Article Figures & Data
Figures
- FIG. 1.
Schematic representation of HSV-1 tk gene and mutations in the seven-G homopolymer region. The top panel represents the tk gene, with the locations of the seven-G homopolymer region and the PCR primers shown. The bottom panel represents the wild-type TK protein and the mutated polypeptides predicted to correspond to mutations in the seven-G region. Gray boxes, ATP binding domains; striped boxes, nucleoside binding domains; bold lines, amino acid sequences resulting from frameshifts; aa, amino acids; dl, deletion; ins, insertion. The oval on the bottom polypeptide diagram indicates an insertion of one amino acid.
- FIG. 2.
Diffuse skin lesions on patient 708. This photograph of patient 708 was taken when the patient was 13 years old and shows diffuse skin lesions on the face and neck. A swab sample collected from the face on the day of the photograph grew HSV-1 that was sensitive to ACV (IC50 = 0.22 μg/ml).
- FIG. 3.
Extremely high HSV-1 DNA loads in TG and DRG of patient 708. Total DNA isolated from ganglia was quantified by real-time PCR with primers and a probe specific for the HSV-1 gG gene. (A) DNA samples isolated from TG of patient 708 and seven other patients were each used as templates in PCRs (500 ng/reaction). *, median; **, maximum. (B) DNA samples isolated from the left TG and left DRG of patient 708 were each used as templates in PCRs (50 ng/reaction).
- FIG. 4.
PCR subcloning and sequencing of HSV-1 tk DNA samples from ganglia of patient 708. Total DNA samples isolated from ganglia were amplified by PCR with primers specific for HSV-1 tk so that the product encompassed the entire ORF of tk. The PCR products were then subcloned into plasmid vectors, and DNA samples prepared from single bacterial colonies were sequenced. (A) Representative gel showing the 1.2-kb PCR products from the LT2, LT9, and LL1 DRG, indicated by an arrow. MW, molecular weight standard. (B to F) Chromatograms showing the seven-G homopolymer regions of tk clones from patient 708 with a variety of mutations: one-G deletion (B), seven-G WT sequence (C), one-G insertion (D), two-G insertion (E), and three-G insertion (F).
- FIG. 5.
Comparison of the frequencies of nucleotide mutations in clones obtained by PCR amplification from ganglia of patient 708 and from a plasmid with WT tk. The nucleotide mutation rates (calculated as the number of nucleotides mutated divided by the total number of nucleotides sequenced from tk clones derived from individual ganglia) were determined for clones from patient 708 ganglion DNA and for clones from a plasmid containing WT tk. The nucleotide mutation rates for clones from 11 of 12 ganglia were lower than that for the WT tk control plasmid.
Tables
- TABLE 1.
Oligonucleotides used for PCR and sequencing
Name Sequence (5′ to 3′) tkF1b CGCCAAGCTTAAGCCACCATGGCTTCGTACCCCG tkR1 CCGTTCTAGAGTTAGCCTCCCCCATCT tkF51 GAAACTCCCGCACCTCTTCGG tkR61 GGTTCCTTCCGGTATTGTCTCC tkF82 AAGCGCCCAGATAACAATGG tkR21 AACACAGGAGGGCGGCGATG tkF5 CAAGAAGCCACGGAAGTC tkR2 GCTGTCCCCAATCCTCCCG M13 Forward (−20) GTAAAACGACGGCCAG M13 Reverse CAGGAAACAGCTATGAC pc3.1F AGAGAACCCACTGCTTACTGGC pc3.1R CTAGAAGGCACAGTCGAGGCTG - TABLE 2.
Results of drug sensitivity testing of HSV-1 clinical isolates from patient 708
Patient agea (yrs) Site of swab IC50 (μg/ml)b of: Last recorded therapy ACV Foscarnet 18.84 Skin 13 22 ACV and foscarnet 18.79 Left inguinal area 0.5 14 Foscarnet 14.39 Labium 3.2 19 ACV 14.39 Abdomen 1.9 16 ACV 13.67 Chin 0.1 27 Foscarnet 13.62 Face 0.2 48 Foscarnet 13.10 Vagina 3.9 NR ACV 13.10 Vagina 1.8 NR ACV - TABLE 3.
Diverse mutations in the HSV-1 tk seven-G homopolymer region detected in individual ganglia from patient 708
Source of DNA No. of clones sampled No. of clonesa with: % of mutant clones 7-G (WT) sequence 1-G del 1-G ins 2-G ins 3-G ins LTG 48 46 2 0 0 0 4.2 LT2 ganglion 23 16 0 0 6 1 30 LT6 ganglion 75 59 0 2 12 2 21 LT7 ganglion 23 20 1 2 0 0 13 LT8 ganglion 23 12 0 2 6 3 48 LT9 ganglion 23 10 0 1 10 2 57 LL1 ganglion 23 15 0 7 0 1 35 LL3 ganglion 21 5 0 1 12 3 76 LS1 ganglion 24 19 0 0 5 0 21 LS2 ganglion 24 18 1 2 2 1 25 RT6 ganglion 23 21 2 0 0 0 8.7 RS1 ganglion 24 24 0 0 0 0 0.0 Total 354 265 6 17 53 13 25 ↵a del, deletion; ins, insertion.
- TABLE 4.
Determining the PCR subcloning fidelity of the seven-G homopolymer region in WT HSV-1 tk
PCR template No. of clones sampled No. of clonesa with: % of mutant clones 7-G (WT) sequence 1-G del 1-G ins 2-G ins 3-G ins LT6 DRG DNA from patient 708 46 38 0 2 5 1 17 Plasmid with WT tk 43 43 0 0 0 0 0.0b TG DNA from patient 725 24 24 0 0 0 0 0.0c ↵a del, deletion; ins, insertion.
↵b The difference between the results for the WT tk control template and the template from patient 708 were statistically significant (P = 0.006).
↵c The difference between the results for the template from patient 725 and that from patient 708 were statistically significant (P = 0.04).
- TABLE 5.
Determining the mutation rate during PCR subcloning of HSV-1 tk plasmid clones from patient 708 with nine-G sequences in the seven-G homopolymer region
PCR template No. of clones sampled No. of clones with: % of mutant clones 9-G sequence 9- and 8-G sequences 8-G sequence 7-G sequence Topo143-2.7 32 28 1 1 2 13 Topo143-4.11 12 9 0 1 2 25 Total 44 37 1 2 4 16 - TABLE 6.
Polymorphisms in HSV-1 tk clones from patient 708
Nucleotide position Nucleotide at indicated position in: HSV-1 17+ 332 HSV-1 tk clones from ganglia 21 tk clones from RT6 and 1 clone from RS1 68 A G G 102 A A G 106 A G G 171 C T T 261 C T C 266 G A A 271 T C C 513 C T C 717 T C C 719 G A G 793 G A A 915 T T C 933 T C C 969 T C C 1065 A C C - TABLE 7.
HSV-1 WT and tk mutants detected in individual neurons from a ganglion of patient 708
Composition of virus population in single neurons (% of total no. of neurons) Single neurona identification No. of clones sampled No. of clonesb with: % of mutant clones 7-G (WT) sequence 1-G del 1-G ins 2-G ins 3-G ins Both WT and mutant clones in sn-1 16 12 4 25 each neuron (42.9) sn-2 17 16 1 6 sn-3 16 12 4 25 sn-4 21 7 14 67 sn-5 24 5 1 16 2 79 sn-6 17 16 1 5.9 WT only in each neuron (28.6) sn-7 13 13 0.0 sn-8 6 6 0.0 sn-9 23 23 0.0 sn-10 10 10 0.0 Mutants only in each neuron (28.6) sn-11 13 13 100 sn-12 21 18 3 100 sn-13 22 2 20 100 sn-14 10 1 9 100
