Immunogenicity of Cytopathic and Noncytopathic Viral Vectors

Plasmid construction.The plasmid encoding a recombinant RV vaccine vector (pSPBN) with the restriction sites BsiWI and NheI has been described previously (39). The NP/SIINFEKL fragment was amplified from the previously described pSC11 plasmid (59) by PCR using primers ATCGTACGCCACCATGGCGTCCCAAGGC and GCTCTAGACTACTAATTGTCGTA containing the BsiWI and XbaI restriction sites (underlined). The PCR fragment was gel purified, BsiWI and XbaI digested, and ligated into previously BsiWI- and NheI-digested pSPBN. The resulting plasmid was designated pRVnoM-NP/S. The VSV wild-type M protein (VSVwtM) (pBSM) has been described elsewhere (12). VSV*M was constructed by replacing the methionine at positions 33 and 51 in VSVwtM with alanine (M33,51A) by using a QuickChange multisite-directed mutagenesis kit (Stratagene) and the primers GAAGAGGACACTAGCGCGGAGTATGCTCCGAGC and TTGGAGTTGACGAGGCGGACACCTATGATCCG. VSVwtM and VSV*M were PCR amplified using primers containing BsiWI and NheI restriction sites (underlined) (GGGCGTACGAAAATGAGTTCCTTAAAGAAGATTC and AAAGCTAGCTCATTTGAAGTGGCTGATAGAA). The fragments were gel purified, digested with BsiWI and NheI, and ligated into pBNSP plasmid (38) (here named pRVnoM) previously digested with BsiWI and NheI. The new plasmids were designated pRVwtM and pRV*M. The plasmids pRVwtM and pRV*M were digested with NaeI and SnaBI. The fragments containing either VSVwtM or VSV*M were ligated into pRVnoM-NP/S, generating pRVwtM-NP/S and pRV*M-NP/S plasmids (see Fig. 1).

• Open in new tab
• Download powerpoint

FIG. 1.

Construction of cytopathic and noncytopathic recombinant RV vectors expressing different model antigens. VSVwtM or mutated VSV M was introduced between the N and P genes of RVnoM, resulting in RVwtM (cytopathic phenotype) or RV*M (noncytopathic phenotype). The Ova_257-264 epitope embedded within the influenza nucleoprotein (NP/S) was inserted between rabies G and L genes (RVnoM-NP/S, RVwtM-NP/S, or RV*M-NP/S).

Recovery of recombinant viruses.For recovery of the recombinant RVs, a previously described RV recovery system was used (16, 53). Briefly, BSR T7 cells, BSR cells which stably express T7 RNA polymerase, were transfected with 5 μg of full-length RV cDNA (pRVnoM, pRVwtM, pRV*M, pRVnoM-NP/S, pRVwtM-NP/S, or pRV*M-NP/S) in addition to plasmids encoding the rabies N, P, L, and G proteins by using a Ca₂PO₄ transfection kit (Stratagene) according to the vendor's instructions. Three days posttransfection, supernatants were transferred onto fresh BSR cells. Infectious virus was detected 3 days later by immunostaining with fluorescein isothiocyanate (FITC)-labeled anti-RV N antibody (Centacor, Inc.). The correct sequences of the VSVwtM and VSV*M genes in the recovered viruses were confirmed by sequencing.

Cells.BSR cells, clonally derived from BHK-21 cells, were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). L-K^b (L929 transfected with H-2K^b) and MC57G (H-2K^b) cells were maintained in DMEM with 5% FBS. P815 cells were maintained in RPMI with 10% FBS.

Mice.C57BL/6 (H-2K^b) female, 6- to 8-week-old mice were purchased from The Jackson Laboratory and maintained at the Thomas Jefferson University Animal Facilities (Philadelphia, PA). The animal protocols were approved by the Thomas Jefferson University Institutional Animal Care and Use Committee.

One-step growth curve.MC57G cells were plated in 60-mm-diameter dishes until 80% confluence (18 h) and infected at a multiplicity of infection (MOI) of 10 with the respective recombinant RVs. After incubation at 37°C for 1 h, the medium was aspirated, cells were washed three times with phosphate-buffered saline (PBS) to remove any unabsorbed virus, and 3 ml of DMEM with 10% FBS was added back. At indicated time points (see Fig. 3), 0.1 ml of supernatant was removed and stored at 4°C. The aliquots were titrated in duplicate on BSR cells as described previously (38, 39).

MTT assay.MC57G cells were incubated with recombinant viruses in duplicate at an MOI of 1 at 37°C for 3 days in a 120-μl volume. MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) (Sigma) was diluted to 5 mg/ml in sterile PBS and filtered once through a 45-μm filter. MTT solution (25 μl) was added to each well, and the plates were incubated for an additional 4 h at 37°C. At that point, 0.1 ml of solubilization solution (10% Triton X-100 diluted in 0.1 N HCl in anhydrous isopropanol) was added to each well and incubation at 37°C was continued for an additional 2 h. The absorbance value was determined by an enzyme-linked immunosorbent assay (ELISA) reader at 590 nm.

Trypan blue exclusion.MC57G cells were plated in six-well plates and infected with recombinant viruses at an MOI of 1. At different time points, cells were collected and mixed with trypan blue to exclude dead cells and the live cells were counted.

Annexin staining.MC57G cells were plated in six-well plates and infected with recombinant viruses at an MOI of 1. At different time points, cells were collected, stained for annexin and propidium iodide (PI) (Pharmingen) as indicated by the manufacturer, and analyzed using an Epics Profile flow cytometer in the Kimmel Cancer Center Flow Cytometry Facility (Thomas Jefferson University).

Presentation assay.MC57G cells were plated in six-well plates and infected the next day with recombinant viruses at an MOI of 1. At different time points, cells were collected, washed three times with FACS buffer (PBS plus 5% fetal calf serum) and counted, and 10⁶ cells were incubated for 1 h with 25.D1.16 culture supernatant (monoclonal antibody specific for residues 257 to 264 of ovalbumin [Ova_257-264] complexed to H-2K^b) (45) at 4°C. Cells were washed three times in FACS buffer and incubated for 30 min at 4°C with 3 μg/ml FITC-labeled horse anti-mouse immunoglobulin G (Vector Laboratories). Cells were washed with FACS buffer, resuspended in 1% paraformaldehyde, and analyzed using an Epics Profile flow cytometer in the Kimmel Cancer Center Flow Cytometry Facility (Thomas Jefferson University).

ELISA.RV G protein was isolated from purified virions and RV N as ribonucleoprotein from infected cells as described previously (32, 54). RV N or G was resuspended in coating buffer (50 mM Na₂CO₃, pH 9.6) at a concentration of 200 μg/ml, and 100 μl/well was plated in 96-well ELISA MaxiSorp plates (Nunc). After overnight incubation at 4°C, plates were washed three times (PBS [pH 7.4], 0.1% Tween 20), blocked with blocking buffer (PBS [pH 7.4], 5% dry milk powder) for 30 min at room temperature, and incubated with serial dilutions of mouse sera for 1 h. Plates were washed three times, followed by the addition of horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G (heavy plus light chains) secondary antibody (1:5,000; Jackson ImmunoResearch Laboratories). After 30 min of incubation at 37°C, plates were washed three times and 200 μl of OPD (o-phenylenediamine dihydrochloride) (Sigma) substrate was added to each well. The reaction was stopped by the addition of 50 μl of 3 M H₂SO₄ per well. Optical density was determined at 490 nm.

ELISPOT.Groups of three C57BL/6 mice, 6-week-old females, were inoculated intraperitoneally (i.p.) with 10⁴ focus-forming units of RVwtM, RVwtM-NP/S, RV*M, and RV*M-NP/S viruses. Mice were bled retroorbitally at 8 or 28 days postimmunization and sacrificed, and spleen-derived single-cell suspensions were prepared. Red blood cells were removed with ACK lysing buffer (BioWhittaker), cells were resuspended in RPMI supplemented with 10% FBS, and 10⁵ cells per well were plated in triplicate. Plates were previously coated overnight with 10 μg of anti-mouse gamma interferon (IFN-γ)/ml in sterile PBS and blocked for 2 h with RPMI with 10% FBS. Splenocytes added to the plates were incubated with MC57G cells (10⁵ cells per well) either fresh (as a negative control) or pulsed with Ova_257-264 peptide (10⁻⁶ M final) for 1 h at 37°C or infected with RV*M for 18 h. The plates were incubated for 18 to 20 h at 37°C and washed 10 times with PBS containing 0.25% Tween 20. Wells were incubated with 5 μg of biotinylated rat anti-mouse IFN-γ antibody/ml for 2 h at room temperature, washed five times, treated with 1 mg of horseradish peroxidase-conjugated streptavidin/ml in PBS containing 1% FBS, incubated for 1 h at room temperature, and washed four times. IFN-γ-secreting, spot-forming cells were detected using an AEC substrate reagent set for an enzyme-linked immunospot (ELISPOT) assay (Pharmingen). The plates and reagents were purchased from Pharmingen. For cross-priming experiments, a modified version of the procedure developed by Norbury et al. (42) was used. P815 cells were infected with recombinant viruses at a previously detected optimum MOI of 3 for 2 days, UV irradiated (312 nm) for 10 min, and counted, and 2 × 10⁶ cells per 200 μl were injected i.p. into C57BL/6 mice. Seven days after immunization, mice were sacrificed, and spleen cell suspensions were prepared and analyzed by ELISPOT assay as described above. L-K^b cells were used to assay the Ova_257-264-specific responses, as they stably express higher levels of H-2K^b molecules than MC57G cells.

Construction of cytopathic and noncytopathic rabies viruses.The genes encoding VSV wtM and the M33,51A (*M) double mutant protein of the noncytopathic VSV phenotype were cloned between the N and P genes of the highly attenuated RV strain pBNSP (38) (here designated pRVnoM), resulting in pRVwtM or pRV*M (Fig. 1). Because one goal was to study epitope- specific T_CD8⁺-cell immune responses within this system and no immunodominant RV-specific epitopes have been identified, we inserted the influenza A nucleoprotein gene that we previously modified to encode the extensively studied Ova_257-264 epitope (also known as SIINFEKL) (59). The region between the G and L genes of pRVnoM, pRVwtM, or pRV*M was the target for introduction of the heterologous NP/S gene. The resulting plasmids were entitled pRVnoM-NP/S, pRVwtM-NP/S, and pRV*M-NP/S (Fig. 1). The recombinant RVs were recovered by standard methods (53).

Cytopathic characteristics of recombinant RVs.To determine whether the insertion of VSV M protein into the RV genome confers cytopathogenicity, we infected MC57G cells with RVs (RVnoM, RVwtM, and RV*M) and counted the live cells at successive days by trypan blue exclusion. As shown in Fig. 2a, the number of live cells decreased continuously after infection with RVwtM. Cells infected with RVnoM or RV*M proliferated 2 days after infection. After that point, the numbers decreased but only modestly compared to cells infected with RVwtM. We confirmed these results using the MTT assay (Fig. 2b), which measures the activity of mitochondrial dehydrogenases in living cells, an early indicator of cell viability. The extent of cell death induced by RVwtM was substantially higher than that induced by the other viruses. RVnoM- and RV*M-infected cells died much more slowly, suggesting more passive mechanisms of death induction. As a final assessment of cytopathogenicity, we measured the proportions of dead and apoptotic cells by PI and annexin staining (Fig. 2c). These data indicate higher proportions of early apoptotic (PI⁻ annexin⁺) and late apoptotic (PI⁺ annexin⁺) cells after infection with RVwtM than after infection with RV*M viruses 2 days postinfection. At day 3 postinfection, we observed lower percentages of apoptotic cells, most likely due to proliferation of uninfected cells, as also seen in Fig. 2a. The patterns of cell survival were similar regardless of whether NP/S was inserted (data not shown), indicating no influence of the heterologous protein with respect to cell death. These experiments indicate that expression of the VSVwtM protein converted the phenotype of RV from noncytopathic to cytopathic and confirmed that residues 33 and 51 are essential for lytic activity, as previously reported (27).

• Open in new tab
• Download powerpoint

FIG. 2.

Analysis of cytolytic capacities of recombinant RVs. (a) Live cells counted by trypan blue exclusion. MC57G cells were infected with recombinant RVs at an MOI of 1, and trypan-excluding cells were counted at different times postinfection. Data are representative of three independent experiments, each of them done in triplicate. (b) MTT assay. Three days after the MC57G cells were infected with recombinant RVs at an MOI of 1, cell viability was measured by MTT conversion as described in Material and Methods. Data are representative of four independent experiments done in duplicate. The numbers represent P values calculated using Student's t test. (c) Annexin and PI staining of MC57G cells infected with recombinant viruses at an MOI of 1 and analyzed at the indicated time points. The numbers represent percentages of cells corresponding to each quadrant. The experiment was done twice. OD, optical density; PI, propidium iodide.

One-step growth curves of recombinant RVs.The observed cytopathogenicity of VSVwtM-expressing RVs could have been the consequence of a faster replication rate of the RVwtM virus and, consequently, a more rapid loss of cell viability. In order to address this possibility, we infected cells with an MOI of 10 to ensure synchronous infection of all cells. As shown in Fig. 3, recombinant RVs have similar replication rates. At 72 h postinfection, the RVnoM titer is about 0.5 log higher, but the M-expressing viruses (RVwtM and RV*M) grow to the same titers. Thus, it is the lytic potential of RVwtM virus, not the replication rate, that influenced survival of infected cells as seen in Fig. 2.

• Open in new tab
• Download powerpoint

FIG. 3.

One-step growth curves of recombinant RVs. MC57G cells were infected with recombinant viruses at an MOI of 10. Aliquots of culture supernatants were collected at different time points, and viral titers were determined in duplicate. Data are representative of four independent experiments.

Ova_257-264 presentation by recombinant RVs.In preparation for the immunogenicity experiments reported below, we tested the capacities of cytopathic (RVwtM) and noncytopathic (RVnoM and RV*M) virus recombinants to express the Ova_257-264 epitope. MC57G cells (H-2K^b) were infected in vitro and at different time points were stained with an antibody specific for the K^b/Ova_257-264 complex (45) and analyzed by flow cytometry (Fig. 4). Staining intensity correlates with the density of K^b/Ova_257-264 complexes on the cell surface (59). One day postinfection, we observed no differences in the level of epitope expressed by various viruses. Two days postinfection, noncytopathic RV*M and cytopathic RVwtM expressed similar epitope levels. At day 3, RV*M and RVwtM maintained the same expression level, which was threefold lower than that of RVwtM. It seems likely that the lower epitope expression of viruses containing the extra VSV M gene is due to transcriptional attenuation, a feature of all rhabdoviruses, which results in greater expression of upstream genes (3, 25). The key point is that levels of protein and epitope expression by RVwtM and RV*M are comparable.

• Open in new tab
• Download powerpoint

FIG. 4.

Recombinant RVs express variable levels of Ova_257-264 epitope. MC57G cells were infected with RVnoM-NP/S, RVwtM-NP/S, or RV*M-NP/S at an MOI of 1 in triplicate, and at different times postinfection, the cells were stained with an anti-K^b/Ova_257-264 antibody followed by a secondary FITC-labeled antibody and analyzed by flow cytometry for the mean fluorescence intensity (MFI). Three separate experiments showed similar results. P values (shown above bars) were calculated using Student's t test.

Cross-priming capacities of recombinant RVs.As discussed, cytolysis is expected to enhance cross-priming capacity. To test this, we infected P815 cells (that do not express H-2K^b) with each recombinant virus for 2 days and injected them into C57BL/6 mice (H-2K^b background). Prior to injection, the cells were UV irradiated in order to inactivate any infectious viruses that might directly infect professional APCs in vivo. The efficacy of inactivation was tested by viral titration after UV treatment, and no infectious virus was detected. Seven days after transfer, Ova_257-264-specific T_CD8⁺-cell responses were assessed by ELISPOT assay for IFN-γ-producing cells (Fig. 5). Our results show that the Ova_257-264 epitope is cross-presented by both types of viruses but that the cytopathic virus induces significantly higher levels of cross-priming.

• Open in new tab
• Download powerpoint

FIG. 5.

Cross-priming of recombinant RVs. P815 cells were infected with the recombinant viruses at an MOI of 3 for 2 days and then UV irradiated. Cells were injected i.p. into C57BL/6 mice, and 7 days later, the Ova_257-264-specific T_CD8⁺ responses were assayed by ELISPOT assay for IFN-γ-positive cells. The data represent three experiments with two mice per group. For each experiment, the maximal response was set at 100%, and the other responses were related to the maximal value. The variances for the two groups were sufficiently similar (0.039 and 0.037) to allow application of a paired Student t test assuming equal variance.

In vivo rabies and Ova_257-264-specific immune responses.The immunogenicity of cytopathic and noncytopathic viruses to RV-specific determinants was investigated by infecting mice and analyzing the humoral and T_CD8⁺-cell responses at 8 and 28 days postinfection. We measured both antiglycoprotein (RV G)- and antinucleoprotein (RV N)-specific antibody responses by ELISA. Eight days postinfection, RV N-specific antibodies were not detected. In contrast, RV G-specific antibodies were detectable with cytopathic RVs inducing higher titers than the noncytopathic counterparts (Fig. 6a). By day 28, both anti-RV N and anti-RV G responses were detectable. At this point, responses induced by the cytopathic and noncytopathic viruses to both antigens were similar (Fig. 6b and c).

• Open in new tab
• Download powerpoint

FIG. 6.

In vivo rabies and Ova_257-264-specific immune responses induced by recombinant RVs. C57BL/6 mice were infected i.p. with 10⁴ focus-forming units of recombinant RVs as indicated. Mice were bled 8 (a) and 28 (b and c) days after infection, and antibody titers specific for RVG (a and b) and RVN (c) were determined by ELISA. (d) The frequency of rabies-specific, IFN-γ-producing T_CD8⁺ cells was determined at day 8 and 28 postinfection by ELISPOT assay using MC57G cells infected with recombinant RV*M. (e) Ova_257-264-specific T_CD8⁺ responses were analyzed by ELISPOT assay at 28 days postinfection by using MC57G cells pulsed with Ova_257-264 peptide. For each graph, the bars represent the means for three mice per group. Data are representative of three identical experiments. OD, optical density; Neg, negative.

The kinetics of the RV-specific T_CD8⁺-cell response was also analyzed by ELISPOT assay, which quantifies the number of antigen-specific IFN-γ-secreting cells (Fig. 6d). As with humoral responses, the cytopathic virus RVwtM induced a higher T_CD8⁺-cell response at 8 days postinfection, but by day 28, the numbers of RV-specific T_CD8⁺ cells generated by infections with cytopathic and noncytopathic viruses were similar. The same was true when Ova_257-264-specific immune responses at day 28 were analyzed in the same way. The results presented in Fig. 6e showed that infection with cytopathic virus RVwtM activated the same number of epitope-specific T_CD8⁺ cells as the noncytopathic virus RV*M. Thus, degree of cross-priming, as seen in Fig. 5, was not predictive of the level of T_CD8⁺-cell priming (Fig. 6e). Additionally, even though the kinetics of immune responses induced by cytopathic and noncytopathic viruses were different, the long-term responses were comparable.