Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Virology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Minireviews
    • JVI Classic Spotlights
    • Archive
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JVI
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Research Article

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

M Merchlinsky
M Merchlinsky
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.

PreviousNext
Back to top
Download PDF
Citation Tools
Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.
M Merchlinsky
Journal of Virology Oct 1990, 64 (10) 5029-5035; DOI:

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Virology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.
(Your Name) has forwarded a page to you from Journal of Virology
(Your Name) thought you would be interested in this article in Journal of Virology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.
M Merchlinsky
Journal of Virology Oct 1990, 64 (10) 5029-5035; DOI:
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About JVI
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #Jvirology

@ASMicrobiology

       

 

JVI in collaboration with

American Society for Virology

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0022-538X; Online ISSN: 1098-5514