solutions, Ann Arbor, MI), following the manufacturer's protocols. Briefly, dried gel pieces were incubated with 20 μg/ml trypsin (Promega, Madison WI) in 25 mM ammonium bicarbonate, pH 8.0, at 37°C for 4 h. The peptide solution is drawn through a ZipTip by the ProPrep robot, and the peptides eluted with 50% acetonitrile-water containing α-cyano-cinnapinic acid and spotted onto an MALDI plate for MS analysis.

MS.MALDI-tandem time-of-flight (TOF-TOF) MS on an Applied Biosystems 4800 MALDI TOF/TOF proteomics analyzer (Foster City, CA) was used to analyze the samples and determine protein identification. The Applied Biosystems software package included 4000 series Explorer (version 3.6 RC1) with Oracle database schema version (version 3.19.0) and data version (3.80.0) to acquire both MS and MS-MS spectral data. The instrument was operated in positive ion reflectron mode, the mass range was 850 to 3,000 Da, and the focus mass was at 1,700 Da. For MS data, 1,000 to 2,000 laser shots were acquired and averaged from each sample spot. Automatic external calibration was performed by using a peptide mixture with reference masses of 904.468, 1,296.685, 1,570.677, and 2,465.199 Da.

Following MALDI MS analysis, MALDI MS-MS was performed on several (4-9) abundant ions from each sample spot. A 1-kV positive-ion MS-MS method was used to acquire data under post-source decay conditions. The instrument precursor selection window was ±3 Da. For MS-MS data, 2,000 laser shots were acquired and averaged from each sample spot. Automatic external calibration was performed by using reference fragment masses of 175.120, 480.257, 684.347, 1,056.475, and 1,441.635 Da (from a precursor mass of 1,570.700 Da).

Applied Biosystems GPS Explorer (version 3.6) software was used in conjunction with MASCOT to search the respective protein databases using both MS and MS-MS spectral data for protein identification. Protein match probabilities were determined by using expectation values and/or MASCOT protein scores. MS peak filtering included the following parameters: mass range, 800 Da to 4,000 Da; minimum signal/noise filter = 10; mass exclusion list tolerance = 0.5 Da; and the mass exclusion list (for some trypsin- and keratin-containing compounds) included masses of 842.51, 870.45, 1,045.56, 1,179.60, 1,277.71, 1,475.79, and 2,211.1. For MS-MS peak filtering, the minimum signal/noise filter was 10.

For protein identification, the mouse taxonomy was searched in either the mouse NCBI or SwissProt database. Other selection parameters included the following: enzyme as trypsin; maximum missed cleavages = 1; fixed modifications included carbamidomethyl (C) for 2D-gel analyses only; variable modifications included oxidation (M); precursor tolerance was set at 0.2 Da; MS-MS fragment tolerance was set at 0.3 Da; mass = monoisotopic; and peptide charges were only considered as +1. The significance of a protein match, based on both the peptide mass fingerprint in the first MS and the MS-MS data from several precursor ions, is based on expectation values; each protein match is accompanied by an expectation value. The expectation value is the number of matches with equal or better scores that are expected to occur by chance alone. The default significance threshold is a P value of <0.05, so an expectation value of 0.05 is considered to be on this threshold. We used a more-stringent threshold of 10⁻³ for protein identification; the lower the expectation value, the more significant the score.

Student's t test significance testing was not performed on these protein spots for multiple reasons. First, our sample size was small; we had either three or four replicates for each protein spot, so the statistics of such a small sample size was underpowered for this study. Second, the outline shape of the same protein spot as defined by the Progenesis software varied from one 2D gel to the next, further complicating statistical comparison.

Ingenuity pathway analysis.The Ingenuity pathway analysis software (IPA) tool has been described in detail previously (11). Briefly, IPA consists of a large, manually curated knowledge base of cellular interactions and regulatory events mined from the peer-reviewed literature. An experimental data set can be used to query this knowledge base, and IPA will construct functional signaling networks based on known interactions within the knowledge base. The software uses Fisher's exact test to assign a statistical score of the probability that these in silico networks could be generated by chance. For our studies, a score of 5 (P = 10⁻⁵) was used as the cutoff for significance. Networks were constructed using the Ingenuity knowledge base as the reference set.

Electrophoretic mobility shift assay.The following single-stranded oligonucleotides were synthesized by BioSynthesis, Inc. (Lewisville, TX): DRAX, CCTAGCAACAGATGCGTCATCTCAAAA, and DPBX, CCTAGTGAGCAATGACTGATACAAAGC. Duplex oligonucleotides were annealed at 1.75 μM in 10 mM Tris-HCl (pH 7.6), 2 mM MgCl₂, 50 mM NaCl, 1 mM EDTA by heating to 95°C and cooled slowly. Probes were labeled with γ-³²P by using T4 polynucleotide kinase (Promega, Madison, WI) under standard reaction conditions. A 5-μg amount of nuclear extract was incubated with 0.1 pmol of labeled oligonucleotide probe in a 15-μl volume for 15 min under standard reaction conditions [20 mM HEPES (pH 7.5), 50 mM KCl, 2.5 mM MgCl₂, 20 mM dithiothreitol, 10% glycerol with 0.5 μg poly(dI-C) per ml]. Samples were then resolved by electrophoresis on a standard 6% acrylamide gel in 0.25× Tris-borate-EDTA. The gels were then dried and imaged on a Packard Instant Imager and by exposure to Autorad film (ISC Bioexpress, Kaysville, UT).

Flow cytometry.P388D1 cells were cultured in six-well plates and mock infected or infected with P2 or P18 PICV for 24 h. Cells were then harvested and washed in fluorescence-activated cell-sorting buffer (phosphate-buffered saline plus 0.05% sodium azide, 0.5% bovine serum albumin, and 2% fetal bovine serum). Cells were stained with anti-major histocompatibility complex II (MHC-II) conjugated to fluorescein isothiocyanate (eBioscience, San Diego, CA), washed three times in fluorescence-activated cell-sorting buffer, and analyzed by using a BD Canto flow cytometer (BD Biosciences, San Jose, CA). Data were analyzed by using FCS Express (De Novo Software, Los Angeles, CA).

Analysis of 2D-gel electrophoresis.Cell extracts from mock-infected or PICV P2 or P18 variant-infected P388D1 cells from triplicate cultures were prepared at 2, 4, 8, 12, and 16 h postinfection. While cell extracts from infected guinea pigs would have been preferable, the large amount of protein required for this study (milligram quantities) meant that in vitro infections were required. Additionally, at the time of this study the guinea pig genome had not been sequenced and so proteins could not be definitively identified by MS-MS peptide sequencing. Although mice infected with PICV do not exhibit symptoms, our previous studies have shown that murine cells infected in vitro exhibit similar responses in the signaling pathways that we have compared with those of cells from primary guinea pig macrophages, support viral replication, and show significant differences in their responses to P2 and P18 infections (8, 9, 24). Samples were resolved by 2D electrophoresis; triplicate gels were run per sample. There was insufficient protein in the 12-h samples to run triplicate gels, and so this time point was excluded from further analyses. Spots were considered to be up- or downregulated if the difference was seen on duplicate gels and was greater than twofold. A summary of the changes identified is shown in Fig. 1. As can be seen, infection with the P18 variant induced fewer total differences from mock infection than infection with the attenuated P2 variant at all time points, although P18 did induce more downregulation at 4 and 8 h postinfection. This finding is consistent with the results of our previous kinomics study, which showed significantly more-complex signaling networks induced during attenuated P2 infection in vivo (9). Of particular interest is the finding that the disparity between P2- and P18-induced changes is greatest at the earliest time point (2 h). This is consistent with our hypothesis that critical events early in infection are likely to be of key importance in determining the host's fate. Figure 1 also shows that there is a greater number of differences between P2 and P18 infections than between infection with either virus variant and mock infection at 2, 4, and 8 h postinfection. This result shows that, despite having very few genetic differences (72), the P2 and P18 variants of PICV produce strikingly different host responses.

• Open in new tab
• Download powerpoint

FIG. 1.

Summary of protein level changes over time following infection with P2 or P18 PICV. All up- and downregulated spots with a twofold or greater difference which were identified in duplicate or triplicate gels were tallied for each time point. Spots which were present or absent in one gel were recorded as upregulated or downregulated, respectively. Comparisons refer to the observation for the virus-infected sample or, in the case of P2 versus P18, for the P2-infected sample; M refers to mock infection. The y axis shows the number of >twofold differences. Individual protein changes can be found in Table S1 in the supplemental material. v, versus; hpi, hours postinfection.

Another point of interest is the difference in the number of proteins which show expression or modification changes following P2 or P18 infection. For example, at 2 h postinfection, the P2 variant induces an approximately equivalent number of upregulated and downregulated proteins; in contrast, P18 infection induces mainly upregulation of proteins. At 4 h postinfection, the cellular response to both P2 and P18 infection appears to predominantly involve upregulation of host proteins. By 8 h postinfection, the pattern is very different, with P2 infection resulting in a predominant upregulation of cellular proteins, similar to P18 at 2 h postinfection, and with P18 exhibiting a majority of downregulated events. By 16 h postinfection, both viruses produce a broadly similar response, with the vast majority of protein level changes being upregulation; accordingly, at this time point there are few significant protein level differences between P2 and P18 infections.

Spot identification by MS-MS.We next attempted to identify the proteins which showed differential expression between infections. We selected 190 spots for sequencing using MALDI-TOF-TOF MS-MS. This number included all of the spots that showed differential expression in P2 and P18 infections at all time points (118 spots) and the spots which showed the greatest increases or were present/absent between mock, P2, and P18 infections. A summary of all significant spot identifications (expectation value of <10⁻³ and/or protein score of >53) for all treatments and time points is shown in Table S1 in the supplemental material. As can be seen there, the majority of proteins identified with high confidence are members of the hnRNP family. Additionally, other key cellular proteins likely to be important in the cellular response to infection, including proteins involved in energy production and several heat shock proteins, were also identified. Figure 2 shows representative gels showing identified proteins from mock- and P2-infected cells. Unfortunately, a significant number of proteins sequenced were not identified with significant confidence scores or expectation values. We hypothesize that this was in part due to protein degradation due to the extensive time taken to perform the appropriate image warping and spot-matching analysis on the large number of gels used in this study.

• Open in new tab
• Download powerpoint

FIG. 2.

Representative gels showing proteins identified by MS-MS following 2D-PAGE. 2D electrophoresis was performed in triplicate on nuclear extracts from mock-, P2-, and P18-infected cells harvested at various times postinfection. Expression changes of proteins which showed >twofold differences between treatments in two or three of the gels were considered significant. One hundred ninety spots were selected for protein identification by MS-MS. The figure shows representative gels from mock- and P2-infected samples. The spots which were identified as having an expectation threshold of <10⁻⁶ are annotated. The proteins shown here correspond to the first two sections in Table S1 in the supplemental material. Boxed numbers are the spot identification numbers allocated by the software.

Construction of functional signaling networks.Due to the small number of proteins identified with high confidence in each comparison at each time point, the proteins identified for each comparison (mock- versus P2-infected cells, mock- versus P18-infected cells, and P2- versus P18-infected cells) at all time points were combined into a single data set using the SwissPROT accession number (http://www.expasy.org/sprot/ ) and severalfold-change value. Protein pathways that met the significance threshold were merged to produce the networks shown in Fig. 3.

• Open in new tab
• Download powerpoint

FIG. 3.

Pathway analysis reveals protein networks and key “hubs” of interaction. Significant proteins identified at all time points for each comparison were uploaded to the Ingenuity pathway analysis software using SwissPROT identifiers. Networks which met the cutoff threshold (score of >5) were merged to form the interaction networks shown. Proteins shown backed by gray symbols are those which were present in the data set, and proteins backed by white symbols were included in the networks on the basis of known interactions. Shaded regions highlight the subnetworks of interaction within each global network. Proteins in shaded regions are those directly identified from differentially expressed spots, and proteins in unshaded regions are those brought into the networks on the basis of known interactions mined from the literature. The networks are described in Results. (a) Mock versus P2. (b) Mock versus P18. (c) P2 versus P18.

Analysis of the mock versus P2 data set produced one significant (score of 39) network with protein functions related to lipid metabolism, molecular transport, and small-molecule biochemistry (Fig. 3a). Interestingly, the in silico-created network incorporated the cystic fibrosis transporter protein, which we have previously shown by kinome analysis to be involved in PICV-induced networks (9). The network also included the Fos proto-oncogene, included in our earlier networks constructed by high-throughput immunoblotting (8), the heat-shock protein 70 complex, and the transcriptional regulator CCAAT-enhancer binding protein alpha. The mock versus P18 data set produced a significant network (score of 30), shown in Fig. 3b, with protein roles in cellular assembly and organization, carbohydrate metabolism, cell signaling, and energy metabolism. As can be seen, there is a discrete, highly interconnected subnetwork involved in energy production and another, broader network, which shows a lower degree of interconnectivity, including the proto-oncogene c-Myc, previously identified in our kinome assay, and an hnRNP family member which can function as a transcription factor, hnRNP K.

As characterizing the pathogenesis-associated differences between P2 and P18 infections was the main aim of this study, all P2 versus P18 differences were sequenced. Thus, the data set constructed from the P2 versus P18 differences was considerably larger than that produced from data from infection with either virus compared to mock infection. Analysis of these data produced three significant networks (scores of 25, 25, and 13) which were merged to produce an integrated signaling network (Fig. 3c). As with the network produced for mock versus P18 infection, discrete subnetworks were observed, with roles in energy metabolism, carbohydrate metabolism, and molecular transport. As with previous analyses, comparison of the P2- and P18-induced proteomes produced signaling networks which included central nodes, such as c-Myc and c-Fos. The transcription factor SP1, previously shown to be differentially activated in P2 and P18 infections (9), is also a central, highly interconnected node in this analysis. The hnRNP K protein shows a high level of interconnectivity in this network. Interestingly, the nucleolar phosphoprotein nucleophosmin is incorporated into this network. Nucleophosmin has been shown to be an NF-κB coactivator (21, 40), suggesting a further mechanism for NF-κB regulation, consistent with the results of our earlier studies in which we identified differential NF-κB activity in P2 and P18 infections (24). Several other proteins identified in these networks, such as the insulin receptor (INSR) and annexin A2 (ANXA2), were found in our earlier network analyses.

We next looked at the functional roles of the differentially expressed/modified proteins in order to better understand the potential roles of these proteins in disease. Figure 4 shows significance scores of how these proteins map to known functional processes and diseases. The histogram represents a significance score, indicating the number of proteins which correspond to the particular process rather than an indication of activity. Both P2 and P18 infection led to significant changes in proteins involved in carbohydrate metabolism, energy production, cell signaling, and RNA trafficking compared to the results for mock infection. Of interest is the increased number of proteins induced by P2 that are involved in amino acid metabolism and protein degradation, folding, and synthesis. Consistent with the disease's pathology, a significant number of proteins with roles in hepatic-system disease, immune development, response and disease, and inflammatory disease are also differentially expressed in P2 and P18 infections. These functions centered on HSPD1/Hsp60 (downregulated in P2), HSPA5/78-kDa glucose-regulated protein (upregulated in P2), and hnRNP A2/B1 (all spots downregulated in P2).

• Open in new tab
• Download powerpoint

FIG. 4.

Functional significance of identified proteins. The Ingenuity pathway analysis software was used to perform a comparison analysis on the proteins that were differentially expressed/modified in P2- or P18-infected cells compared to their levels in mock-infected cells. These proteins are assigned roles in functional and disease processes on the basis of published reports. The bar represents the statistical involvement of proteins in these processes rather than an increase or decrease in process activity. The dashed line indicates the threshold of statistical significance.

Cytoplasmic shuttling of hnRNP proteins.As the majority of the spots we identified were hnRNP family members (representative gels are shown in Fig. 5) and these spots showed differential expression between infections, we further investigated the subcellular location of these proteins during time courses of infections by nuclear/cytoplasmic fractionation of infected cells and detection of hnRNP A2/B1 by immunoblotting (Fig. 6). Of particular interest is the observation that at 2 h postinfection, hnRNP A2/B1 is nuclear in mock- and P18-infected cells, whereas the protein localizes to the cytoplasm following infection with the attenuated P2 variant. At later stages of infection, P2 and P18 induce similar patterns of hnRNP A2/B1 expression and localization. Similar nuclear localization and expression was observed for hnRNP A1 (data not shown). These results are consistent with many of our previous data showing that P18-infected cells resemble mock-infected cells at early times postinfection, suggesting a failure to activate and/or active suppression of host cell responses.

• Open in new tab
• Download powerpoint

FIG. 5.

Example of differential hnRNP expression in P2- and mock-infected cells. Representative gels showing differences in hnRNP expression. The spots found to be hnRNP family members in the 2-h-time-point gels were identified with the Progenesis software. The spots shown in the figure correspond to the hnRNP proteins shown in the 2-h section of Table S1 in the supplemental material.

• Open in new tab
• Download powerpoint

FIG. 6.

hnRNP proteins show differential subcellular locations in P2- and P18-infected cells. P388D1 cells were mock (M), P2, or P18 infected in triplicate, and nuclear and cytoplasmic extracts prepared at various times postinfection. Samples were denatured in SDS-containing buffer and resolved by PAGE. Samples were immunoblotted with antibodies against hnRNP A1 and hnRNP A2/B1.

Differential activity of XBP-1.Network analysis of proteins which showed differential expression in P2 and P18 infections (Fig. 3c) implicated the transcription factor X-box binding protein 1 (XBP-1), a transcription factor involved in transactivating the MHC-II promoter. XBP-1 is a leucine zipper protein and is structurally similar to the AP-1 members c-Fos and c-Jun (41). To further investigate the role of this protein in PICV infection, nuclear extracts were prepared from P2- and P18-infected cells at 4 and 16 h postinfection and used to assay differences in binding to two probes previously characterized as XBP-1 binding sites (53). Differential binding was assayed by mobility shift assay (Fig. 7a). For both probes, P2 infection induced increased binding of the upper band (marked) at 4 h postinfection compared to the levels of binding induced by mock and P18 infections. By 16 h postinfection, both P2 and P18 led to increased levels of binding of the upper band.

• Open in new tab
• Download powerpoint

FIG. 7.

P2 and P18 infection induced differential XBP-1 binding to DNA and MHC-II surface expression. (a) Nuclear extracts from mock-, P2-, and P18-infected cells were harvested at 4 and 16 h postinfection and assayed by gel shift assay for their ability to bind two MHC-II promoter elements. Probes DRAX and DPBX are described in Materials and Methods. M, mock infection. (b) Surface expression of MHC-II on mock-, P2-, or P18-infected macrophages was assayed at 12 and 48 h postinfection by flow cytometry.

To determine whether these changes in MHC-II promoter binding led to a change in the surface expression of MHC-II, cells were mock infected or infected with P2 or P18 PICV for 12 or 48 h, and the levels of surface expression of MHC-II were determined by flow cytometry. Figure 7b shows an increase in MHC-II type I-E^k induced by P2 infection by 12 h compared to the levels induced by mock and P18 infections (median fluorescence intensity of 2,876, compared to 1,920 and 1,737 for mock and P18 infections, respectively). By 48 h, infection with P18 induces a striking increase in the surface expression of MHC-II, with P2 also inducing increased expression, with a more-heterogeneous population of MHC-II upregulation as shown by the wider distribution following staining with both MHC-II antibodies. These results correlate with the early change in XBP-1 binding induced by P2 infection, consistent with the early increase in MHC-II expression induced by P2 infection.