Article Figures & Data
Figures
- FIG. 1.
(A) Protein sequence alignment of coronavirus RdRps. The conserved motifs for RdRps are indicated above the sequences. Specimens collected from M. pusillus at geographical site 1 (*), M. pusillus at geographical site 2 (¶), and M. schreibersii (specimen 86) and M. magnater (specimens 88 and 96) at site 3 (+) are indicated. 229e, HCoV-229E. (B) Phylogenetic analysis of RNA sequences encoding RdRp (partial sequence).
- FIG. 2.
Protein sequence alignment of coronavirus S proteins (partial sequence). The HR1 and HR2 regions are indicated. The locations of potential N-glycosylation sites in the Bat-CoV sequence are marked by asterisks. TGV, TGEV; NL63, HCoV-N63; 229E, HCoV-229E; OC43, HCoV-OC43.
- FIG. 3.
(A) Phylogenetic analysis of RNA sequences for the S gene (partial sequence). (B) Predicted coiled-coil regions in the deduced S-protein sequence. The coiled-coil regions were predicted by Stablecoil 1.0 with a 35-residue window width. The HR1 and HR2 regions are indicated. (C) HR1 and HR2 in the S protein of Bat-CoV. The a and d positions of the strongest predicted coiled-coil heptad repeats are indicated. The 14-amino-acid residue insertions that are unique in group 1 viruses are underlined.
- FIG. 4.
(A) Phylogenetic analysis of RNA sequences coding for helicase-ExoN (partial sequence). (B) Protein sequence alignment of coronavirus helicase-ExoN. The conserved motifs for helicases and the first motif for ExoN (DEDD motif I) are indicated. The invariant acidic residues in DEDD motif 1 are labeled with white stars below the sequences. The inverted open triangle above the sequences marks the predicted 3CL proteinase cleavage site.
Tables
- TABLE 1.
Prevalence of Bat-Cov in animals
Animal type and scientific name Common name No. of individual animals No. of positive respiratory samples No. of positive fecal samples Mammals Cynopterus sphinx Short-nosed fruit bat 15 0 0 Hipposideros armiger Great round-leaf bat 4 0 0 Hipposideros pomona Bicolored round-leaf bat 3 0 0 Miniopterus magnater Large bent-winged bat 16 1 2 Miniopterus pusillus Lesser bent-winged bat 19 5 12 Miniopterus schreibersii Japanese long-winged bat 4 1 1 Myotis myotis Large mouse-eared bat 3 0 0 Myotis ricketti Rickett's big-footed bat 5 0 0 Pipistrellus abramus Japanese pipistrelle bat 3 0 0 Rhinolophus affinis Intermediate horseshoe bat 2 0 0 Rhinolophus pusillus Least horseshoe bat 1 0 0 Rhinolophus rouxi Rufous horseshoe bat 6 0 0 Canis familiaris Feral dog 6 0 0 Felis catus Feral cat 1 0 0 Herpestes javanicus Javan mongoose 1 0 0 Herpestes urva Crab-eating mongoose 1 0 0 Hystrix hodgsoni Chinese porcupine 10 0 0 Macaca mulatta Rhesus macaque 6 0 0 Melogale moschata Chinese ferret badger 8 0 0 Muntiacus muntjak Indian muntjac 4 0 0 Paguma larvata Himalayan palm civet 21 0 0 Rattus rattus Black rat 6 0 0 Viverricula indica Small indian civet 4 0 0 Sus scrofa Wild boar 9 0 0 Reptiles Naja atra Chinese cobra 1 0 0 Opisthotropis balteata Banded stream snake 1 0 0 Ptyas korros Indo-Chinese rat snake 2 0 0 Trachemys scrpta elegants Red-eared slider 1 0 0 Rhabdophis subminiatus helleri Red-necked keelback 1 0 0 Trimeresurus albolabris Bamboo snake 1 0 0 Sibynophis chinensis Chinese mountain snake 1 0 0 Sinonatrix percarinata Mountain water snake 1 0 0 Elaphe radiata Copperhead racer 1 0 0 Birds Chalcophaps indica Emerald dove 1 0 0 Garrulax pectoralis Greater necklaced laughing thrush 1 0 0 Garrulax perspicillatus Masked laughing thrush 2 0 0 Myophonus caeruleus Blue whistling thrush 3 0 0 Scolopax rusticola Eurasian woodcock 1 0 0 Streptopelia chinensis Spotted dove 3 0 0 Streptopelia orientalis Oriental turtle dove 3 0 0 Turdus cardis Japanese thrush 1 0 0 Turdus obscurus Eyebrowed thrush 1 0 0 Turdus ohortulorum Grey-backed thrush 1 0 0 Zoothera dauma Scaly thrush 1 0 0 - TABLE 2.
Primer sequences positive for Bat-CoV detection
PCR Target sequence Primer orientation Primer sequence (5′ to 3′) 1 RdRp Forward AYAACCAAGATCTTAATGG Reverse TGCTTAGAACCCAAAATCAT 2a RdRp Forward GGTTGGGACTATCCTAAGTGTGA Reverse CCATCATCAGATAGAATCATCATA 3 Helicase-ExoN Forward CTCARGGTAGTGARTATGA Reverse AATTGTTCWCCWGGTGG 4 Spike Forward WTATGTTTGYAATGGTAAY Reverse GTCWTCATCMACWGTRC 5 Spike Forward GAYTDDCAGCACTTAATGC Reverse TTGAGCCAYTCAAGRTYRA 6 Spike Forward CAATCTAGGTCTGCTATCG Reverse CTAGAAGACTGTGATTTGA ↵ a Forward and reverse primers (IN-6 and IN-7) were communicated through the World Health Organization's SARS etiology network by colleagues from the Centers for Disease Control and Prevention.
- TABLE 4.
Nucleotide sequence identities of Bat-CoV RNA fragments to other coronaviruses
RNA fragment % Identity of RNA fragment to: PEDV TGEV HCoV-229E HCoV-NL63 MHV HCoV-OC43 SARS-CoV IBV RdRp 74 70 75 74 60 61 62 63 Helicase-ExoN 71 67 71 72 55 55 55 55 S 58 54 58 60 40 42 41 43
