This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ibarra, K. D.
Right arrow Articles by Pfeiffer, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ibarra, K. D.
Right arrow Articles by Pfeiffer, J. K.

 Previous Article  |  Next Article 

Journal of Virology, May 2009, p. 4538-4547, Vol. 83, No. 9
0022-538X/09/$08.00+0     doi:10.1128/JVI.02280-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Reduced Ribavirin Antiviral Efficacy via Nucleoside Transporter-Mediated Drug Resistance{triangledown}

Kristie D. Ibarra and Julie K. Pfeiffer*

Department of Microbiology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, Texas 75390-9048

Received 30 October 2008/ Accepted 17 February 2009


arrow
ABSTRACT
 
Treatment for hepatitis C virus infection currently consists of pegylated interferon and ribavirin (RBV), a nucleoside analog. Although RBV clearly plays a role in aiding the treatment response, its antiviral mechanism is unclear. Regardless of the specific mechanism of RBV, we hypothesize that differences in levels of cellular uptake of RBV may affect antiviral efficacy and treatment success and that cells may become RBV resistant through reduced uptake. We monitored RBV uptake in various cell lines and determined the effect of uptake capacity on viral replication. RBV-resistant cells demonstrated reduced RBV uptake and increased growth of a model RNA virus, poliovirus, in the presence of RBV. Overexpression of equilibrative nucleoside transporter 1 (ENT1) or concentrative nucleoside transporter 3 (CNT3) increased RBV uptake in RBV-sensitive cell lines and restored the uptake defect in most RBV-resistant cell lines. However, CNT3 is not expressed in Huh-7 liver cells, and inhibition of concentrative transport did not affect RBV uptake. Blocking equilibrative transport using the inhibitor nitrobenzylmercaptopurine riboside recapitulated the RBV-resistant phenotype in RBV-sensitive cell lines, with a reduction in RBV uptake and increased poliovirus growth. Taken together, these results indicate that RBV uptake is restricted primarily to ENT1 in the cell lines examined. Interestingly, some RBV-resistant cell lines may compensate for reduced ENT1-mediated nucleoside uptake by increasing the activity of an alternative nucleoside transporter, ENT2. It is possible that RBV uptake affects the antiviral treatment response, either through natural differences in patients or through acquired resistance.


arrow
INTRODUCTION
 
Approximately 170 million people are infected with hepatitis C virus (HCV), with the majority developing chronic infection (1). With no vaccine currently available, the only approved treatment consists of a combination of alpha interferon (IFN-{alpha}) and ribavirin (RBV), a guanosine nucleoside analog. IFN-{alpha} monotherapy has limited success, with only 16 to 20% of genotype 1-infected patients achieving a sustained virological response (SVR). However, the addition of RBV doubled response rates to 35 to 40%. Current treatment regimens including pegylated IFN and RBV achieve SVR rates of 54 to 56% in genotype 1-infected patients, while SVR rates of 70 to 80% are achieved in genotype 2- or 3-infected patients. The patient response is divided into three categories: SVR, end-of-treatment response and relapse, and nonresponse. Little is known about factors that influence the treatment response, although various host and viral factors have been implicated. For instance, genotype 1 infections are more difficult to treat than those of other genotypes. Additionally, male gender, African-American race, advanced age, fibrosis, obesity, human immunodeficiency virus coinfection, and low RBV serum concentrations have been negatively correlated with treatment success (3, 14, 26, 27, 34, 35).

Although RBV clearly plays a role in the HCV treatment response, the antiviral mechanism remains controversial. There are many proposed mechanisms of action for RBV (6, 10, 37, 63). First, RBV directly inhibits the viral RNA-dependent RNA polymerase through incorporation of RBV triphosphate (RTP) (6, 37, 63). Incorporation of RTP inhibits chain elongation and causes termination. Second, RBV inhibits the activity of inosine monophosphate dehydrogenase (IMPDH) (36, 43, 58), the host enzyme responsible for de novo synthesis of GTP. The monophosphorylated form of RBV, RMP, binds to the substrate pocket of IMPDH, thereby inhibiting the enzyme and reducing host nucleotide pools, which are required for viral replication. Third, RBV is a viral mutagen (7, 8, 62). For poliovirus, the incorporation of RTP into the viral RNA causes transition mutations (8). RNA viruses have high replicative error rates, and incorporation of RTP can increase the error rate to the point of error catastrophe. Fourth, RBV treatment can inhibit mRNA capping, potentially affecting viral replication either indirectly for HCV or directly for viruses with capped RNA genomes or mRNAs (19). Fifth, RBV shifts the immune response to a beneficial Th1-cell-mediated response (46, 60). Although there is evidence to support each of the proposed mechanisms, the antiviral mechanism of RBV for HCV remains uncertain.

Factors that influence the treatment response are not completely understood. Unlike the case for human immunodeficiency virus, no clear drug resistance mutations that can account for treatment failure have been identified for HCV (2, 12, 23, 28, 57, 65). Therefore, the HCV treatment response may be influenced more by host factors than by viral factors. Our previous work sought to determine whether RBV-resistant (RBVr) HCV replicon-containing cells could be generated (49). Whereas some low-level resistance occurred through mutations in the replicon, the majority of resistance occurred through changes in the cell line. These RBVr cells demonstrated a RBV uptake defect.

RBV is imported into cells through host nucleoside transporters (25), which are divided into two categories, equilibrative and concentrative (31). The equilibrative nucleoside transporters include ENT1, ENT2, ENT3, and ENT4, which are carrier proteins that mediate facilitated bidirectional diffusion of nucleosides across the cell membrane. The concentrative transporters CNT1, CNT2, and CNT3 are able to transport nucleosides against a concentration gradient by coupling transport to the inwardly directed sodium gradient. The transporters differ in tissue distributions and substrate preferences. ENT1 is generally considered ubiquitous and has broad substrate selectivity (9, 31). Although ENT2 and CNT3 are also broadly selective, ENT2 is expressed predominantly in skeletal muscle, while CNT3 is found largely in the mammary gland, pancreas, bone marrow, and trachea (9, 31, 47). Both the concentrative and equilibrative transporters are capable of importing synthetic nucleosides (13, 29, 33, 42, 54, 70) in addition to natural nucleosides. Therefore, nucleoside transporters are important clinically, since many nucleoside analogs are currently in use for the treatment of cancer and viral infections. Although the anti-HCV mechanism of RBV is controversial, at least four of the five proposed mechanisms require RBV import into the cell. We have therefore focused our efforts toward examining RBV uptake and the effect of uptake on antiviral efficacy.

In this study, we sought to understand RBV uptake and cell-based mechanisms of RBV resistance. We were able to generate RBVr cells in all cell lines tested, and we demonstrated that resistance is likely achieved by reduced ENT1-mediated uptake. We found that, in the presence of RBV, RBVr cells facilitate increased growth of poliovirus, a model RNA virus with known sensitivity to RBV, compared to RBV-sensitive (RBVs) cells. Additionally, by inhibiting equilibrative transport, the RBVr phenotype was mimicked in RBVs cells, for both RBV uptake and poliovirus growth. Our results suggest that the level of RBV uptake may affect the HCV treatment response, either through natural equilibrative transport variance in patients or through acquired resistance.


arrow
MATERIALS AND METHODS
 
Cell lines. All cell lines were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine or calf serum and 100 U of penicillin-streptomycin/ml. The Cured 4 cell line has been previously described (49). Briefly, RBVr replicon-containing Huh-7 cells were generated by repeated passage in RBV, and the cells were cured of the replicon by IFN treatment. The Huh-7 (human hepatoma), 293 (human embryonic kidney), HeLa (human cervical carcinoma), HepG2 (human liver; a kind gift from M. Gale), PH5CH8 (human primary liver; a kind gift from M. Gale), and MCF7 (human breast adenocarcinoma) cell lines are used in this study.

Poliovirus infections. Mahoney serotype 1 poliovirus was generated as previously described from a single plaque following transfection of the viral cDNA clone (52), and high-titer stocks were generated as previously described (30). All plaque assays were performed at 37°C. For the Cured 4, Huh-7, HeLa, HepG2, and PH5CH8 cells, virus was added at 70 to 100 PFU/monolayer in 60-mm tissue culture plates. The MCF7 cells were infected with 10-fold more virus (700 PFU/plate) due to decreased permissivity. Following a 30-min incubation period, virus was aspirated, and an agar overlay, with or without 400 µM RBV (Sigma), was added. After 48 h of incubation, the cells were stained with crystal violet to visualize plaques.

Generation of RBVr cell lines and RBV resistance assay. RBVr cell lines were generated as previously described (49). Briefly, cells were initially passaged in medium containing 100 µM RBV for approximately 4 weeks. The concentration of RBV was subsequently increased in 2-week intervals until a concentration of 400 µM was achieved. The cells were maintained in medium containing 400 µM RBV for approximately 2 to 4 weeks, and the level of RBV resistance was determined as previously described (49), by splitting cells every 1 to 3 days for 10 days and staining with crystal violet to visualize cellular viability.

Uptake assays. Cells were plated the day prior to the assay on 35-mm tissue culture plates to generate roughly 50 to 80% confluence on the day of the experiment. For the [3H]RBV uptake assays, cells were treated with 100 µl of medium containing 5 µM RBV, 1% of which was [3H] labeled to serve as a tracer ([3H]RBV; Moravek, Brea, CA). Following a 30-min incubation period at 37°C, the cells were washed twice with ice-cold phosphate-buffered saline to terminate uptake. The cells were then trypsinized and collected via centrifugation. Cell pellets were resuspended in 100 µl of cold lysis buffer (10 mM Tris at pH 8, 10 mM NaCl, 1.5 mM MgCl2, and 0.1% NP-40). Cell debris was removed by centrifugation, and 40 µl of the supernatant was quantified by scintillation counting. Cell number was determined by trypan blue counting of trypsinized cells from an additional plate. Uptake values were determined by multiplying the counts per minute per cell by 2.5 to account for the amount of lysate counted in the scintillator. The hypoxanthine uptake assays were performed in the same manner, except that the incubation period was reduced to 5 min to minimize the amount of [3H]hypoxanthine (Moravek, Brea, CA) metabolized and exported out of the cell.

Transfections and inhibitor assays. Transfections were performed using 2 µg of plasmid DNA (pcDNA 3.1, pENT1, pCNT1, pCNT2, pCNT3 [kindly provided by K. Giacomini, University of California—San Francisco], or pLacZ) and Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations. pLacZ-transfected cells were stained as previously described (50) with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) at 24 h posttransfection to monitor transfection efficiency, which ranged from 40 to 90%, based on the number of blue cells observed under the microscope. For uptake assays involving the inhibitor nitrobenzylmercaptopurine riboside (NBMPR; Sigma), cells were pretreated at the appropriate concentration for 15 min. For those involving phloridzin (Sigma), 15 min of pretreatment was not required; therefore, the pretreatment incubation period was shortened to 5 min. Following inhibitor pretreatment, uptake assays were preformed as described above, with the exception that the incubation period was reduced to 5 min.

Real-time RT-PCR and immunoblot analysis. Total RNA was isolated from RBVr and RBVs Huh-7 cells as previously described (53). Briefly, 1 x 107 cells were collected, resuspended in a cell lysis buffer, and placed on ice for 5 min. Following centrifugation, sodium dodecyl sulfate (SDS) buffer was added, and samples were vortexed and then incubated with proteinase K. Nucleic acids were phenol-chloroform/isoamyl alcohol extracted and treated with a DNase solution, and samples were subjected to an additional phenol-chloroform/isoamyl alcohol extraction. The relative levels of ENT1, CNT3, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (as an internal control) RNAs were assessed using one-step reverse transcriptase PCR (RT-PCR) and the comparative threshold cycle ({Delta}{Delta}Ct) method (5). Reactions were performed with an ABI 7500 sequence detection system (Applied Biosystems) and analyzed using ABI Sequence Detection 1.3 software. Reaction mixtures were plated in triplicate, each in a total volume of 25 µl, and consisted of 50 ng of whole-cell RNA from RBVr and RBVs Huh-7 cells, SYBR green PCR master mix (Applied Biosystems), 1.25 µM primer, RNasin (40 U/µl), and SuperScript II RT (200 U/µl). Reactions were performed according to the manufacturer's suggestions (Applied Biosystems). Cycling conditions were as follows: 1 cycle of 30 min at 42°C and 10 min at 95°C and then 40 cycles of 15 s at 95°C and 1 min at 60°C. The ENT1 and GAPDH primers have been previously reported (39, 40). The CNT3 primer was designed using Primer3 v. 0.4.0 (56). The forward and reverse CNT3 primer sequences are ACCTGATGGCCAAATACGAAC and GAGCTCCAGATCACCCACTTC, respectively. Each primer was validated according to standard protocol (5), and the products were additionally verified by agarose gel electrophoresis. Analysis and methods used to determine the change (2{Delta}{Delta}Ct) using the comparative ({Delta}{Delta}Ct) method have been previously described (5). For immunoblot analysis, approximately 5 x 105 Huh-7 and RBVr Huh-7 cells were collected via trypsinization and centrifugation, followed by three washes with ice-cold phosphate-buffered saline. Cell pellets were resuspended in a lysis buffer (10 mM Tris, 150 mM NaCl, 0.02% NaN3, 1% Na-deoxycholate, 1% Triton X-100, 0.1% SDS) containing 10 µl/ml (each) of protease inhibitor cocktail (Sigma) and phosphatase inhibitor (Calbiochem). Lysates were centrifuged, and supernatants were removed and transferred to fresh tubes for protein concentration determination using a Bio-Rad protein assay. Twenty micrograms of protein was then separated by 10% SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Following primary (rabbit polyclonal immunoglobulin ENT1; Abgent) and secondary (donkey anti-rabbit immunoglobulin G-horseradish peroxidase; Jackson Immunoresearch) antibody probing, blots were developed using an ECL Plus chemiluminescence reagent (Amersham) according to the manufacturer's recommendations.

Statistical analysis. Statistical significance was determined using independent two-sample Student's t test. Statistical significance was assigned to P values of less than 0.05.


arrow
RESULTS
 
RBV uptake and poliovirus growth in different cell lines. To assess whether the amount of RBV uptake could impact viral replication, we measured RBV uptake in a variety of cell lines and measured the growth of a model RNA virus, poliovirus. Various cell lines were tested, including several liver cell lines (Huh-7, HepG2, and PH5CH8) and a Huh-7-based cell line previously shown to have reduced RBV uptake (Cured 4) (49). As expected, the RBVr Cured 4 cells took up significantly less RBV than all cell lines tested (Fig. 1A) (P ≤ 0.005). Although the amount of RBV uptake varied between the remaining cell lines, Huh-7 cells took up significantly less than HeLa, HepG2, PH5CH8, and MCF7 cells (P ≤ 0.01). We then determined whether differences in RBV uptake correlated with poliovirus growth efficiency in the presence of RBV. We chose poliovirus as a model RNA virus because RBV's antiviral mechanism for poliovirus, error catastrophe, has been established (8). Since the mutagenic effects of RBV are cumulative and require several rounds of viral replication, an infection carried out over several days allows differences in viral growth to be observed (7, 8, 48, 49). Therefore, we performed plaque assays with each of the cell lines in the absence or presence of 400 µM RBV. Although the addition of RBV greatly inhibited viral growth in the majority of cell lines (Fig. 1B), those with lower RBV uptake levels generally displayed enhanced viral growth, as measured by plaque size. The addition of RBV to the Cured 4 cell line had little effect on viral plaque size. Likewise, although a reduction in viral growth was observed for Huh-7 cells upon addition of RBV, the antiviral efficacy of the drug was reduced compared with cells having higher levels of uptake. These results suggest the possibility that low drug uptake facilitated enhanced viral growth in the presence of RBV.


Figure 1
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 1. RBV uptake and poliovirus growth in several cell lines. (A) [3H]RBV uptake assay. Cells were incubated in media containing 5 µM [3H]-labeled RBV at 37°C. After 30 min, cells were chilled, washed, ad harvested, and the level of [3H]RBV uptake was determined by scintillation counting. The data were normalized to account for cell numbers and are reported as counts per minute (CPM) per cell. The average values and standard deviations (SD) from at least three independent experiments performed in duplicate are shown. The difference between Cured 4 values and all other values was statistically significant (P ≤ 0.005, Student's t test). Huh-7 cells took up significantly less than HeLa, HepG2, PH5CH8, and MCF7 cells (P ≤ 0.01). (B) Poliovirus plaque assays. Cells were infected with poliovirus, and agar overlays, containing 0 µM or 400 µM RBV, were added. After 48 h, the overlays were removed and cells were stained with crystal violet to visualize plaques.

Generation and characterization of new RBVr cell lines. The RBVr Cured 4 cell line generated previously had initially contained the HCV replicon, which was cured by IFN treatment (49). Consequently, it is possible that cellular resistance could have arisen due to virally induced changes in the cells. For this reason, we generated new RBVr versions of three cell lines, Huh-7, 293, and HeLa. RBV is toxic to a variety of cell lines at high micromolar concentrations (49, 71). Therefore, we generated RBVr cell lines by passages in increasing doses of RBV as previously described (Fig. 2A) (49). Once the cells were able to withstand high concentrations of RBV, they were tested for resistance alongside the parental RBVs cell lines. Both the RBVs and the RBVr cells were passaged for 10 days in medium containing 0 µM, 100 µM, or 400 µM RBV. As shown in Fig. 2B, each of the RBVr cell lines survived treatment with either high- or low-dose RBV, whereas their RBVs counterparts could not. Importantly, all of the RBVr cells demonstrated significantly reduced RBV uptake (Fig. 2C) (P < 0.01).


Figure 2
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 2. Generation of RBVr cell lines and the effect of RBV resistance on poliovirus growth. (A) Generation of RBVr cell lines. Huh-7, HeLa, and 293 cells were passaged for 1 to 4 weeks in medium containing 100 µM RBV. The dosage of RBV was increased by 100 µM every 2 weeks until a concentration of 400 µM was achieved. After 2 to 4 weeks in 400 µM RBV, the cells were assessed for RBV resistance and RBV uptake. (B) RBV resistance assay. The RBVr and RBVs parental cells were passaged for 10 days in medium containing 0 µM, 100 µM, or 400 µM RBV. The cells were then stained with crystal violet to visualize cellular viability. (C) [3H]RBV uptake. Cells were incubated in media containing [3H]RBV for 30 min. at 37°C, and the level of [3H]RBV uptake was determined by scintillation counting of cell lysates. The average values and SD from six independent experiments are shown. The difference in levels of uptake between RBVs and RBVr cell lines was statistically significant (P < 0.01, Student's t test). (D) Plaque assays for RBVr and RBVs parental cells. Cells were infected with poliovirus, and agar overlays, containing 0 µM or 400 µM RBV, were added. After 48 h, the overlays were removed and cells were stained with crystal violet to visualize plaques.

Our previous results suggested that reduced RBV uptake promotes increased viral growth (49). Therefore, we performed poliovirus plaque assays to determine whether the new RBVr cell lines demonstrate increased permissivity for viral growth in the presence of RBV. Whereas RBV treatment severely limited viral growth in RBVs HeLa cells, it had little effect on viral growth in RBVr HeLa cells (Fig. 2D). Poliovirus grown in RBVr Huh-7 cells also displayed an increased plaque size in the presence of RBV, although the viral growth difference between RBVs and RBVr Huh-7 cells was less than the viral growth difference observed for RBVs and RBVr HeLa cells. The minimal increase in plaque size in the RBVr Huh-7 cells in the presence of RBV could be due to the reduced uptake in these cells (Fig. 1) or to other host factors that enhance viral growth. Overall, these results indicate that a small reduction in RBV uptake (~50% reduction in HeLa cells) (Fig. 2C) can have a major impact on poliovirus growth (Fig. 2D, HeLa cells).

The role of nucleoside transporters in RBV uptake and resistance. RBV is transported into cells via nucleoside transporters. ENT1 is thought to be the primary RBV transporter (25), although ENT2 and CNT2 may also transport RBV in human liver (20). However, most previous studies measured RBV uptake in erythrocytes, and it is well known that nucleoside transporter expression varies in different tissues (20). To determine which transporters are capable of importing RBV into liver cell lines, we transfected Huh-7 cells with several nucleoside transporter expression plasmids to determine which could increase RBV uptake. As shown in Fig. 3A, transfection of ENT1 and CNT3 expression plasmids increased RBV uptake. We next determined whether overexpression of ENT1 or CNT3 could rescue the RBV uptake defect in RBVr cells (Fig. 3B). Transfection of the ENT1 or CNT3 expression plasmid increased the level of RBV uptake in all RBVs cell lines tested, as well as in the majority of RBVr cell lines. Although the level of uptake increased ~3-fold in RBVr Huh-7 cells, nucleoside transporter overexpression was not able to fully restore the uptake defect (Fig. 3C). While we cannot definitively rule out a role for ENT2, CNT1, and CNT2 in RBV transport based on this experiment, in later inhibition experiments, we confirm the role of ENT1 in RBV uptake (Fig. 4).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 3. The effect of nucleoside transporter overexpression on RBV uptake. (A) RBVs Huh-7 cells were transfected with nucleoside transporter expression plasmids or a vector control plasmid, and the [3H]RBV uptake assay was performed at 24 h posttransfection. The average values and SD from three independent experiments are shown. The difference in levels of uptake between vector and ENT1- or CNT3-transfected cells was statistically significant for all cell lines (P ≤ 0.03, Student's t test). (B) RBVr and RBVs Huh-7, 293, and HeLa cells were transfected with the vector control, ENT1, or CNT3 transporter expression plasmids, and the [3H]RBV uptake assay was performed at 24 h posttransfection. The average values and SD from at least three independent experiments are shown. The difference in levels of uptake between vector and ENT1- or CNT3-transfected cells was statistically significant for all cell lines (P ≤ 0.03, Student's t test). (C) Huh-7 uptake data from panel B graphed on an appropriate scale to highlight uptake differences. The average values and SD from at least three independent experiments are shown.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 4. Inhibition of endogenous RBV uptake in Huh-7 and HeLa cells. (A and B) [3H]RBV uptake in the presence of NBMPR. Huh-7 cells (A) or HeLa cells (B) were pretreated for 15 min. with 15 µM NBMPR to inhibit ENT1 transport, 100 µM NBMPR to inhibit ENT1 and ENT2 transport, or media lacking NBMPR. Following inhibitor treatment, the level of [3H]RBV uptake was determined over a 5-min incubation period. The difference in uptake levels between NBMPR-treated and untreated cells was statistically significant for both Huh-7 and HeLa cells (P < 0.04, Student's t test). (C and D) [3H]RBV uptake in the presence of phloridzin. Huh-7 cells (C) or HeLa cells (D) were pretreated for 5 min. with 1 mM phloridzin, to inhibit concentrative nucleoside transport, or medium lacking phloridzin. Following inhibitor treatment, the level of [3H]RBV uptake was determined over a 5-min incubation period. The average values and SD from two experiments performed in duplicate are shown. The difference in levels of uptake between phloridzin-treated and untreated cells was not statistically significant (P > 0.3, Student's t test). (E) To ensure that phloridzin inhibits concentrative transport, Huh-7 cells were transfected with the vector control or CNT3 transporter expression plasmid, and the [3H]RBV uptake assay was performed at 24 h posttransfection in the presence or absence of 1 mM phloridzin. The average values and SD from two independent experiments, performed in duplicate, are shown. The difference in levels of uptake between phloridzin-treated and untreated CNT3-transfected cells was statistically significant (P = 0.001, Student's t test).

The effect of nucleoside transporter inhibition on RBV uptake in RBVr and RBVs cells. If the RBVr cells have some modification that alters nucleoside transporter expression or activity, then the RBVr phenotype should be mimicked by inhibition of endogenous transporters in RBVs cells. Therefore, we performed RBV uptake assays in RBVr and RBVs Huh-7 cells and HeLa cells in the presence of nucleoside transport inhibitors. NBMPR is an inosine analog commonly used as an equilibrative nucleoside transport inhibitor. ENT1- and ENT2-mediated transport can be differentiated based on levels of NBMPR sensitivity. ENT1 is NBMPR sensitive and is inhibited within the nanomolar range, while ENT2 is insensitive to nanomolar concentrations of NBMPR, with inhibition requiring concentrations within the high micromolar range (31, 67). The RBV uptake assay was performed with RBVr and RBVs Huh-7 or HeLa cells in the presence or absence of NBMPR. For both Huh-7 and HeLa cells, NBMPR treatment reduced RBV uptake in RBVs cells threefold, to an amount comparable to the level of uptake of RBVr cells (Fig. 4A and B). Since treatment with 15 µM NBMPR was not sufficient to completely inhibit ENT1 uptake, we repeated the experiment using a higher dose, 100 µM NBMPR, which would completely block ENT1-mediated transport and likely ENT2-mediated transport as well. As anticipated, treatment of RBVs Huh-7 or HeLa cells with 100 µM NBMPR reduced RBV uptake to match the low uptake of RBVr cells (Fig. 4A and B). Although ENT3 or ENT4 are equilibrative transporters, they are not likely to be relevant for RBV uptake because ENT3 is localized in intracellular compartments, and ENT4 is a monoamine/organic cation transporter (69).

Because overexpression of CNT3 could also restore RBV uptake in RBVr cells, we performed the inhibition assay using the drug phloridzin, which is a broad concentrative transport inhibitor (22, 44, 61). We observed no significant difference in the level of uptake in either the RBVr or RBVs Huh-7 or HeLa cells in the presence of phloridzin (Fig. 4C and D). In order to confirm that the drug concentration used was sufficient to inhibit concentrative transport, Huh-7 cells were transfected with CNT3 and then subjected to the RBV uptake assay in the presence of phloridzin. We observed a dramatic decrease in the level of RBV uptake in the CNT3-transfected cells (Fig. 4E), indicating that phloridzin was indeed capable of inhibiting concentrative transport. Taken together, these results suggest that endogenous uptake of RBV in Huh-7 and HeLa cells is primarily equilibrative, with the majority of uptake mediated by ENT1. Despite the fact that ENT1 overexpression could not completely restore RBV uptake in RBVr Huh-7 cells to the amount of uptake observed for RBVs Huh-7 cells, the robust inhibition of RBV uptake in RBVs Huh-7 cells by NBMPR (Fig. 4A) indicates that ENT1 is the likely RBV transporter in these cells. Additionally, our results indicate that for Huh-7 and HeLa cells, uptake is not mediated via concentrative transporters, since decreased uptake was not observed upon inhibition of concentrative transport.

Quantification of ENT1 expression in RBVs and RBVr cells. In some cases of acquired resistance to nucleoside analog drugs, a decrease in the level of nucleoside transporter RNA has been reported (15, 17, 59). Therefore, we compared ENT1 and CNT3 RNA levels in RBVr and RBVs Huh-7 cells by using real-time RT-PCR. CNT3 RNA was undetectable in Huh-7 cells by real-time RT-PCR analysis (data not shown). We found a slight variation in ENT1 RNA levels between RBVr and RBVs Huh-7 cells, with a 0.2-fold reduction in ENT1 RNA in the RBVr cell line (Fig. 5A). Although this small reduction in ENT1 RNA levels was statistically significant (P < 0.01), ENT1 protein levels were equivalent in RBVs and RBVr cells (Fig. 5B). Therefore, ENT1 RNA and protein levels do not correlate with RBV uptake or resistance, suggesting that altered ENT1 localization or activity may contribute to resistance. These results highlight the importance of assessing the activity of nucleoside transporters, rather than RNA or protein levels.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 5. Nucleoside transporter RNA and protein levels in RBVr and RBVs cells. (A) Total RNA was isolated from RBVr and RBVs Huh-7 cells, and the relative levels of ENT1, CNT3, and GAPDH RNA were assessed with one-step real-time RT-PCR using the comparative method (internal control not shown). CNT3 RNA was not detectable (data not shown). The average values and SD from three experiments performed in triplicate are shown. The difference in ENT1 RNA levels in RBVr and RBVs cells was statistically significant (P < 0.01, Student's t test). (B) Immunoblot analysis of ENT1 protein levels in RBVr and RBVs Huh-7 cells. Lysates were prepared, and equivalent amounts of total protein were loaded. A representative immunoblot, probed with anti-human ENT1 antibody, is shown. The two bands may represent unglycosylated ENT1 (~45 kDa) and glycosylated ENT1 (~55 kDa) (22).

Effect of nucleoside transporter activity on RBV-mediated viral growth inhibition. Our results indicated that the level of RBV uptake affects poliovirus growth (Fig. 1 and Fig. 2D), and inhibition of equilibrative transport reduced RBV uptake in RBVs cells (Fig. 4A and B). Thus, we sought to determine whether the antiviral efficacy of RBV could be reduced in RBVs cells through equilibrative transport inhibition. Poliovirus plaque assays were performed in the absence or presence of RBV and in the absence or presence of NBMPR. As anticipated, the inhibition of equilibrative transport facilitated robust viral growth, despite the presence of RBV (Fig. 6). We also performed the poliovirus plaque assays with the concentrative inhibitor phloridzin. We observed no difference in viral plaque sizes in the presence of phloridzin and RBV (data not shown). These results, in conjunction with our other data, indicate that endogenous ENT1 is responsible for RBV uptake in Huh-7 and HeLa cells and that ENT1-mediated RBV uptake facilitates RBV's antiviral effect in these cells.


Figure 6
View larger version (81K):
[in this window]
[in a new window]

 
FIG. 6. Effect of equilibrative nucleoside transporter inhibition on RBV-mediated viral growth inhibition. HeLa cells were infected with poliovirus, and an agar overlay containing 0 µM or 400 µM RBV and 0 µM or 100 µM NBMPR was added. After 48 h, the overlay was removed and cells were stained with crystal violet to visualize plaques.

Nucleoside uptake compensation mechanism in RBVr Huh-7 cells. Whereas ENT1 clearly plays a pivotal function in the uptake of RBV in Huh-7 and HeLa cells, we could not dismiss the possibility that ENT2 contributed to RBV uptake (Fig. 4A and B). The simplest method of differentiating ENT1- and ENT2-mediated uptake, other than NBMPR sensitivity, is through nucleobase transport. While ENT2 has the capacity to transport both nucleosides and nucleobases, ENT1 cannot transport nucleobases (24, 55, 64, 68). Therefore, we monitored the uptake of [3H]hypoxanthine, a nucleobase. In contrast to the low level of RBV uptake in RBVr Huh-7 cells, the level of hypoxanthine uptake in RBVr Huh-7 cells was increased almost threefold compared with that in RBVs Huh-7 cells (Fig. 7A) (P < 0.01). Although not initially expected, these data provide evidence for a possible cellular compensation mechanism for reduced ENT1-mediated uptake. A deficiency in a broad transporter such as ENT1 would be expected to confer a cellular growth defect. Perhaps to compensate for the reduction in available nucleosides imported by ENT1, the activity of ENT2, another broad nucleoside transporter, increased. Interestingly, the level of hypoxanthine uptake was equivalent in RBVr and RBVs HeLa cells (Fig. 7B), suggesting that the ENT2-mediated compensation mechanism may be unique to Huh-7 cells.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 7. Hypoxanthine uptake in RBVs and RBVr cells. RBVr and RBVs Huh-7 cells (A) or RBVr and RBVs HeLa cells (B) were incubated in media containing 5 µM [3H]-labeled hypoxanthine for 5 min at 37°C, and the level of [3H]-hypoxanthine uptake was determined by scintillation counting. The average values and SD from at least three experiments performed in duplicate are shown. The difference in hypoxanthine uptake between RBVr and RBVs cells was statistically significant for Huh-7 cells (P < 0.01, Student's t test) but not for HeLa cells (P = 0.68).


arrow
DISCUSSION
 
Only limited success has been achieved in treating those infected with HCV. Whereas much effort has been targeted toward understanding the mechanism of IFN and potential IFN resistance, relatively little effort has been directed toward understanding RBV. RBV has been shown to play an important role in the treatment response (14), and higher RBV serum concentrations correlate with improved treatment outcome (26, 34). However, we still do not understand how RBV works synergistically with IFN to improve SVR rates or whether resistance to RBV develops in patients.

Our goal in this study was to gain a better understanding of potential RBV resistance mechanisms by using a cell culture system. We began by examining the levels of RBV uptake among several cell lines and found it to vary. We next ascertained whether RBV uptake level influenced antiviral efficacy by performing poliovirus plaque assays. It is known that poliovirus is sensitive to RBV at high concentrations, such as 400 µM. Additionally, the antiviral mechanism of RBV, increasing the error rate to the point of error catastrophe (8), is well established for poliovirus. We observed an inverse relationship, where decreased RBV uptake facilitated increased viral growth in the presence of RBV (Fig. 1B). Importantly, a high dose of RBV was used in this study and is required to observe effects on poliovirus growth (7, 8, 48, 49). Although the concentration of RBV in plasma is significantly lower (~10 µM), RBV may accumulate to higher concentrations in the liver (18).

Since the focus of our work was to understand potential host-mediated RBV resistance, we generated new RBVr cell lines using cells that had not previously contained the HCV replicon (49). Resistance was achieved in all three cell lines, and the RBVr phenotype was stable, with cells maintaining their resistance despite months of culture in media lacking RBV (data not shown). When tested for RBV uptake, all RBVr cell lines demonstrated significantly reduced uptake compared to their RBVs counterparts (Fig. 2C). Upon performing poliovirus plaque assays in these new RBVr cell lines, we found that RBV resistance also facilitated increased poliovirus growth in the presence of RBV (Fig. 2D). These results indicate that a reduction in RBV uptake can promote increased poliovirus growth.

As RBV is imported by nucleoside transporters, we assessed the contribution of several nucleoside transporters to RBV resistance in our cell lines. After surveying several transporters, we found that overexpression of ENT1 and CNT3 increased RBV uptake. Although ENT1 is widely accepted as the primary RBV transporter, there have been additional reports suggesting that other transporters can import RBV (13, 20, 45, 66); indeed, our findings confirm CNT3-mediated RBV uptake. Additionally, we determined whether overexpression of ENT1 or CNT3 could restore the uptake defect in RBVr cells. We found that in the majority of RBVr cells, overexpression of ENT1 or CNT3 could restore RBV uptake (Fig. 3B). While transfection of ENT1 and CNT3 significantly increased uptake in RBVs Huh-7, 293, and HeLa cells, it could completely restore the uptake defect in only RBVr 293 and HeLa cells. The fact that uptake could not be completely restored in RBVr Huh-7 cells (Fig. 3C) suggests other factors could interfere with RBV uptake in RBVr Huh-7 cells, perhaps by limiting nucleoside transporter activity or localization. However, RBV uptake could be completely restored in ENT1- or CNT3-transfected RBVr Huh-7.5 cells, a liver cell line derived from Huh-7 cells (data not shown). These results indicate that multiple pathways can lead to RBV resistance, even in transformed cells of the same lineage, such as Huh-7 and Huh-7.5 cells. We hypothesize that ENT1 protein is mislocalized in RBVr Huh-7 cells. There is evidence that localization of ENT1 and other transporters can change from the plasma membrane to intracellular membrane compartments in response to various stimuli, including adaptation to two-dimensional tissue culture (20) (see below). Similarly, the expression and activity of transporters can change in response to transformation (11). Therefore, although our results with Huh-7 cells may or may not apply to liver cells in vivo, they provide a foundation for future studies of the role of nucleoside transporters in host-based RBV resistance and antiviral efficacy.

Whereas ENT1 is ubiquitously expressed, the expression of CNT3 is normally restricted to a few tissues, with low expression levels reported for the liver (4, 21). The most common method of determining endogenous transport activity is through uptake assays performed in the presence of specific inhibitors. Experiments performed using NBMPR (an ENT1 inhibitor) and phloridzin (a broad concentrative nucleoside transport inhibitor) indicated that RBV uptake occurs primarily through ENT1 (Fig. 4A and B). While CNT3 was capable of increasing RBV uptake into the cells upon transfection (Fig. 3B), CNT3 expression was undetectable in nontransfected Huh-7 cells as measured by real-time RT-PCR (data not shown). These data suggest that ENT1 is the RBV transporter in the Huh-7 hepatoma cell line.

Host-based resistance to treatment with nucleoside analogs is not uncommon in cancer patients, and numerous studies linking nucleoside analog drug resistance to decreased nucleoside transporter expression have been reported (15, 17, 59). Accordingly, we quantified ENT1 RNA levels in the RBVr and RBVs Huh-7 cells, and found only slightly reduced ENT1 expression in RBVr cells (Fig. 5). An immunoblot analysis indicated that ENT1 protein levels are equivalent in RBVr and RBVs cells (Fig. 5B), providing support for the idea that ENT1 activity or protein localization is altered in RBVr cells. Perhaps some modification occurred that altered the activity of ENT1, or altered the plasma membrane localization of ENT1, thus conferring the RBVr phenotype. While much remains to be understood regarding regulation, localization, and activity of nucleoside transporters, there is a precedent for localization of transporters in internal cell compartments (20, 32, 38, 41, 51). Altered ENT1 localization would account for the similar ENT1 RNA and protein levels found in RBVr and RBVs cells. It is also possible that RBV resistance is conferred by altered RBV processing pathways, such as reduced phosphorylation or increased degradation. There have been several cases in which resistance correlates with either a decrease in the level of activating kinases required for nucleoside phosphorylation or an increase in the level of 5' nucleotidases capable of dephosphorylating nucleoside analogs (16, 17, 38). However, the facts that uptake of RBV was reduced in RBVr cell lines, that no difference was found in the levels of export of RBV (data not shown), and that inhibition of ENT activity mimicked the RBVr cell phenotype suggest that RBV resistance is due to altered ENT1 activity and not phosphorylation, degradation, or efflux effects.

After establishing that the level of RBV uptake affects viral growth and that endogenous ENT1 was primarily responsible for uptake, our next step was to demonstrate the antiviral impact of altered uptake. Our results illustrated two key points. First, by blocking equilibrative transport, uptake in the RBVs cells mirrored that in the RBVr cells. Second, inhibition of RBV uptake reduced antiviral efficacy, with poliovirus growth in the RBVs cells mirroring that in the RBVr cells in the presence of nucleoside transport inhibitor (Fig. 6). Overall, our results indicate a role for ENT1-mediated RBV transport in the uptake of RBV and suggest that a reduction in ENT1 activity may play a role in the acquisition of resistance.

The idea that host-based nucleoside uptake defects can affect antiviral efficacy may have clinical relevance. Similar to cancer patients undergoing chemotherapy, chronically infected hepatitis C patients undergo harsh, toxic, long-term treatments. The standard of care for treating HCV infection includes a combination of pegylated IFN-{alpha} and RBV for 24 to 48 weeks. Treatment with IFN alone can have side effects, but RBV is also a toxic drug capable of inducing hemolytic anemia. As with long-term exposure to cytotoxic nucleoside analogs in chemotherapy, it is plausible that host-based drug resistance could occur in response to RBV treatment. Constant exposure to RBV toxicity could trigger reduced transporter activity. Liver cells, like many others, are capable of de novo nucleoside synthesis. Additionally, the liver is considered the main site of nucleoside synthesis, providing a reservoir of nucleosides for other cells in the body which lack de novo synthesis (31). It is likely that any disadvantage conferred by downregulation of a broad transporter such as ENT1 would be outweighed by the advantage of hepatocyte survival.

Our work also suggests that for RBVr Huh-7 cells, a compensation mechanism upregulates the activity of an alternate transporter, ENT2 (Fig. 7A). Furthermore, these results provide additional evidence, indirectly, that ENT1 is indeed the primary RBV nucleoside transporter in Huh-7 cells. We surmise that upregulation of an alternate transporter offsets the disadvantage caused by downregulation of ENT1 activity. Therefore, we suggest that ENT1 downregulation is primarily responsible for RBV resistance and that Huh-7 cells compensate for reduced nucleoside uptake by upregulation of the ENT2 transporter. RBVr HeLa cells did not exhibit this ENT2-mediated compensation mechanism (Fig. 7B). Interestingly, RBVr HeLa cells grow significantly slower than RBVr Huh-7 cells (data not shown).

It is possible that nucleoside transporter activity could aid in the prediction of treatment success. Perhaps elevated RBV uptake correlates with overall treatment success. Higher RBV serum concentrations have been associated with SVR (26, 34). SVR rates of up to 90% have been achieved by using extremely high doses of RBV (35), albeit with increased toxicity. We are currently measuring RBV uptake in HCV patient samples and determining the effect of the RBV uptake level on the HCV treatment response and HCV replication. If RBV uptake can affect the treatment response, either through natural transport differences in the population or through acquired resistance, then tailored treatment regimens may enhance the treatment response.


arrow
ACKNOWLEDGMENTS
 
We thank David Rasko and Andrea Erickson for assistance with real-time RT-PCR analysis, Kathy Giacomini for helpful advice and the nucleoside transporter constructs, Will Lee and Mamta Jain for helpful advice, and Nick Conrad and Pinghui Feng for helpful comments on the manuscript.

This study has been supported by funding from the Lizanell and Colbert Coldwell Foundation, American Cancer Society grant IRG-02-196, the University of Texas Southwestern President's Research Council, start-up funds provided by the state of Texas, and a Pew Scholar award to J.K.P.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9048. Phone: (214) 648-7319. Fax: (214) 648-5905. E-mail: Julie.Pfeiffer{at}UTSouthwestern.edu Back

{triangledown} Published ahead of print on 25 February 2009. Back


arrow
REFERENCES
 
    1
  1. Anonymous. 2000. Hepatitis C—global prevalence (update). Wkly. Epidemiol. Rec. 75:18-19.[Medline]
  2. 2
  3. Bacheler, L., S. Jeffrey, G. Hanna, R. D'Aquila, L. Wallace, K. Logue, B. Cordova, K. Hertogs, B. Larder, R. Buckery, D. Baker, K. Gallagher, H. Scarnati, R. Tritch, and C. Rizzo. 2001. Genotypic correlates of phenotypic resistance to efavirenz in virus isolates from patients failing nonnucleoside reverse transcriptase inhibitor therapy. J. Virol. 75:4999-5008.[Abstract/Free Full Text]
  4. 3
  5. Bain, V. G., S. S. Lee, K. Peltekian, E. M. Yoshida, M. Deschenes, M. Sherman, R. Bailey, H. Witt-Sullivan, R. Balshaw, and M. Krajden. 2008. Clinical trial: exposure to ribavirin predicts EVR and SVR in patients with HCV genotype 1 infection treated with peginterferon alpha-2a plus ribavirin. Aliment. Pharmacol. Ther. 28:43-50.[Medline]
  6. 4
  7. Baldwin, S. A., P. R. Beal, S. Y. Yao, A. E. King, C. E. Cass, and J. D. Young. 2004. The equilibrative nucleoside transporter family, SLC29. Pflugers Arch. 447:735-743.[CrossRef][Medline]
  8. 5
  9. Bookout, A. L., C. L. Cummins, M. F. Kramer, J. M. Pesola, and D. J. Mangelsdorf. 2006. High-throughput real-time quantitative reverse transcription PCR. Curr. Protoc. Mol. Biol. 2006:15.8.
  10. 6
  11. Bougie, I., and M. Bisaillon. 2003. Initial binding of the broad spectrum antiviral nucleoside ribavirin to the hepatitis C virus RNA polymerase. J. Biol. Chem. 278:52471-52478.[Abstract/Free Full Text]
  12. 7
  13. Crotty, S., C. E. Cameron, and R. Andino. 2001. RNA virus error catastrophe: direct molecular test by using ribavirin. Proc. Natl. Acad. Sci. USA 98:6895-6900.[Abstract/Free Full Text]
  14. 8
  15. Crotty, S., D. Maag, J. J. Arnold, W. Zhong, J. Y. Lau, Z. Hong, R. Andino, and C. E. Cameron. 2000. The broad-spectrum antiviral ribonucleoside ribavirin is an RNA virus mutagen. Nat. Med. 6:1375-1379.[CrossRef][Medline]
  16. 9
  17. Damaraju, V. L., S. Damaraju, J. D. Young, S. A. Baldwin, J. Mackey, M. B. Sawyer, and C. E. Cass. 2003. Nucleoside anticancer drugs: the role of nucleoside transporters in resistance to cancer chemotherapy. Oncogene 22:7524-7536.[CrossRef][Medline]
  18. 10
  19. Dixit, N. M., and A. S. Perelson. 2006. The metabolism, pharmacokinetics and mechanisms of antiviral activity of ribavirin against hepatitis C virus. Cell. Mol. Life Sci. 63:832-842.[CrossRef][Medline]
  20. 11
  21. Dragan, Y., R. Valdes, M. Gomez-Angelats, A. Felipe, F. Javier Casado, H. Pitot, and M. Pastor-Anglada. 2000. Selective loss of nucleoside carrier expression in rat hepatocarcinomas. Hepatology 32:239-246.[CrossRef][Medline]
  22. 12
  23. Enomoto, N., I. Sakuma, Y. Asahina, M. Kurosaki, T. Murakami, C. Yamamoto, N. Izumi, F. Marumo, and C. Sato. 1995. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b: sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J. Clin. Investig. 96:224-230.[Medline]
  24. 13
  25. Errasti-Murugarren, E., M. Pastor-Anglada, and F. J. Casado. 2007. Role of CNT3 in the transepithelial flux of nucleosides and nucleoside-derived drugs. J. Physiol. 582:1249-1260.[Abstract/Free Full Text]
  26. 14
  27. Feld, J. J., and J. H. Hoofnagle. 2005. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature 436:967-972.[CrossRef][Medline]
  28. 15
  29. Fotoohi, A. K., M. Lindqvist, C. Peterson, and F. Albertioni. 2006. Involvement of the concentrative nucleoside transporter 3 and equilibrative nucleoside transporter 2 in the resistance of T-lymphoblastic cell lines to thiopurines. Biochem. Biophys. Res. Commun. 343:208-215.[CrossRef][Medline]
  30. 16
  31. Galmarini, C. M., M. L. Clarke, L. Jordheim, C. L. Santos, E. Cros, J. R. Mackey, and C. Dumontet. 2004. Resistance to gemcitabine in a human follicular lymphoma cell line is due to partial deletion of the deoxycytidine kinase gene. BMC Pharmacol. 4:8.[CrossRef][Medline]
  32. 17
  33. Galmarini, C. M., X. Thomas, F. Calvo, P. Rousselot, A. El Jafaari, E. Cros, and C. Dumontet. 2002. Potential mechanisms of resistance to cytarabine in AML patients. Leuk. Res. 26:621-629.[CrossRef][Medline]
  34. 18
  35. Glue, P. 1999. The clinical pharmacology of ribavirin. Semin. Liver Dis. 19(Suppl. 1):17-24.[Medline]
  36. 19
  37. Goswami, B. B., E. Borek, O. K. Sharma, J. Fujitaki, and R. A. Smith. 1979. The broad spectrum antiviral agent ribavirin inhibits capping of mRNA. Biochem. Biophys. Res. Commun. 89:830-836.[CrossRef][Medline]
  38. 20
  39. Govindarajan, R., C. J. Endres, D. Whittington, E. LeCluyse, M. Pastor-Anglada, C. M. Tse, and J. D. Unadkat. 2008. Expression and hepatobiliary transport characteristics of the concentrative and equilibrative nucleoside transporters in sandwich-cultured human hepatocytes. Am. J. Physiol. Gastrointest. Liver Physiol. 295:G570-G580.[Abstract/Free Full Text]
  40. 21
  41. Gray, J. H., R. P. Owen, and K. M. Giacomini. 2004. The concentrative nucleoside transporter family, SLC28. Pflugers Arch. 447:728-734.[CrossRef][Medline]
  42. 22
  43. Griffith, D. A., and S. M. Jarvis. 1996. Nucleoside and nucleobase transport systems of mammalian cells. Biochim. Biophys. Acta 1286:153-181.[Medline]
  44. 23
  45. Hofmann, W. P., C. Sarrazin, B. Kronenberger, B. Schonberger, K. Bruch, and S. Zeuzem. 2003. Mutations within the CD81-binding sites and hypervariable region 2 of the envelope 2 protein: correlation with treatment response in hepatitis C virus-infected patients. J. Infect. Dis. 187:982-987.[CrossRef][Medline]
  46. 24
  47. Isakovic, A. J., S. M. Dencic, M. B. Segal, and Z. B. Redzic. 2008. Transport of [14C]hypoxanthine by sheep choroid plexus epithelium as a monolayer in primary culture: Na+-dependent and Na+-independent uptake by the apical membrane and rapid intracellular metabolic conversion to nucleotides. Neurosci. Lett. 431:135-140.[CrossRef][Medline]
  48. 25
  49. Jarvis, S. M., J. A. Thorn, and P. Glue. 1998. Ribavirin uptake by human erythrocytes and the involvement of nitrobenzylthioinosine-sensitive (es)-nucleoside transporters. Br. J. Pharmacol. 123:1587-1592.[CrossRef][Medline]
  50. 26
  51. Jen, J., M. Laughlin, C. Chung, S. Heft, M. B. Affrime, S. K. Gupta, P. Glue, and G. Hajian. 2002. Ribavirin dosing in chronic hepatitis C: application of population pharmacokinetic-pharmacodynamic models. Clin. Pharmacol. Ther. 72:349-361.[CrossRef][Medline]
  52. 27
  53. Jen, J. F., P. Glue, S. Gupta, D. Zambas, and G. Hajian. 2000. Population pharmacokinetic and pharmacodynamic analysis of ribavirin in patients with chronic hepatitis C. Ther. Drug Monit. 22:555-565.[CrossRef][Medline]
  54. 28
  55. Johnson, V. A., F. Brun-Vezinet, B. Clotet, H. F. Gunthard, D. R. Kuritzkes, D. Pillay, J. M. Schapiro, and D. D. Richman. 2007. Update of the drug resistance mutations in HIV-1: 2007. Top. HIV Med. 15:119-125.[Medline]
  56. 29
  57. King, K. M., V. L. Damaraju, M. F. Vickers, S. Y. Yao, T. Lang, T. E. Tackaberry, D. A. Mowles, A. M. Ng, J. D. Young, and C. E. Cass. 2006. A comparison of the transportability, and its role in cytotoxicity, of clofarabine, cladribine, and fludarabine by recombinant human nucleoside transporters produced in three model expression systems. Mol. Pharmacol. 69:346-353.[Abstract/Free Full Text]
  58. 30
  59. Kirkegaard, K., and D. Baltimore. 1986. The mechanism of RNA recombination in poliovirus. Cell 47:433-443.[CrossRef][Medline]
  60. 31
  61. Kong, W., K. Engel, and J. Wang. 2004. Mammalian nucleoside transporters. Curr. Drug Metab. 5:63-84.[CrossRef][Medline]
  62. 32
  63. Lai, Y., C. M. Tse, and J. D. Unadkat. 2004. Mitochondrial expression of the human equilibrative nucleoside transporter 1 (hENT1) results in enhanced mitochondrial toxicity of antiviral drugs. J. Biol. Chem. 279:4490-4497.[Abstract/Free Full Text]
  64. 33
  65. Lang, T. T., J. D. Young, and C. E. Cass. 2004. Interactions of nucleoside analogs, caffeine, and nicotine with human concentrative nucleoside transporters 1 and 2 stably produced in a transport-defective human cell line. Mol. Pharmacol. 65:925-933.[Abstract/Free Full Text]
  66. 34
  67. Larrat, S., F. Stanke-Labesque, A. Plages, J. P. Zarski, G. Bessard, and C. Souvignet. 2003. Ribavirin quantification in combination treatment of chronic hepatitis C. Antimicrob. Agents Chemother. 47:124-129.[Abstract/Free Full Text]
  68. 35
  69. Lindahl, K., L. Stahle, A. Bruchfeld, and R. Schvarcz. 2005. High-dose ribavirin in combination with standard dose peginterferon for treatment of patients with chronic hepatitis C. Hepatology 41:275-279.[CrossRef][Medline]
  70. 36
  71. Lowe, J. K., L. Brox, and J. F. Henderson. 1977. Consequences of inhibition of guanine nucleotide synthesis by mycophenolic acid and virazole. Cancer Res. 37:736-743.[Abstract/Free Full Text]
  72. 37
  73. Maag, D., C. Castro, Z. Hong, and C. E. Cameron. 2001. Hepatitis C virus RNA-dependent RNA polymerase (NS5B) as a mediator of the antiviral activity of ribavirin. J. Biol. Chem. 276:46094-46098.[Abstract/Free Full Text]
  74. 38
  75. Mackey, J. R., C. M. Galmarini, K. A. Graham, A. A. Joy, A. Delmer, L. Dabbagh, D. Glubrecht, L. D. Jewell, R. Lai, T. Lang, J. Hanson, J. D. Young, H. Merle-Beral, J. L. Binet, C. E. Cass, and C. Dumontet. 2005. Quantitative analysis of nucleoside transporter and metabolism gene expression in chronic lymphocytic leukemia (CLL): identification of fludarabine-sensitive and -insensitive populations. Blood 105:767-774.[Abstract/Free Full Text]
  76. 39
  77. Mackey, J. R., L. L. Jennings, M. L. Clarke, C. L. Santos, L. Dabbagh, M. Vsianska, S. L. Koski, R. W. Coupland, S. A. Baldwin, J. D. Young, and C. E. Cass. 2002. Immunohistochemical variation of human equilibrative nucleoside transporter 1 protein in primary breast cancers. Clin. Cancer Res. 8:110-116.[Abstract/Free Full Text]
  78. 40
  79. Maes, B., V. Vanhentenrijk, I. Wlodarska, J. Cools, B. Peeters, P. Marynen, and C. de Wolf-Peeters. 2001. The NPM-ALK and the ATIC-ALK fusion genes can be detected in non-neoplastic cells. Am. J. Pathol. 158:2185-2193.[Abstract/Free Full Text]
  80. 41
  81. Mani, R. S., J. R. Hammond, J. M. Marjan, K. A. Graham, J. D. Young, S. A. Baldwin, and C. E. Cass. 1998. Demonstration of equilibrative nucleoside transporters (hENT1 and hENT2) in nuclear envelopes of cultured human choriocarcinoma (BeWo) cells by functional reconstitution in proteoliposomes. J. Biol. Chem. 273:30818-30825.[Abstract/Free Full Text]
  82. 42
  83. Molina-Arcas, M., B. Bellosillo, F. J. Casado, E. Montserrat, J. Gil, D. Colomer, and M. Pastor-Anglada. 2003. Fludarabine uptake mechanisms in B-cell chronic lymphocytic leukemia. Blood 101:2328-2334.[Abstract/Free Full Text]
  84. 43
  85. Muller, W. E., A. Maidhof, H. Taschner, and R. K. Zahn. 1977. Virazole (1-β-D-ribofuranosyl-1,2,4-triazole-3-carboxamide; a cytostatic agent. Biochem. Pharmacol. 26:1071-1075.[CrossRef][Medline]
  86. 44
  87. Ngo, L. Y., S. D. Patil, and J. D. Unadkat. 2001. Ontogenic and longitudinal activity of Na+-nucleoside transporters in the human intestine. Am. J. Physiol. Gastrointest. Liver Physiol. 280:G475-G481.[Abstract/Free Full Text]
  88. 45
  89. Patil, S. D., L. Y. Ngo, P. Glue, and J. D. Unadkat. 1998. Intestinal absorption of ribavirin is preferentially mediated by the Na+-nucleoside purine (N1) transporter. Pharm. Res. 15:950-952.[CrossRef][Medline]
  90. 46
  91. Peavy, D. L., C. N. Powers, and V. Knight. 1981. Inhibition of murine plaque-forming cell responses in vivo by ribavirin. J. Immunol. 126:861-864.[Abstract]
  92. 47
  93. Pennycooke, M., N. Chaudary, I. Shuralyova, Y. Zhang, and I. R. Coe. 2001. Differential expression of human nucleoside transporters in normal and tumor tissue. Biochem. Biophys. Res. Commun. 280:951-959.[CrossRef][Medline]
  94. 48
  95. Pfeiffer, J. K., and K. Kirkegaard. 2003. A single mutation in poliovirus RNA-dependent RNA polymerase confers resistance to mutagenic nucleotide analogs via increased fidelity. Proc. Natl. Acad. Sci. USA 100:7289-7294.[Abstract/Free Full Text]
  96. 49
  97. Pfeiffer, J. K., and K. Kirkegaard. 2005. Ribavirin resistance in hepatitis C virus replicon-containing cell lines conferred by changes in the cell line or mutations in the replicon RNA. J. Virol. 79:2346-2355.[Abstract/Free Full Text]
  98. 50
  99. Pfeiffer, J. K., R. S. Topping, N. H. Shin, and A. Telesnitsky. 1999. Altering the intracellular environment increases the frequency of tandem repeat deletion during Moloney murine leukemia virus reverse transcription. J. Virol. 73:8441-8447.[Abstract/Free Full Text]
  100. 51
  101. Pisoni, R. L., and J. G. Thoene. 1989. Detection and characterization of a nucleoside transport system in human fibroblast lysosomes. J. Biol. Chem. 264:4850-4856.[Abstract/Free Full Text]
  102. 52
  103. Racaniello, V. R., and D. Baltimore. 1981. Molecular cloning of poliovirus cDNA and determination of the complete nucleotide sequence of the viral genome. Proc. Natl. Acad. Sci. USA 78:4887-4891.[Abstract/Free Full Text]
  104. 53
  105. Ribaudo, R., M. Gilman, R. E. Kingston, P. Chomczynski, and N. Sacchi. 2007. Preparation and analysis of RNA. Curr. Protoc. Immunol. 2007:1-14.[Medline]
  106. 54
  107. Ritzel, M. W., A. M. Ng, S. Y. Yao, K. Graham, S. K. Loewen, K. M. Smith, R. G. Ritzel, D. A. Mowles, P. Carpenter, X. Z. Chen, E. Karpinski, R. J. Hyde, S. A. Baldwin, C. E. Cass, and J. D. Young. 2001. Molecular identification and characterization of novel human and mouse concentrative Na+-nucleoside cotransporter proteins (hCNT3 and mCNT3) broadly selective for purine and pyrimidine nucleosides (system cib). J. Biol. Chem. 276:2914-2927.[Abstract/Free Full Text]
  108. 55
  109. Robillard, K. R., D. B. Bone, and J. R. Hammond. 2008. Hypoxanthine uptake and release by equilibrative nucleoside transporter 2 (ENT2) of rat microvascular endothelial cells. Microvasc. Res. 75:351-357.[CrossRef][Medline]
  110. 56
  111. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Bioinform. Methods Protoc. 132:365-386.
  112. 57
  113. Sarrazin, C., U. Mihm, E. Herrmann, C. Welsch, M. Albrecht, U. Sarrazin, S. Traver, T. Lengauer, and S. Zeuzem. 2005. Clinical significance of in vitro replication-enhancing mutations of the hepatitis C virus (HCV) replicon in patients with chronic HCV infection. J. Infect. Dis. 192:1710-1719.[CrossRef][Medline]
  114. 58
  115. Sintchak, M. D., and E. Nimmesgern. 2000. The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors. Immunopharmacology 47:163-184.[CrossRef][Medline]
  116. 59
  117. Takagaki, K., S. Katsuma, Y. Kaminishi, T. Horio, S. Nakagawa, T. Tanaka, T. Ohgi, and J. Yano. 2004. Gene-expression profiling reveals down-regulation of equilibrative nucleoside transporter 1 (ENT1) in Ara-C-resistant CCRF-CEM-derived cells. J. Biochem. (Tokyo) 136:733-740.[Abstract/Free Full Text]
  118. 60
  119. Tam, R. C., B. Pai, J. Bard, C. Lim, D. R. Averett, U. T. Phan, and T. Milovanovic. 1999. Ribavirin polarizes human T cell responses towards a type 1 cytokine profile. J. Hepatol. 30:376-382.[CrossRef][Medline]
  120. 61
  121. Toan, S. V., K. K. To, G. P. Leung, M. O. de Souza, J. L. Ward, and C. M. Tse. 2003. Genomic organization and functional characterization of the human concentrative nucleoside transporter-3 isoform (hCNT3) expressed in mammalian cells. Pflugers Arch. 447:195-204.[CrossRef][Medline]
  122. 62
  123. Vignuzzi, M., J. K. Stone, and R. Andino. 2005. Ribavirin and lethal mutagenesis of poliovirus: molecular mechanisms, resistance and biological implications. Virus Res. 107:173-181.[CrossRef][Medline]
  124. 63
  125. Vo, N. V., K. C. Young, and M. M. Lai. 2003. Mutagenic and inhibitory effects of ribavirin on hepatitis C virus RNA polymerase. Biochemistry 42:10462-10471.[CrossRef][Medline]
  126. 64
  127. Ward, J. L., A. Sherali, Z. P. Mo, and C. M. Tse. 2000. Kinetic and pharmacological properties of cloned human equilibrative nucleoside transporters, ENT1 and ENT2, stably expressed in nucleoside transporter-deficient PK15 cells: ENT2 exhibits a low affinity for guanosine and cytidine but a high affinity for inosine. J. Biol. Chem. 275:8375-8381.[Abstract/Free Full Text]
  128. 65
  129. Wohnsland, A., W. P. Hofmann, and C. Sarrazin. 2007. Viral determinants of resistance to treatment in patients with hepatitis C. Clin. Microbiol. Rev. 20:23-38.[Abstract/Free Full Text]
  130. 66
  131. Yamamoto, T., K. Kuniki, Y. Takekuma, T. Hirano, K. Iseki, and M. Sugawara. 2007. Ribavirin uptake by cultured human choriocarcinoma (BeWo) cells and Xenopus laevis oocytes expressing recombinant plasma membrane human nucleoside transporters. Eur. J. Pharmacol. 557:1-8.[CrossRef][Medline]
  132. 67
  133. Yao, S. Y., A. M. Ng, W. R. Muzyka, M. Griffiths, C. E. Cass, S. A. Baldwin, and J. D. Young. 1997. Molecular cloning and functional characterization of nitrobenzylthioinosine (NBMPR)-sensitive (es) and NBMPR-insensitive (ei) equilibrative nucleoside transporter proteins (rENT1 and rENT2) from rat tissues. J. Biol. Chem. 272:28423-28430.[Abstract/Free Full Text]
  134. 68
  135. Yao, S. Y., A. M. Ng, M. F. Vickers, M. Sundaram, C. E. Cass, S. A. Baldwin, and J. D. Young. 2002. Functional and molecular characterization of nucleobase transport by recombinant human and rat equilibrative nucleoside transporters 1 and 2: chimeric constructs reveal a role for the ENT2 helix 5-6 region in nucleobase translocation. J. Biol. Chem. 277:24938-24948.[Abstract/Free Full Text]
  136. 69
  137. Young, J. D., S. Y. Yao, L. Sun, C. E. Cass, and S. A. Baldwin. 2008. Human equilibrative nucleoside transporter (ENT) family of nucleoside and nucleobase transporter proteins. Xenobiotica 38:995-1021.[CrossRef][Medline]
  138. 70
  139. Zhang, J., F. Visser, K. M. King, S. A. Baldwin, J. D. Young, and C. E. Cass. 2007. The role of nucleoside transporters in cancer chemotherapy with nucleoside drugs. Cancer Metastasis Rev. 26:85-110.[CrossRef][Medline]
  140. 71
  141. Zhou, S., R. Liu, B. M. Baroudy, B. A. Malcolm, and G. R. Reyes. 2003. The effect of ribavirin and IMPDH inhibitors on hepatitis C virus subgenomic replicon RNA. Virology 310:333-342.[Medline]


Journal of Virology, May 2009, p. 4538-4547, Vol. 83, No. 9
0022-538X/09/$08.00+0     doi:10.1128/JVI.02280-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ibarra, K. D.
Right arrow Articles by Pfeiffer, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ibarra, K. D.
Right arrow Articles by Pfeiffer, J. K.