Article Figures & Data
Figures
- FIG. 1.
siRNA targeting of HIV-1. (A) SupT1 cells were stably transduced with the empty pRETRO-SUPER retroviral vector (4, 5) (control) or with vectors expressing siRNAs against eight target sequences in the HIV genome: PBS-A, GTGGCGCCCGAACAGGGACTT; PBS-B, TGGCGCCCGAACAGGGACTT; PPT, GGGGGGACTGGAAGGGCTA; TatRev-A, GCCTTAGGCATCTCCTATG;TatRev-B, CCTATGGCAGGAAGAAGCG; UTR-A, GCGGAGGCTAGAAGGAGAG; UTR-B, GGCTAGAAGGAGAGAGATG; and Nef, GTGCCTGGCTAGAAGCACA. (B) Cells were infected with HIVLAI (800 pg of CA-p24 in a 5-ml culture), and virus replication was monitored by determining the CA-p24 level in the culture supernatant. (C) Predicted structure of the siRNA-Nef transcript. The sequence targeting the Nef gene is shown in bold.
- FIG. 2.
Sequence-specific inhibition of HIV-1 replication. (A) SupT1 cells stably transduced with the siRNA-Nef vector (left panels) or the empty vector (right panels) were infected with wild-type HIVLAI (closed circles) or HIVrtTA with the Nef gene deleted (open circles). The virus input levels were 800 pg of CA-p24 (top panels), 4,000 pg of CA-p24 (middle panels), and 8,000 pg of CA-p24 (bottom panels) in 5-ml cultures. Virus spread was monitored by determining the CA-p24 level in the culture supernatant. (B) siRNA-Nef and control cells were transfected with 10 μg of DNA encoding wild-type HIVLAI or HIVrtTA with the Nef gene deleted as described previously (7). Virus production in the culture supernatant at 2 and 3 days after transfection was measured by a CA-p24 enzyme-linked immunosorbent assay.
- FIG. 3.
HIVLAI develops resistance against siRNA-Nef by deleting the Nef target sequence. SupT1 cells expressing siRNA-Nef were massively infected with HIVLAI to overcome the siRNA-mediated inhibition of replication. The virus was passaged repeatedly onto fresh SupT1-siRNA-Nef cells. Cells were initially infected with a high virus dose that could be reduced gradually. (A) Schematic of the 3′ end of the HIVLAI proviral genome. Indicated are the positions of the siRNA-Nef-targeted sequence, the PCR primers (black arrows), and the 106-bp deletion observed after prolonged virus culture. (B) At each passage, the proviral DNA present in infected cells was PCR amplified with primers that amplify the complete Nef gene as a 1,014-bp fragment. At 23 days after infection, a fast-replicating variant containing a 106-bp deletion in the Nef gene was observed. At 43 days after infection, this siRNA-Nef-resistant virus dominated the virus population. (C) Sequences of the Nef gene in the HIVLAI virus and in the evolved siRNA-Nef-resistant virus (LAIR1) with the 106-bp deletion encompassing the siRNA-Nef target sequence. (D) Infection of SupT1 control cells and siRNA-Nef-expressing cells with wild-type LAI (left panel) or the evolved LAIR1 variant harvested at day 43 (right panel). We used equal virus input levels (400 pg of CA-p24 in a 5-ml culture).
- FIG. 4.
RNAi-resistant HIV-1 variants. HIVLAI variants resistant to siRNA-Nef were selected in independent cultures and analyzed as described in the legend to Fig. 3. (A) PCR amplification of the Nef gene on the indicated day (LAI, input HIVLAI virus; R1, LAIR1 escape virus shown in Fig. 3 at day 43; R2 to R7, independent HIVLAI escape variants); (B) Nef target sequence in the evolved RNAi-resistant viruses. In LAIR5, nucleotides 179 to 241 of the Nef gene are deleted. In LAIR7, we observed the deletion of nucleotides 44 to 268 and a T269A substitution.
