Article Figures & Data
Figures
- Fig. 1.
Strand-specific characterization of viral RNAs produced during acute and persistent infection. The presence of plus (+)- and minus (−)-strand viral RNAs was determined by strand-specific RT-PCR and evaluated in combination with RNase I treatment to determine whether the RNA existed in a single- or double-stranded form. Production of a 2.3-kb amplicon which includes viral nucleotides 4365 to 6693 is shown (arrowhead) for control T7-transcribed single-stranded and annealed double-stranded RNAs (A) and viral RNAs produced during acute or persistent infection of muscle or G8 myoblasts (B). The strand that was primed during the RT reaction is indicated by (+) or (−). In panel B, an RT reaction without any added primer (N) served as a negative control.
- Fig. 2.
Quantitation of plus (+)- and minus (−)-strand viral RNAs during acute and persistent infection. Competitive, strand-specific RT-PCR was used to measure the levels of plus and minus strands of viral RNA. The solid arrowhead marks the position of the target amplicon, and the open arrowhead marks the competitive template. Brackets underneath each gel indicate which lanes were used for quantitation, as shown in the adjacent plot. Representative data are shown, and a summary of data from all experiments is presented in Table2. (A) Control plus and minus transcripts were input at 4 × 104 copies per reaction and used to evaluate the efficiency of the strand-specific competitive RT-PCR procedure. (B) Acutely infected muscle at 7 days postinfection showed a 61-fold excess of plus strand with 1.3 × 104 copies per 0.5 μg of input RNA for the plus strand and 1.7 × 103 copies per 4 μg of input RNA for the minus strand. (C) At 1 month after infection, the plus strand was present at 5.1 × 103 copies per 4 μg of input RNA while the minus strand was at 2.6 × 103 copies per 4 μg, yielding a final plus-strand-to-minus-strand ratio of 2.0.
- Fig. 3.
Detection of sequence changes in persistent viral RNA by REF analysis. The open arrowheads indicate the positions of bands whose migration was altered relative to those of parental MP1, which are marked by the solid arrowheads. (A) BsaJI digest of fragment 5479 to 6693 for the detection control showing MP1 (lane 1) and the altered migration of two bands caused by a T-to-C transition engineered into the primer at nucleotide 6682 (lane 2). (B)HaeIII-MboI digest of fragment 5479 to 6693 from MP1 (lane 1) compared to persistent MP1/M (lane 2). Broadening of the banding pattern in MP1/M resulting from an A-to-G dimorphism is indicated by the brackets. (C) MnlI-BsaJI digest of fragment 5479 to 6693 from MP1 (lane 1) and altered migration of two bands caused by a U-to-C transition at position 5787 in MP1/G8 (lane 2). (D) DdeI-HaeIII digest of fragment 4365 to 5552 from MP1 (lane 1), MP1/M from a mouse which contained a U-to-C transition at nucleotide 5157 (lane 2), and MP1/M from a second mouse which did not contain the mutation (lane 3).
Tables
- Table 1.
Oligonucleotide primers used in this study
Primer namea Genomic location (nucleotides) Nucleotide sequenceb (5′ to 3′) Strand-specific and competitive template primers T7.5UTR.1 1–20 TAATACGACTCACTATAGGGTTAAAACAGCCTGTGGGTTG T7.3UTR.7359 7341–7359 TAATACGACTCACTATAGGGGCACCGTTATCTAGTTCGG 2C.4365*4774 4365–4387* CATACAGTTCAAGTCCAAATGCC* 4774–4798 ATCGAGGTTATCTCCATGTACAGCC 3UTR.7359 7341–7359 GCACCGTTATCTAGTTCGG REF primers (sense/antisense pairs) 5UTR.1 1–20 TTAAAACAGCCTGTGGGTTG 5UTR.603 584–603 TCAATTGTCACCATAAGCAG 5UTR.450 450–474 CCGGCCCCTGAATGCGGCTAATCCT 1C.2154 2134–2154 TGCGCCTGGTGGTGAGTATGC 1C.2093 2093–2120 TGTTCTGTGGGTCTGCAATGGCCACAG 2B.4022 3994–4022 GCCATTGGAATCCCATAATATTGGGACAC 2A.3307 3307–3338 GGGGCTGTCTACGTAGGCAACTACAGAGTGGT 2B.4417 4393–4417 CGTGCAAGAGACAGCATACAGGTTC 2C.4365 4365–4387 CATACAGTTCAAGTCCAAATGCC 3C.5552 5524–5552 CCATCCTTGTCCACCAACTCTTTAGCGTC 3C.5479 5479–5507 CCTGGGCCAACCATCCTGATGAATGACCA 3D.6693 6669–6693 GTTGGTTTCCTTGTGCGAGTATCCG 3D.6693.82T-C 6669–6693 GTTGGTTTCCTCGTGCGAGTATCCGc 3D.6255 6255–6279 CCCGTATGTCGCATTAGGTATCAAG Tag.3DT.C 7389–poly(A) CGATCTGAGTCATGTCACTGTTTTTTTTTTTTTTC ↵a With the exception of Tag.3DT.C, virus-specific primer names include the viral gene designation and the number of the first nucleotide on the 5′ end of the primer. In primer 2C.4365*4774, the location of a deletion that was engineered into the primer is indicated (*).
↵b Primers 5UTR, 5UTR.603, 5UTR.450, 1C.2154, 2B.4022, and 2B.4417 were based on the published sequence of pNI4. All remaining primer sequences were based on sequence information obtained from CVB1T (unpublished data). The Tag sequence in primer Tag.3DT.C is a nonviral sequence appended to the 5′ end to facilitate amplification of the 3′ end of the virus and is italicized. T7 promoter sequences in T7.5UTR.1 and T7.3UTR.7359 are underlined.
↵c This primer has the same sequence as 3D.6669-93 but with a T-to-C transition at nucleotide 6682 (shown in boldtype).
- Table 2.
Comparison of plus- and minus-strand viral RNA levels in acute and persistently infected samples
Sample Virus titera No. of copies viral RNAb Viral RNA strand ratio (plus:minus)c Plus strand Minus strand MP1/M (7 days) 2.1 × 108 4.5 × 104 (2.6 × 104–6.6 × 104) 6.0 × 102 (4.2 × 102–7.5 × 102) 75:1* MP1/M (1 mo) NDd 2.0 × 103 (1.3 × 103–2.8 × 103) 5.2 × 102 (3.9 × 102–6.5 × 102) 4:1 MP1/G8 (20 h) 1.1 × 106 4.6 × 105 (0.47 × 105–7.1 × 105) 7.7 × 103 (6.9 × 103–9.0 × 103) 60:1* MP1/PI-G8 (passage 30) 3.4 × 104 6.3 × 103 (4.4 × 103–9.3 × 103) 1.5 × 102 (1.1 × 102–2.3 × 102) 42:1* ↵a Virus titers are expressed as PFU per gram of muscle for muscle samples (M) or PFU per 106 cells for G8 and PI-G8 cells.
↵b When quantitated by competitive RT-PCR, in vitro-transcribed control transcripts input at 4 × 104 copies gave mean values of 2.1 × 104copies of plus-strand RNA (range, 1.8 × 104 to 2.5 × 104 copies) and 1.2 × 104copies of minus-strand RNA (range, 1.0 × 104 to 1.6 × 104 copies). Values shown in the table are the mean number of copies of the plus or minus strand expressed per microgram of total RNA from muscle or G8 cells. Values were determined from three independent samples, and the range is shown in parentheses.
↵c *, The number of copies of the plus strand was significantly different from that of the minus strand by the pairedt test (α = 0.05).
↵d ND, none detected.
- Table 3.
Mutations that occurred during persistence of MP1 in muscle or in PI-G8 myoblasts
Genomic region (nucleotides)a Mutations detected in persistent viral RNAb MP1/M MP1/G8 REF Sequencing REF Sequencing 21–583 − − + 269 (C-U) 475–2133 − NS − NS 2121–3993 − NS + NS 3339–4392 − NS − NS 4388–5523 − NS + NS 5508–6668 + 6249 (GCA-GCRc) (Ala-Ala) + 5787 (GGU-GGC) (Gly-Gly) 6280–7388 − NS + NS ↵a Nucleotide numbers indicate the genomic region screened and exclude the primer-binding region of the amplicon. The numbering system is based on alignment of partial-sequence information for MP1 with the complete sequence of CVB1 published for the pNI4 clone.
↵b Results of REF analysis indicate whether altered migration either was (+) or was not (−) observed for restriction fragments within a given genomic region. Summarized sequence information indicates that there were no sequence changes detected within a region (−) or that the region was not sequenced (NS). Mutations are reported as the nucleotide position of the mutation followed by the base change and the codon change for coding sequences.
↵c R = A or G.
- Table 4.
PI-G8 myoblasts are completely cured of persistent infection by anti-CVB1 treatment
Horse serum Serum added CPE/viral RNA detected at passagea: 30 31 32 33 34 35 36 37 Preimmune p30-p35 +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ Anti-CVB1 p30-p35 −/− −/− −/− −/− −/− −/− −/− −/− Preimmune p30-p31 +/+ +/+ +/+ +/+ +/+ NAb NA NA Anti-CVB1 p30-p31 −/− −/− −/− −/− −/− NA NA NA ↵a Results indicate that cultures were consistently positive (+) or negative (−) for virus-induced CPE or viral RNA (detected by RT-PCR) at a given passage. Uninfected G8 cells were uniformly negative when run as a negative control for detection of CPE and viral RNA.
↵b NA, not assayed for CPE or viral RNA at these passages.
