Roles of Phosphatidylinositol 3-Kinase and NF-κB in Human Cytomegalovirus-Mediated Monocyte Diapedesis and Adhesion: Strategy for Viral Persistence

HCMV culture and infection.Human embryonic lung fibroblasts were cultured in minimum essential media (Cellgro, Herndon, VA) supplemented with 10% fetal bovine serum (FBS; Gemini, Woodland, CA) at 37°C with 5% CO₂. Fibroblasts were infected with the low-passage clinical HCMV isolate TRpM1A (passages 3 to 6) and incubated in minimum essential media supplemented with 4% FBS. HCMV was purified on a 0.5 M sucrose gradient and resuspended in RPMI (Cellgro) as described previously (58). In the experiments outlined below, monocytes were infected with purified virus at a multiplicity of infection (MOI) of 15. Mock infection was carried out by adding an equivalent volume of RPMI to monocytes. UV-inactivated HCMV (UV-HCMV) was prepared as previously described and used to treat monocytes at an equivalent MOI of 15 (45, 46). UV-HCMV was replication defective and did not express detectable immediate-early gene products in human embryonic lung fibroblasts.

Monocyte isolation, treatment, and culture.Human peripheral blood monocytes were purified by double-density gradient centrifugation (60). Samples (240 ml) of whole blood were taken from donors by venipuncture and centrifuged though a Ficoll Histopaque 1077 (Sigma, St. Louis, MO) gradient. Mononuclear cells were washed six times to remove platelets. Monocytes were further purified by centrifugation through a Percoll (Pharmacia, Piscataway, NJ) gradient. For immunofluorescence staining assays and phagokinetic track motility assays (adherent conditions), the monocytes were plated on fibronectin (Calbiochem, San Diego, CA)-coated glass coverslips in 24-well plates at a cell density of 5.0 × 10⁴ cells per well or on colloidal gold-coated glass coverslips in 24-well plates at a cell density of 1.0 × 10³ cells per well. Monocytes were cultured in RPMI supplemented with 10% human serum (Sigma) at 37°C with 5% CO₂ for 2 hours and subsequently treated with dimethyl sulfoxide (DMSO; Sigma) as a solvent control, 50 μM of the PI(3)K inhibitor LY294002 (LY; Promega, Madison, WI), 5 μM of the NF-κB inhibitor Bay11-7082 (Bay11; EMD Biosciences, Inc., La Jolla, CA), or 4 μM of cytochalasin D (Promega) for 45 min. The concentrations of these inhibitors have previously been shown to be optimal in our system (14, 46). Adherent cells were then mock infected, HCMV infected (MOI of 15), UV-HCMV treated (equivalent MOI of 15), or phorbol 12-myristate 13-acetate (PMA) treated (10 ng/ml; Sigma). For all other assays (nonadherent conditions), the monocytes were treated with DMSO, LY (50 μM), or Bay11 (5 μM) and rocked on an orbital shaker for 45 min at 37°C in RPMI supplemented with 10% human serum. Pretreated cells were then mock infected, HCMV infected, or PMA treated as described above and cultured nonadherently. University Institutional Review Board and Health Insurance Portability and Accountability Act guidelines were followed for all experimental protocols involving human subjects.

Western blot analysis.Monocytes were isolated, treated, and incubated under nonadherent conditions as described above. To examine the expression of CD18, CD29, CD11a, CD11b, and CD11c in monomeric forms, cytoplasmic extracts were harvested at 6 hours postinfection (hpi) with an Active Motif cytoplasmic/nuclear extract kit according to the manufacturer's protocol with one exception: 0.5% deoxycholate was added to the lysis buffer to solubilize the integrin heterodimers. After the extracts were harvested, cytoplasmic extracts were mixed 1:1 with a 2× Tris-glycerol sample buffer consisting of 0.25 ml of 0.5 M Tris-Cl (pH 6.8), 0.2 ml glycerol, 0.1 mg bromophenol blue, and 1 ml H₂O. To disrupt CD18, CD11a, CD11b, and CD11c heterodimeric complexes, Triton X-100, which was suspended in STE buffer consisting of 25 mM Tris-HCl (pH 7.4), 1 mM Na₂EDTA, and 100 mM NaCl, was added to each sample to achieve a final concentration of 0.1%. To disrupt CD29 heterodimeric complexes, CHAPS {3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate} suspended in STE buffer was added to each sample to yield a final concentration of 0.6% CHAPS. Bovine serum albumin (BSA; nondenatured protein molecular weight marker kit; Sigma) was included as a reference after blot analysis. Equal protein amounts of the cytoplasmic extracts were separated by continuous native polyacrylamide gel electrophoresis (PAGE) and transferred to ImmunoBlot polyvinylidene difluoride membranes (Bio-Rad). For the analysis of ICAM-1 and ICAM-3 expression, total protein was harvested at 6 hpi in Laemmli sample buffer (Bio-Rad) and boiled for 10 min. Samples were separated by sodium dodecyl sulfate-PAGE and transferred to polyvinylidene difluoride membranes.

All blots were blocked in a solution of 5% skim milk, 0.1% Tween 20, and phosphate-buffered saline (PBS) and then incubated with anti-CD29 antibody (Ab; Chemicon, Temecula, CA), anti-CD18 Ab (Chemicon), anti-ICAM-1 Ab (MAB2146Z; Chemicon), anti-ICAM-3 Ab (Chemicon), anti-CD11a Ab (Chemicon), anti-CD11b Ab (BD Pharmingen, San Diego, CA), anti-CD11c Ab (Chemicon), or anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase) Ab (Santa Cruz Biotechnology) in blocking solution overnight. The blots were washed and incubated with the appropriate horseradish peroxidase-conjugated secondary Ab (Santa Cruz Biotechnology), and the proteins were detected with an enhanced chemiluminescence plus kit (Pharmacia).

Monocyte diapedesis.Monocyte diapedesis assays were performed with human dermal microvascular endothelial cells (HMECs) cultured on cell culture inserts (BD Falcon, Bedford, MA) with an 8-μm pore size in 24-well plates and grown to confluence (4, 45, 46). HMECs were incubated and grown to confluence in endothelial cell growth medium-1 (Clonetics, Walkersville, MD) supplemented with 5% heat-inactivated FBS (Clonetics), hydrocortisone (1 μg/ml; Clonetics), human epidermal growth factor (10 ng/ml; Clonetics), bovine brain extract (12 μg/ml; Clonetics), and gentamicin sulfate amphotericin-B (Clonetics) at 37°C with 5% CO₂. Monocytes were isolated and labeled with CellTracker green CMFDA (5-chloromethylfluorescein diacetate; Molecular Probes, Eugene, OR) according to the manufacturer's protocol. Monocytes were then treated and incubated under nonadherent conditions for 3 h as described above. Monocytes were washed three times and resuspended in RPMI supplemented with 10% human serum. Prior to addition of monocytes to the transwells, the HMECs in the upper compartment were washed, and the media in the transwells were replaced with RPMI supplemented with 10% human serum. Labeled monocytes (2.5 × 10⁴) from each experimental arm were then added to each transwell and incubated at 37°C with 5% CO₂. Twenty-four hours after the addition of monocytes, the ratios of cells undergoing diapedesis to those cells that were stationary on the surface of the endothelial monolayer were determined by inverted fluorescence microscopy as previously described (46). Results are plotted as means ± standard deviations (SD) for 10 random fields of view. Statistical significance between experimental means (P value) was determined with Student's t test.

Phagokinetic track motility assay.Colloidal gold-coated coverslips were prepared as previously described (1, 45). Glass coverslips were immersed in a 300 Bloom gelatin solution (0.5 g in 300 ml; Sigma), heated at 90°C for 10 min, and dried at 70°C for 45 min. A colloidal gold suspension was prepared by adding 11 ml of tissue culture water (Sigma) and 6 ml Na₂CO₃ (36.5 mM) to 1.8 ml AuHCl₄ (14.5 mM; Fisher Scientific), bringing the solution to a boil, and rapidly adding 1.8 ml of 0.1% formaldehyde (Fisher Scientific). While hot, 2 ml of the colloidal gold suspension was added to each coverslip and incubated at 37°C for 1 h. The coverslips were washed and transferred to 24-well plates. Monocytes were isolated, treated, and incubated under adherent conditions as described above. Monocytes were incubated on colloidal gold coverslips for 6 h at 37°C with 5% CO₂. Cells were then fixed with 1.5% paraformaldehyde for 15 min and mounted on slides with glycerol. Track images of cells were video captured, and the average area cleared per cell out of 20 cells per sample was determined in square arbitrary units with Scion Image software. Results are plotted as means ± standard errors of the mean (SEM) for 50 cells. Statistical significance between experimental means (P value) was determined with Student's t test.

Firm adhesion of monocytes to endothelial cells.HMECs were incubated and grown to confluence in 24-well plates as described above. Monocytes were isolated and labeled with CellTracker green CMFDA according to the manufacturer's protocol. Monocytes were then treated and incubated under nonadherent conditions for 6 hours as described above. After 6 h of nonadherent incubation, 2.5 × 10⁵ labeled monocytes were added to each well and incubated for 30 min at 37°C with 5% CO₂. The wells were then washed four times with PBS, and RPMI supplemented with 10% human serum was added to each well. Fluorescence intensity was determined for each well with a fluorescence plate reader. Total input fluorescence intensities for each experimental arm were determined by omitting the washing steps. The baseline autofluorescence of endothelial cells was determined by reading wells containing HMECs alone, and this average value was subtracted from the fluorescence intensities of each well to yield an adjusted intensity. The percentage of adherent cells represents the adjusted fluorescence intensities of an experimental arm divided by the adjusted total input cell fluorescence. The experiment was performed in triplicate. The results are plotted as means ± SEM. Statistical significance between experimental means (P value) was determined by Student's t test.

To determine the roles of CD29, CD18, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion, adhesion assays were performed as described above, with one exception. Prior to the addition of monocytes to endothelial cells, HCMV-infected monocytes were incubated with 10 μg/ml of neutralizing Abs against CD29 (MAB1987Z; Chemicon), CD18 (CBL158; Chemicon), ICAM-1 (MAB2146Z; Chemicon), and ICAM-3 (MAB2149; Chemicon) or with an IgG1 isotype control Ab (R&D Systems, Minneapolis, MN) for 1 hour at room temperature. A fluorescence plate reader was used to determine the adjusted fluorescence intensities of each experimental arm as described above. To determine the changes in intensity over mock-infected monocytes (arbitrary units), the adjusted fluorescence intensities of mock-infected monocytes were subtracted from the adjusted fluorescence intensities of each experimental arm and multiplied by 1,000. The experiment was performed in triplicate. The changes in intensity over mock-infected monocytes for each experimental arm are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors.

RNA isolation and reverse transcription-PCR (RT-PCR).Monocytes were isolated, treated, and incubated under nonadherent conditions for 6 h as described above. At 6 hpi, total cellular RNA from infected monocytes was harvested with an RNA STAT-60 isolation reagent (Tel-Test Inc., Friendswood, TX). RNA samples were reverse transcribed with 400 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen Corp., Carlsbad, CA) in 1× reverse transcriptase buffer supplemented with 80 U of RNasin (Promega), random hexamers (0.1 μg/μl; Invitrogen Corp.), and 1 mM deoxynucleoside triphosphates (Amersham). After incubation at 37°C for 1 h, 2 U of RNase H (Stratagene, La Jolla, CA) was added. RT products were amplified by PCR performed in 1× iTaq buffer (Bio-Rad) containing 1.25 U of iTaq DNA polymerase (Bio-Rad) and a 50 μM concentration of each deoxynucleoside triphosphate. Primers specific for ICAM-1 (sense, AAGCCAAGAGGAAGGAGCAAGACT; antisense, TGAACCATGATTGCACCACTGCAC), ICAM-3 (sense, AGTGTACTGCAATGGCTCCCAGAT; antisense, TGGTTCATGACTGTCGCATTCAGC), CD29 (sense, TGCGAGTGTGGTGTCTGTAAGTGT; antisense, CCCGTGTCCCATTTGGCATTCATT), and CD18 (sense, ACTCCAGCAATGTGGTCCATCTCA; antisense, TAGCGCTCACAGTTGATGGTGTCA) were used to amplify regions of these genes. For all primers, an initial denaturing step at 95°C for 5 min and a final elongation step at 72°C for 7 min were utilized for each reaction. cDNAs were amplified in 32 cycles (for ICAM-1, ICAM-3, and GAPDH) or in 28 cycles (for CD29 and CD18) consisting of 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min. PCR products were analyzed by electrophoresis on a 1% agarose gel. Equal RNA loading was confirmed by repeating the PCR with GAPDH-specific primers (sense, GAAGGTGAAGGTCGGAGTC; antisense, GAAGATGGTGATGGGATTTC). Band intensities were determined by densitometry with Quantity One image analysis software (Bio-Rad) and normalized to GAPDH band intensities.

Immunofluorescence staining.Monocytes were isolated, treated, and incubated under adherent conditions as described above. Monocytes were fixed at 24 hpi. Monocytes were then either permeabilized with a solution consisting of 0.25 M sucrose and 0.5% Triton X-100 in PBS for 5 min at 4°C or were left unpermeabilized. Coverslips were blocked with a solution containing 10% human serum, 10% FBS, 10% normal goat serum, and 0.5% BSA in PBS for 30 min at room temperature. The coverslips were incubated with monoclonal Abs (MAbs) against CD29 (MAB1987Z; Chemicon), CD18 (CBL158; Chemicon), ICAM-1 (MAB2146Z; Chemicon), or ICAM-3 (MAB2149; Chemicon) in PBS (1:100 dilution) for 90 min at room temperature and washed three times. Cells were then incubated with the appropriate fluorescein isothiocyanate (FITC)-conjugated secondary Ab (Sigma) at a concentration of 1:200 for 1 hour and washed three times. Cells that were not permeabilized previously were now permeabilized as described above to allow for staining of F-actin. Actin and nuclear staining utilizing Alexa Fluor 546 phalloidin (Molecular Probes) and TO-PRO-3 (Molecular Probes), respectively, was performed according to the manufacturer's protocol. The coverslips were washed three times and mounted in Slow Fade Gold (Molecular Probes). Cells were examined and photographed with a confocal microscope at ×3,000 magnification (1,000× optical; 3× digital zoom).

Flow cytometry.Monocytes were isolated, treated, and incubated under nonadherent conditions as described above and cultured nonadherently for 24 h. Cells (1.0 × 10⁶ per experimental arm) were fixed with 2% paraformaldehyde, blocked with 10% human serum, 10% normal mouse serum, 10% normal goat serum, and 5.0% BSA in fluorescence-activated cell sorting (FACS) buffer, and stained with CD14-allophycocyanin (APC)-Cy7 MAb (1:30 dilution; BD Biosciences, San Jose, CA), CD29-APC MAb (1:30 dilution; BD Biosciences), CD18-phycoerythrin (PE)-Cy5 MAb (1:30 dilution; BD Biosciences), CD50/ICAM-1-FITC (1:30 dilution; BD Biosciences), and CD54/ICAM-3-PE (1:30 dilution; BD Biosciences) for 60 min. Following Ab staining, the cells were washed two times in FACS buffer and analyzed by flow cytometry using a FACSCalibur system (BD Biosciences). CD14⁺ cells alone are represented in the histograms.

NF-κB and PI(3)K are required for HCMV-induced monocyte diapedesis and motility.We previously reported that HCMV induces PI(3)K activation in monocytes over a 36-h time course of infection (46). Blocking PI(3)K activity with the PI(3)K-specific inhibitor LY prior to infection of monocytes abrogated the ability of the virus to promote monocyte motility, diapedesis, and migration through endothelial monolayers (46). In this study, our primary hypothesis was that HCMV required the cellular PI(3)K and NF-κB signaling pathways due to their critical role in regulating the molecular changes needed for monocyte motility and diapedesis through the endothelium. To test this hypothesis, we wanted to determine, first, the overall contribution of HCMV-induced NF-κB activation in mediating monocyte diapedesis and motility and then, second, the specific cellular changes mediated by these pathways that could promote viral dissemination.

To block NF-κB activity, we utilized the drug inhibitor Bay11, which blocks the phosphorylation and degradation of the NF-κB inhibitors IκBα and IκBβ (14). By this mechanism, Bay11 prevents the nuclear translocation of NF-κB and the transactivation of NF-κB-responsive promoters (14). For the following studies, we chose a concentration of 5 μM of Bay11 for two reasons. First, this dose has been reported to be effective in blocking NF-κB nuclear translocation (8). Second, 5 μM of Bay11 did not result in decreased monocyte viability at any of the time points examined in our study (data not shown). Western blot analyses of NF-κB activation and IκB degradation with and without Bay11 were utilized to validate our system (data not shown). HCMV infection induced nuclear NF-κB-p65 translocation and IκBα and IκBβ phosphorylation and degradation; pretreatment with Bay11 prior to HCMV infection abrogated these HCMV-induced changes in the NF-κB pathway. Pretreatment with LY partially blocked p65 nuclear translocation, indicating that PI(3)K signaling plays a partial role in HCMV-induced NF-κB activation in monocytes. This finding of a partial link between PI(3)K signaling and NF-κB signaling is likely due to the fact that HCMV signals through cellular receptors that are capable of activating NF-κB via PI(3)K-dependent and PI(3)K-independent mechanisms (10, 17, 56, 57). The use of LY in our system was also validated as previously documented (46).

To determine the role of NF-κB and PI(3)K in HCMV-induced transendothelial migration, monocytes were pretreated with LY, Bay11, or DMSO and then HCMV infected, mock infected, or PMA treated for 2 h. CellTracker green-labeled monocytes were added to cell culture inserts containing confluent monolayers of HMECs. The ratios of cells undergoing diapedesis to those cells that were stationary at the monolayer surface were determined by fluorescence microscopy after 24 h in culture (Fig. 1A). As previously reported, HCMV infection promoted monocyte diapedesis to a degree comparable to levels seen with the PMA positive control, and both HCMV-induced and PMA-induced diapedesis were dependent on PI(3)K activation (45, 46). Inhibition of NF-κB with Bay11 pretreatment likewise returned HCMV-induced and PMA-induced monocyte diapedesis to those levels seen with mock-infected monocytes treated with DMSO alone. These data demonstrate that HCMV-induced monocyte diapedesis through the endothelium depends on both the PI(3)K- and the NF-κB-associated signaling pathways. In addition, the results provide a general understanding of how specific signal transduction pathways modulate monocyte function, a process largely unknown.

• Open in new tab
• Download powerpoint

FIG. 1.

HCMV promotes transendothelial migration and motility of monocytes in a PI(3)K-dependent and NF-κB-dependent manner. (A) CellTracker green CMFDA-labeled monocytes were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml) for 3 h. Labeled monocytes (2.5 × 10⁴) were added to cell culture inserts containing confluent monolayers of HMECs. HCMV-induced monocyte diapedesis is dependent on both PI(3)K and NF-κB activity. The ratios of cells undergoing diapedesis to those cells that were stationary at the monolayer surface were determined by fluorescence microscopy after 24 h in culture. The results are plotted as means ± SD for 15 random fields of view. The results are representative of three independent experiments with separate blood donors. (B) Monocytes were plated on colloidal gold-coated coverslips for 1 hour. Cells were subsequently pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15), UV-HCMV treated (equivalent MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were incubated on coverslips for 6 h and fixed with 3% paraformaldehyde. Individual cell track images were captured. The average area (square arbitrary units) of colloidal gold cleared by 20 monocytes was determined for each experimental arm. Results are plotted as means ± SEM for 20 cells per experimental arm. The results are representative of three independent experiments with separate human blood donors. In both panels, lanes marked with an asterisk denote significance (P < 0.01); depending on the experiment, the HCMV-infected, UV-HCMV-treated, and PMA-treated samples are significantly different from the mock-treated samples and those samples treated with LY, Bay11, or cytochalasin D (Cyt D).

We next assessed the roles of NF-κB and PI(3)K activity on HCMV-induced monocyte motility (Fig. 1B). Monocytes were plated on colloidal gold-coated coverslips prior to drug treatment to eliminate changes in firm adhesion due to potential changes in adhesion molecule expression in the context of NF-κB and PI(3)K inhibition. After being allowed to adhere, the cells were pretreated with LY, Bay11, or DMSO and then HCMV infected, UV-HCMV treated, mock infected, or PMA treated. As a negative control, mock-infected, HCMV-infected, UV-HCMV-treated, and PMA-treated experimental arms were also treated during this incubation with cytochalasin D, an inhibitor of actin polymerization. Consistent with our previous findings (46), HCMV infection, UV-HCMV treatment, and PMA treatment significantly (P < 0.01) induced monocyte motility in a PI(3)K-dependent manner. Our work now demonstrates an essential role for NF-κB-dependent gene transactivation in the viral induction of monocyte motility, as Bay11 significantly reduced monocyte motility (P < 0.01). The induction of monocyte motility following UV-HCMV treatment confirms our previous findings that HCMV induces cellular changes in monocytes independent of viral gene expression, which does not occur in monocytes until 3 to 4 weeks postinfection (45).

HCMV induces firm adhesion of monocytes to endothelial cells: roles of NF-κB and PI(3)K.To determine if HCMV infection promoted firm adhesion of monocytes to endothelial cells, CellTracker green CMFDA-labeled monocytes were added to confluent monolayers of HMECs and fluorescence intensities determined with a fluorescence plate reader (Fig. 2A). HCMV infection and UV-HCMV treatment of monocytes induced firm adhesion of approximately 87% of input cells compared to the firm adhesion of approximately 21% of mock-infected input monocytes. These data indicate that HCMV infection of monocytes induced firm adhesion to endothelial cells independent of viral gene expression. Inhibition of NF-κB activity prior to infection resulted in a significant (P < 0.01) decrease in firm adhesion (approximately 15% of input monocytes). PI(3)K inhibition had a more subtle, although significant (P < 0.01), effect on HCMV-induced firm adhesion, with approximately 56% of input monocytes firmly adhering. The PMA-treated experimental arms had profiles similar to those seen with HCMV infection in the context of PI(3)K and NF-κB inhibition, although the induction of firm adhesion by PMA alone (47%) was not as robust as that by HCMV infection. These data suggest that HCMV is a potent inducer of adhesion molecule activation and that the upregulation of adhesion molecule expression occurs primarily through the activation of NF-κB in a PI(3)K-independent signaling pathway.

• Open in new tab
• Download powerpoint

FIG. 2.

HCMV promotes firm adhesion of monocytes to endothelial cells. (A) HCMV infection of monocytes promotes firm adhesion to endothelial cells in a PI(3)K-dependent and NF-κB-dependent manner. CellTracker green CMFDA-labeled monocytes were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Monocytes were cultured nonadherently for 6 h. Labeled monocytes (2.5 × 10⁵ per well) were then added to cell culture inserts containing confluent monolayers of HMECs in 24-well plates and incubated for 30 min. Cells were then washed four times, and fluorescence intensities were determined with a fluorescence plate reader. The percentage of adherent cells represents the ratio of the adjusted fluorescence intensities of an experimental arm to the total input cell-adjusted fluorescence intensities. The experiment was performed in triplicate. The results are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors. Lanes marked with an asterisk denote significance (P < 0.01); the HCMV-infected, UV-HCMV-treated, and PMA-treated samples are significantly different from the mock-treated samples and those samples treated with LY or Bay11. (B) CD29, CD18, ICAM-1, and ICAM-3 are required for HCMV-induced firm adhesion of monocytes to endothelial cells. CellTracker green CMFDA-labeled monocytes were treated and cultured as described above. Prior to addition of monocytes to endothelial cells, monocytes were incubated with neutralizing Abs against CD29, CD18, ICAM-1, or ICAM-3 or with an IgG1 isotype control Ab for 1 h at room temperature. Labeled monocytes (2.5 × 10⁵ per well) were then added to cell culture inserts containing confluent monolayers of HMECs in 24-well plates and incubated for 30 min. Cells were then washed four times and fluorescence intensities determined with a fluorescence plate reader in triplicate. To determine the changes in intensity over mock-infected monocytes (arbitrary units), the adjusted fluorescence intensities of mock-infected monocytes were subtracted from the adjusted fluorescence intensities of each experimental arm. The results are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors. The HCMV-infected group and the isotype control-treated HCMV-infected group are significantly different from the CD29, CD18, ICAM-1, and ICAM-3 neutralizing MAb-treated groups (P < 0.01). This significance is denoted in the appropriate lanes via an asterisk.

As stated above, CD49d/CD29 (α₄β₁), CD11a/CD18 (α_Lβ₂), CD11b/CD18 (α_Mβ₂), CD11c/CD18 (α_xβ₂), ICAM-1, and ICAM-3 are expressed by peripheral blood monocytes and are known to promote firm adhesion to the endothelium (13). To address the functional contribution of the β₁ integrins, the β₂ integrins, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion of monocytes, we utilized neutralizing Abs against CD29 (β₁ integrin subunit), CD18 (β₂ integrin subunit), ICAM-1, and ICAM-3 in our adhesion assays. Monocytes were labeled with CellTracker green and mock infected or HCMV infected. Prior to adhesion, the monocytes were treated with neutralizing Abs or an IgG1 isotype control and the change in intensity over mock-infected monocytes (arbitrary units) was determined for each experimental arm (Fig. 2B). The treatment of HCMV-infected monocytes with neutralizing Abs against the β integrin subunits (CD29, CD18), ICAM-1, and ICAM-3 completely blocked HCMV-induced firm adhesion of monocytes, while the treatment of HCMV-infected monocytes with the isotype control Ab alone had no effect on firm adhesion. These data demonstrate that these cellular adhesion receptors are critical for HCMV-induced firm adhesion of monocytes and, in a broader context, that the viral-induced molecular and/or cellular changes in monocyte function have bona fide biological benefits for the virus.

Regulation of CD29, CD18, ICAM-1, and ICAM-3 mRNA and protein levels by HCMV infection.We next wanted to correlate the roles of CD29, CD18, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion of monocytes to endothelial cells with the viral upregulation of these molecules at the mRNA level. Monocytes were pretreated as described above and were cultured nonadherently for 6 h. Total RNA was isolated, and RT-PCR was performed on all experimental samples with primers specific for the mRNA coding regions of CD29, CD18, ICAM-1, and ICAM-3 (Fig. 3). Band intensities were determined by densitometry (Table 1). CD29 message levels were upregulated following HCMV infection and PMA treatment, although PI(3)K and NF-κB played little or no role in regulating CD29 message expression under these conditions. The inhibition of PI(3)K activity in mock-infected monocytes resulted in increased CD29 message levels, suggesting that PI(3)K negatively regulated CD29 expression at the level of transcription or message stability in resting monocytes. HCMV-infected and PMA-treated monocytes showed similar modest increases in CD18 mRNA levels compared to mock-treated monocytes. Blocking NF-κB activity had a slight negative effect on CD18 expression in HCMV-infected and PMA-treated monocytes. In contrast, the inhibition of NF-κB activity in mock-infected monocytes resulted in increased CD18 message levels, suggesting that NF-κB negatively regulated CD18 expression. PI(3)K inhibition, however, reduced CD18 message levels in mock-infected, PMA-treated, and HCMV-infected monocytes. ICAM-1 was upregulated at the message level by HCMV and PMA treatment, and this increased message expression was largely dependent on NF-κB activity. ICAM-3 mRNA levels were also elevated following HCMV infection and PMA treatment; however, unlike those for the other adhesion receptors examined, the increase in ICAM-3 message expression was independent of both NF-κB and PI(3)K activities. The inhibition of NF-κB resulted in increased ICAM-3 message levels in mock-infected monocytes, suggesting a negative regulatory role for NF-κB in the expression of ICAM-3 by resting monocytes.

• Open in new tab
• Download powerpoint

FIG. 3.

Regulation of CD29, CD18, ICAM-1, and ICAM-3 mRNA expression in HCMV-infected monocytes. Monocytes were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were then cultured nonadherently for 6 h, and total RNA was harvested from each sample. RT-PCR was performed for CD29, CD18, ICAM-1, and ICAM-3. The results are representative of three independent experiments with separate human blood donors.

The next step in the investigation into viral regulation of adhesion molecule expression was to correlate changes in mRNA levels with changes in total protein levels for these adhesion molecules. Monocytes were treated nonadherently as described above for 6 h, and total protein was harvested and treated as described in Materials and Methods. Native Western blot analyses were performed to examine the total levels of CD29 and CD18 expression in their monomeric forms. Despite the substantial increase in CD29 mRNA levels following HCMV infection (Fig. 3 and Table 1), infected monocytes showed only marginal increases in CD29 expression at the protein level (Fig. 4). Furthermore, the inhibition of PI(3)K and NF-κB activity had no effect on the levels of CD29 protein expressed by mock-infected or infected monocytes (Fig. 4). In regard to CD18, total protein levels showed only minor increases following HCMV infection. No change was seen when PI(3)K or NF-κB activity was inhibited (Fig. 4). These data are comparable to those for the RT-PCR analysis of CD18 mRNA expression (Fig. 3 and Table 1), with the exception that CD18 mRNA levels dropped following PI(3)K inhibition.

• Open in new tab
• Download powerpoint

FIG. 4.

Regulation of CD29, CD18, CD11a, CD11b, CD11c, ICAM-1, and ICAM-3 protein expression in HCMV-infected monocytes. Monocytes were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were then cultured nonadherently for 6 h, and protein was harvested and solubilized. Samples for the analysis of CD29, CD18, CD11a, CD11b, and CD11c were separated by continuous native PAGE with equal protein loading. Samples for the analysis of ICAM-1 and ICAM-3 were separated by sodium dodecyl sulfate-PAGE with equal protein loading based on actin band intensity. Blots were probed with the different Abs stated in the figure.

Because CD11a, CD11b, and CD11c are the predominant β₂ integrin (CD18)-associated α subunits (15, 37, 39, 53), the expression of these monomeric α subunits was examined next to determine if their expression levels were a limiting factor in functional heterodimeric integrin expression. Similar to those of the β integrin subunits, the expression levels of these α integrin subunits did not substantially change following HCMV infection or when NF-κB or PI(3)K activity was inhibited (Fig. 4).

ICAM-1 and ICAM-3 expression levels were examined by Western blot analysis under denaturing conditions. In HCMV-infected monocytes, ICAM-1 protein levels were increased compared to those in mock-infected monocytes (Fig. 4) and were dependent on NF-κB activity but not PI(3)K activity. ICAM-3 protein expression increased only marginally in infected monocytes and was not altered considerably by LY or Bay11 pretreatments (Fig. 4). The protein expression profiles for ICAM-1 and ICAM-3 are consistent with the RT-PCR analysis of ICAM-1 and ICAM-3 mRNA levels (Fig. 3).

HCMV infection of monocytes upregulates CD29, CD18, ICAM-1, and ICAM-3 surface expression.It can be concluded from the experiments described above that the total protein levels of the β₁ and β₂ integrins and ICAM-3 showed only small increases in total protein expression following HCMV infection. However, integrin and ICAM-3 molecules in circulating leukocytes localize primarily to specific secretory vesicles rather than the cell surface, and the translocation of these adhesion molecules from secretory vessels to the cell membrane can be induced by mitogens such as PMA, chemokines, or cytokines (41). We hypothesized that HCMV, through the manipulation of cellular signaling pathways, would induce cell surface expression of the integrins and ICAM-3 and that ICAM-1 expression, due to its robust induction at the mRNA and protein levels following HCMV infection, would be localized primarily at the cell surface in both mock-infected and HCMV-infected monocytes. Monocytes were HCMV infected, mock infected, or PMA treated. At 24 hpi, cells were fixed and stained with Abs against CD29, CD18, ICAM-1, or ICAM-3 and the appropriate secondary Abs. Monocytes were then permeabilized, stained with TO-PRO-3 and phalloidin, and photographed by confocal microscopy. CD29, CD18, ICAM-1, and ICAM-3 cell surface expression levels in HCMV-infected and PMA-treated monocytes were all dramatically upregulated compared to those in mock-infected monocytes (Fig. 5). The cellular localization of the various adhesion receptors is appropriate and consistent with their use in adhesion and motility. The upregulation of the cell surface expression of these molecules in the absence of robust changes in total protein levels (ICAM-1 being an exception) hints at the complexities of the regulation of these adhesion receptors on monocytes and the processes that the virus has evolved to manipulate. These images of individual cells document two additional points. (i) HCMV induces morphological changes in infected monocytes that verify a conversion to a motile phenotype, exemplified in the pictures by cytoskeletal rearrangements, membrane ruffling, and the existence of multiple extensions. (ii) HCMV induces a distinctly different morphology than PMA. Infected monocytes show the motile phenotype discussed above, while on average, PMA-treated monocytes show a much more rounded cellular structure. This difference between HCMV-infected and PMA-treated monocytes is likely tied to the fact that only HCMV mediates the functional changes in monocytes that ultimately promote the monocyte-to-macrophage differentiation that we previously described (45).

• Open in new tab
• Download powerpoint

FIG. 5.

HCMV infection induces cell surface expression of CD29, CD18, ICAM-1, and ICAM-3. Monocytes were plated on fibronectin-coated coverslips for 2 h and subsequently HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml) and cultured for 24 h. Monocytes were fixed at 24 hpi and incubated with MAbs against CD29, CD18, ICAM-1, or ICAM-3. Cells were then incubated with the appropriate FITC-conjugated secondary Ab to label the adhesion receptors, permeabilized, and stained with Alexa Fluor 546 phalloidin (depicted in blue) to stain actin and TO-PRO-3 (depicted in red) to stain the nucleus, according to the manufacturer's protocol. Cells were examined and photographed with a confocal microscope (×3,000 magnification; 1,000× optical, 3× digital zoom). Results are representative of three independent experiments with different human blood donors.

Next, we quantitatively addressed the role that the PI(3)K and NF-κB pathways played in the increased surface expression of CD29, CD18, ICAM-1, and ICAM-3 following infection using flow cytometry (Fig. 6A -D). Monocytes were cultured for 24 hpi nonadherently following pretreatment with Bay11, LY, or DMSO. The flow cytometric analyses showed that CD29 (Fig. 6A), CD18 (Fig. 6B), ICAM-1 (Fig. 6C), and ICAM-3 (Fig. 6D) surface expression levels on HCMV-infected monocytes were increased compared to those on the mock-infected monocytes, consistent with our microscopy results. PI(3)K activity was required for maximal surface expression of CD29, CD18, and ICAM-3 in the HCMV-infected monocytes, while NF-κB activity was required for the maximal expression of ICAM-1 observed in the HCMV-infected monocytes. NF-κB activity appears to negatively control CD29 surface expression. These results suggest that another layer of control for these adhesion receptors is at the level of trafficking to the surface.

• Open in new tab
• Download powerpoint

FIG. 6.

Confirmation of HCMV-induced cell surface translocation of CD29, CD18, ICAM-1, and ICAM-3. Monocytes were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min and then HCMV infected (MOI of 15) or mock infected. Cells were then cultured nonadherently for 24 h. Cells were fixed and incubated with MAbs against CD29, CD18, ICAM-1, or ICAM-3 and examined by flow cytometry for CD29 expression (A), CD18 expression (B), ICAM-1 expression (C), or ICAM-3 expression (D). Results are representative of three independent experiments with separate blood donors.

Because of this apparent complexity in the regulation of the surface expression levels of these receptors compared to the regulation of the total levels of protein, we next examined the intracellular expression levels of CD29, CD18, ICAM-1, and ICAM-3 (Fig. 7) at 24 hpi by permeabilizing monocytes prior to receptor staining. Under these conditions, CD29 was detected throughout the cytosol in infected and mock-treated monocytes. However, infected cells showed increased surface expression and a subtle increase in total protein levels compared to mock-infected cells, consistent with the results of our studies discussed above. The data also showed that the nature of the treatment (infection of nonadherent cells versus infection of adherent cells) dictated the requirements for either a PI(3)K- or an NF-κB-dependent role, respectively, in the translocation of the β₁ integrins from secretory vessels to the cell surface. When monocytes were infected nonadherently, PI(3)K activity was the dominant pathway required for the surface expression of CD29 (shown in Fig. 6); no role was observed for NF-κB activity under these nonadherent conditions. However, when cells were adhered and infected, NF-κB activity appeared to be dominant (Fig. 7, middle [no surface expression is seen in the absence of NF-κB activity]). This point was confirmed when monocytes were examined by confocal microscopy for CD29 surface expression (in the absence of permeabilization) with or without Bay11 treatment (data not shown). The identification of a shift in the pathways regulating adhesion occurred only with the β₁ integrins. The mechanism responsible for this dual regulation is unknown, although our previous work hinted at differences in the regulation of the β₁ integrins in nonadherent versus adherent monocytes (data not shown and reference 60). Regardless, the data suggest that PI(3)K and NF-κB activations either promote CD29 translocation to the cell membrane or inhibit the endocytosis of cell surface-expressed CD29.

• Open in new tab
• Download powerpoint

FIG. 7.

HCMV infection of monocytes promotes the translocation of CD29, CD18, and ICAM-3 from the cytosol to the cell membrane. Monocytes were treated as stated in the legend for Fig. 5, with the following exceptions: (i) cells were pretreated with LY (50 μM), Bay11 (5 μM), or DMSO for 45 min prior to infection (MOI of 15) or mock treatment; (ii) prior to incubation of monocytes with Abs against the adhesion receptors, monocytes were permeabilized with Triton X-100; and (iii) TO-PRO-3 was the only other stain utilized. Cells were examined and photographed with a confocal microscope (×3,000 magnification; 1,000× optical, 3× digital zoom). Results are representative of three independent experiments with separate blood donors.

When mock-infected and HCMV-infected monocytes were permeabilized prior to Ab staining, CD18 was found in high levels throughout the cytosol (Fig. 7). LY pretreatment did not affect cytosolic CD18 expression in HCMV-infected monocytes, although as shown in Fig. 6, it inhibited the surface expression of CD18, thereby indicating a critical role for PI(3)K in either promoting the translocation of CD18 from the cytosol to the cell surface or inhibiting the endocytosis of cell surface-associated CD18. A role for PI(3)K in regulating CD18 cell surface expression, but not total cellular CD18 expression, is consistent with our Western blot analysis. The permeabilization of cells prior to ICAM-1 staining revealed little cytosolic staining (Fig. 7), which, taken together with our RT-PCR (Fig. 3) and Western blot analyses (Fig. 4), verifies that ICAM-1 expression is regulated solely at the level of NF-κB-dependent transcription. ICAM-3 cell surface expression was upregulated in HCMV-infected monocytes and was dependent on PI(3)K activity (Fig. 6). Cytosolic staining of ICAM-3 revealed that mock-infected, HCMV-infected, and LY-pretreated HCMV-infected cells had significant levels of cytosolic ICAM-3 (Fig. 7), which was not affected by the inhibition of PI(3)K activity. Together, these data demonstrate that HCMV induces the translocation of ICAM-3 to the cell surface in a PI(3)K-dependent manner. In conclusion, these results identify that a complex regulatory network exists for the regulation of monocyte adhesion receptors and that a pathogen, such as HCMV, must navigate these complex systems in order to utilize these cells as “Trojan horses” for hematogenous spread.