Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Moore, M. L. Articles by Peebles, R. S. Search for Related Content PubMed PubMed Citation Articles by Moore, M. L. Articles by Peebles, R. S., Jr.

 Previous Article  |  Next Article 

Journal of Virology, May 2009, p. 4185-4194, Vol. 83, No. 9
0022-538X/09/$08.00+0     doi:10.1128/JVI.01853-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

A Chimeric A2 Strain of Respiratory Syncytial Virus (RSV) with the Fusion Protein of RSV Strain Line 19 Exhibits Enhanced Viral Load, Mucus, and Airway Dysfunction

Martin L. Moore,^1* Michael H. Chi,¹ Cindy Luongo,² Nicholas W. Lukacs,³ Vasiliy V. Polosukhin,¹ Matthew M. Huckabee,¹ Dawn C. Newcomb,¹ Ursula J. Buchholz,² James E. Crowe Jr.,^4,5 Kasia Goleniewska,¹ John V. Williams,⁴ Peter L. Collins,² and R. Stokes Peebles Jr.^1*

Departments of Medicine,¹ Pediatrics,⁴ Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232,⁵ Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Disease, Bethesda, Maryland 20892,² Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan 48109³

Received 3 September 2008/ Accepted 28 January 2009

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Respiratory syncytial virus (RSV) is the leading cause of respiratory failure and viral death in infants. Abundant airway mucus contributes to airway obstruction in RSV disease. Interleukin-13 (IL-13) is a mediator of pulmonary mucus secretion. It has been shown that infection of BALB/c mice with the RSV line 19 strain but not with the RSV A2 laboratory strain results in lung IL-13 and mucus expression. Here, we sequenced the RSV line 19 genome and compared it to the commonly used A2 and Long strains. There were six amino acid differences between the line 19 strain and both the A2 and Long RSV strains, five of which are in the fusion (F) protein. The Long strain, like the A2 strain, did not induce lung IL-13 and mucus expression in BALB/c mice. We hypothesized that the F protein of RSV line 19 is more mucogenic than the F proteins of A2 and Long. We generated recombinant, F-chimeric RSVs by replacing the F gene of A2 with the F gene of either line 19 or Long. Infection of BALB/c mice with RSV rA2 line 19F resulted in lower alpha interferon lung levels 24 h postinfection, higher lung viral load, higher lung IL-13 levels, greater airway mucin expression levels, and greater airway hyperresponsiveness than infection with rA2-A2F or rA2-LongF. We identified the F protein of RSV line 19 as a factor that plays a role in pulmonary mucin expression in the setting of RSV infection.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis and viral pneumonia in infants. RSV is the most frequent cause of infant viral death worldwide. A hallmark of RSV disease is abundant mucus production (1, 28). Mucus contributes to airway constriction, airway hyperresponsiveness (AHR), air trapping, hypoxia, and partial lung collapse in RSV disease (1, 28, 35, 43). In RSV bronchiolitis, dense plugs consisting of mucus, necrotic epithelial cell debris, and mononuclear cells obstruct the airways (1, 28). The T_H2 cytokine interleukin-13 (IL-13) is a mediator of pulmonary mucus secretion (24, 59, 61). IL-13-expressing RSV-specific T cells are found in RSV bronchiolitis (15). However, mechanisms by which RSV infection induces IL-13 and mucus expression are not known.

We reported that primary infection of BALB/cJ mice with the RSV line 19 strain, but not with the A2 strain of RSV, results in lung IL-13 and mucus expression (29). RSV strain line 19-induced mucus expression and AHR are IL-13 dependent (29, 54). Thus, RSV strain line 19 provides a novel, convenient model for investigating mechanisms of RSV-induced mucus production/airway dysfunction. RSV strain differences may contribute to variable immunologic phenotypes observed in RSV disease in humans (56), as well as regional or season-to-season variations in RSV disease severity because dominant strains in annual RSV epidemics are generally replaced every year (8, 38, 39).

In order to investigate mechanisms by which RSV infection causes mucus production, we sought to identify the region(s) of the RSV line 19 genome responsible for augmented mucus induction. Using an RSV reverse genetics system, we identified the fusion (F) gene of line 19 as a mucogenic virulence factor. Furthermore, our mapping studies identified five candidate key amino acids in the F protein that play direct or indirect roles in modulation of the early alpha interferon (IFN-) response, enhanced viral replication, and pulmonary mucus expression in RSV infection.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cells, viruses, and mice. HEp-2 cells were obtained from the ATCC. Vero (WHO) cells were a gift from Wyeth Lederle Vaccine Programs (Pearl River, NY). The A2 and Long strains of RSV were provided by Barney Graham (NIH, Bethesda, MD) and maintained at Vanderbilt University by passage in HEp-2 cells. The line 19 RSV strain was originally isolated at the University of Michigan and maintained by passage in HEp-2 cells (23, 29). A2, line 19, and Long are antigenic subgroup A RSV strains. Viral stocks were propagated and titrated by plaque assay in HEp-2 cells as described previously (19). Female, 6- to 8-week-old BALB/cJ mice were obtained from Jackson Laboratories. All mice were maintained under specific-pathogen-free conditions. Mice were anesthetized by intramuscular injection of a ketamine-xylazine solution and infected intranasally with 10⁵ PFU of RSV in 100 µl Dulbecco modified Eagle medium (DMEM) or with mock-infected cell culture supernatant as described previously (19).

Sequencing the RSV line 19 genome. Viral RNA was isolated from unpurified virus particles from medium overlaying virus-infected HEp-2 cells using the QIAamp viral RNA minikit (Qiagen Inc. USA, Valencia, CA). Reverse transcription (RT) was performed with Superscript II (Invitrogen Corp., Carlsbad, CA) according to the manufacturer's protocol using five primers designed from the sequence of strain A2 (GenBank accession number M74568) complementary to and evenly spaced along the negative-sense RNA genome. The RT products were amplified into overlapping 3.2- to 3.5-kb segments by PCR using Platinum Pfx polymerase (Invitrogen Corp.). After 30 cycles of amplification, primers and proteins were removed using the QIAquick PCR purification kit (Qiagen, Inc.). The PCR products were subjected to cycle sequencing with BigDye terminators (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. Between six and eight primers were needed to sequence each of the five PCR products. Unincorporated reagents were removed using the Performa Ultra 96-well plate (Edge Biosystems, Gaithersburg, MD), and the products were analyzed using a 3730 DNA analyzer (Applied Biosystems), inspected, and compiled using VectorNTI 7 software. Primers used for RT and PCR overlapped the first 29 and last 31 nucleotides (nt) of the genome, and hence, these residues were not directly confirmed.

Generation and recovery of chimeric RSVs. RNA was isolated from HEp-2 cells infected with RSV strain A2, line 19, or Long. cDNA was reverse transcribed using primer F-r (TGAAATTCGAGGTCATTGCTT). The F genes were PCR amplified using primers F-f (CAAAATAAACTCTGGGGCAAA) and F-r. PCRs were gel purified and then sequenced. The A2, line 19, and Long F-gene sequences were confirmed from RNA isolated from three separate infections. The F genes were then PCR amplified from cDNA using forward primer FStuI (AGGAATTCAGGCCTTGACCAACTCAAACAGAATC) and reverse primer FSphI (AGGAATTCGCATGCAATTGTGTTTTATATAACTATAAAC) which incorporated StuI and SphI restriction sites (bold type) into the G-F intergenic region and F-M2 intergenic region, respectively, and added flanking EcoRI sites (italic type). The StuI and SphI sites were previously engineered into the antigenomic A2 cDNA (12). The F genes were cloned into the EcoRI site of pGEM-9Zf (Promega). Sequence analyses were performed with VectorNTI software (Invitrogen Corp.).

pLG338-30, a low-copy-number cloning vector, was modified by ablating StuI and SphI sites to create pLG4 (14). D46/6120 is a modified version of the A2 antigenomic cDNA plasmid D46 (12) in which most (112 nt total) of the 3' noncoding region of the SH gene has been deleted, rendering D46/6120 more stable in Escherichia coli than parental D46 (7). The XhoI/BamHI fragment (containing the G and F genes and partial M2 gene of RSV) of D46/6120 was subcloned into pLG4. The use of this low-copy-number vector was essential because the XhoI/BamHI fragment of D46/6120 was not stable in pUC-based vectors during propagation in E. coli even at low temperature (30°C) and reduced aeration (data not shown). The F gene of D46/6120 (rA2) was replaced with the F gene of either RSV A2, line 19, or Long strain using the above-mentioned flanking StuI and SphI sites. The resulting XhoI/BamHI fragments were cloned into D46/6120 to generate the full-length antigenomic plasmids rA2-A2F, rA2-line19F, and rA2-LongF. The sequences of the F genes in these plasmids were confirmed.

Confluent BSR-T7/5 cells, which constitutively express T7 polymerase, were transfected with 5 µg of antigenomic plasmid (rA2-A2F, rA2-line19F, or rA2-LongF) and four support plasmids (2 µg pN, 2 µg pP, 1 µg pM21, and 1 µg pL) which express RSV N, P, M21, and L proteins under the control of the T7 promoter (5, 6, 12). Transfections were performed using Lipofectamine 2000 (Invitrogen) in Opti-MEM. Transfections were rocked at room temperature for 2 h and then incubated at 33°C and 5% CO₂ for 3 h or overnight. Supernatants were replaced with Glasgow's minimal essential medium supplemented with 3% fetal bovine serum (FBS), 200 mM Glu, and nonessential amino acids. Transfected cells were passaged 1:3 4 days later and then passaged 1:3 every 5 days until syncytia were observed, at which point the BSR-T7/5 cells were scraped in the medium, snap-frozen, thawed, and used to infect HEp-2 cells. When maximal cytopathic effect was observed in HEp-2 cells, serial dilutions of clarified supernatants were used to infect fresh HEp-2 cells, the cells were overlaid with agarose/media, and plaques were picked. Plaques were amplified in HEp-2 cells to generate viral stocks. The F genes were PCR amplified as described above from the recovered virus stocks (rA2-A2F, rA2-line19F, and rA2-LongF), and the F gene sequences were confirmed.

Multistep virus growth curves. Subconfluent HEp-2 cells in six-well dishes were infected in triplicate with RSV strain A2, line 19, Long, rA2-A2f, rA2-line19F, or rA2-LongF at a multiplicity of infection of 0.5 in 750 µl. After 1 h of adsorption at room temperature on a rocking platform, the cells were washed with medium (DMEM containing 10% FBS), and medium was added. Supernatants were harvested from each well after 24 h, 48 h, 72 h, and 96 h and clarified by centrifugation, and RSV was titrated in duplicate by plaque assay on HEp-2 cells as described previously (19).

Quantitation of lung viral load. Lungs were harvested from BALB/cJ mice infected with 10⁵ PFU of RSV. Lungs were individually ground in 2 ml minimal essential medium with precooled mortars and pestles and sterile ground glass. Glass and tissue debris were removed from lung homogenates by centrifugation (15 min, 1,000 x g). Lung homogenates were immediately serially diluted and used to inoculate subconfluent Vero (WHO) cells in 12-well dishes. After 1 h of adsorption at room temperature on a rocking platform, the cells were overlaid with DMEM containing 10% FBS and 0.75% methylcellulose. After 5 days, the cells were fixed with formalin and stained with hematoxylin and eosin (H&E) as described previously (19). We used Vero (WHO) cells in the plaque assays because they yielded RSV A2 strain PFU titers that were approximately 1 log unit higher than those of HEp-2 cells (data not shown).

Quantitation of RSV RNA in vivo. Total RNA was isolated from lung homogenates described above using TRIzol (Invitrogen) according to the manufacturer's instructions. One-step quantitative real-time RT-PCR (qRT-PCR) was performed to measure levels of RSV F (sense) using primers RS-F1 and RS-F2 and probe RS-F3 as described previously (32). The levels of RSV RNA were normalized to mouse beta-actin mRNA levels (Applied Biosystems TaqMan primer Mm00607939_S1) determined by qRT-PCR simultaneously. PCRs were performed using arrayed SmartCyclers (Cepheid, Sunnyvale, CA). The data are presented as the difference compared to one day 8 A2 infection sample using the comparative threshold cycle method (C_T) described previously (29).

IFN- ELISA. The lungs were homogenized as described above. IFN- was quantified using a sandwich mouse interferon enzyme-linked immunosorbent assay (ELISA) with horseradish peroxidase-conjugated secondary antibody according to the manufacturer's instructions (PBL Biomedical Laboratories, Piscataway, NJ). Samples were assayed in duplicate. Concentrations were determined using a standard curve obtained from serial dilutions of the mouse IFN- standard provided.

IL-13 ELISA and gob-5 Western blot. The lungs were removed and snap-frozen in liquid nitrogen. The lungs were homogenized with a tissue tearer (Biospec, Racine, WI) in 1 ml of modified radioimmunoprecipitation assay buffer (120 mM NaCl, 50 mM Tris-HCl [pH 8.0], 1% Triton X-100, 0.1% sodium dodecyl sulfate, 1% deoxycholate, 10 mM dithiothreitol, 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 1% protease inhibitor cocktail [P8340; Sigma]). Homogenates were clarified by centrifugation at 2,000 x g. IL-13 levels were measured in lung homogenates using an ELISA kit (Quantikine; R&D Systems, Minneapolis, MN). Western blotting for gob-5 and actin in lung homogenates was performed as described previously (21, 22).

Histopathology. Heart-lung blocks were harvested 8 days postinfection (p.i.) and fixed in 4% paraformaldehyde overnight. The lungs were transferred to 70% ethanol and then embedded in paraffin blocks. Tissue sections (5 µm) were stained with H&E to assess histologic changes and periodic acid-Schiff (PAS) to assess goblet cell hyperplasia as a measure of mucin expression. Slides were examined and scored by a single pathologist who was blinded to the experimental groups. For mucin expression, individual airways (bronchi/bronchioles) were scored for goblet cell hyperplasia according to the following scale: 0, no PAS-positive cells; 1, <5% PAS-positive cells; 2, 5 to 10% PAS-positive cells; 3, 10 to 25% PAS-positive cells; and 4, > 25% PAS-positive cells. All airways involved in the tissue sections were scored (15 to 40 airways per mouse).

Methacholine challenge. We measured AHR 9 days p.i. (29). The mouse to be tested was anesthetized with pentobarbital (8.5 mg/kg of body weight) given intraperitoneally. The trachea was cannulated with a 20-gauge metal stub adapter. The animal was placed on a small animal ventilator, flexiVent (SCIREQ, Montreal, Canada) with 150 breaths/min and a tidal volume of 10 ml/kg body weight. Airway responsiveness was assessed by administering incremental concentrations of aerosolized methacholine (0, 30, 60, and 100 mg/ml in saline) via an in-line ultranebulizer (Aeroneb; SCIREQ, Montreal, Canada). The SCIREQ software calculates the resistance by dividing the change in pressure by the change in flow (units = centimeter of H₂O/milliliter/second).

Statistical analyses. Unless otherwise indicated, groups were compared by one-way analysis of variance (ANOVA) and Tukey multiple comparison tests (P < 0.05). Where indicated, we used the Bonferroni posttest in order to calculate P values. Values below the limit of detection were assigned a value of half the limit of detection, as shown in the figures.

Nucleotide sequence accession numbers. The nucleotide sequence data for RSV strain line 19 genome was submitted to GenBank under accession number FJ614813. Nucleotide sequence data for the F genes of RSV strains A2 and Long from this study were submitted to GenBank under accession numbers FJ614814 and FJ614815, respectively.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The line 19 RSV strain genome sequence is similar to the Long RSV strain genome sequence. In order to facilitate mapping the region(s) of line 19 responsible for pulmonary IL-13 production and mucus induction, we sequenced the line 19 genome. Direct sequence analysis of uncloned, overlapping RT-PCR products generated a 15,191-nt consensus sequence (GenBank accession number FJ614813). This sequence lacked confirmation of the first 29 nt of the 3' leader region and the last 31 nt of the 5' trailer region, as those sequences represented primer-binding sites. The line 19 genome was compared to the reference A2 (15,222 nt; GenBank accession number M74568) and Long (15,226 nt; GenBank accession number AY911262) genomes. The line 19 genome sequence is similar to the Long strain genome sequence, as there are only 16 nucleotide differences between them (Table 1). Of those 16 nucleotide differences, 10 result in amino acid differences within the predicted RSV proteins, 2 are within non-protein-coding regions of genes, 2 are single U insertions in gene end regions, and two are within protein-coding regions but are silent (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. RSV Long and line 19 genome comparisona

Of the 10 nonsynonymous nucleotide differences that result in single amino acid differences in the line 19 and Long strains, 6 remained unique to line 19 compared in addition to the A2 strain (Table 1). For example, the difference in the G genes of line 19 and Long strain (4771 C/A) (Table 1) results in Cys at residue 29 in line 19 and Gly in 29G in Long; however, residue 29G is also Cys in the A2 strain and thus is not unique to the mucogenic line 19 strain. Most coding differences between line 19 and Long are in the F gene (Table 1). The RSV A2, line 19, and Long strain F sequences from this study were compared to each other in an amino acid alignment (Table 2). We determined that amino acids unique to line 19 compared to the Long and A2 strains are 17NS1, 79F, 191F, 357F, 371F, and 557F (Tables 1 and 2).

View this table: [in this window] [in a new window]

TABLE 2. RSV A2, Long, and line 19 F-protein sequence comparisona

Line 19 RSV strain induces IL-13 and mucus production, whereas the Long strain does not. We compared the ability of RSV strains A2, line 19, and Long to induce production of IL-13 and mucus in the lungs of BALB/cJ mice. Mice were mock infected or infected with these RSV strains, and the lungs were harvested 8 days p.i. This time point represents the peak of IL-13 expression induced by RSV line 19 and the peak of lung inflammation induced by line 19 and A2 strain (29, 54). In contrast to infections with the A2 and Long strains, line 19 infection resulted in significant lung IL-13 expression (Fig. 1). We did not detect IL-4 or IL-5 in lung homogenates from mice infected with any RSV strain (data not shown). The lungs were harvested 8 days p.i. from BALB/cJ mice that were mock infected or infected with A2, line 19, or Long, and lung sections were stained with PAS to quantify airway mucin expression utilizing a morphometric scale (Materials and Methods) (Fig. 2A and B). Line 19 infection resulted in high levels (score of 3 or 4) of airway mucin expression, and the A2 and Long strains did not induce high-level mucin expression compared to mock infection (Fig. 2C). There was no difference in lymphocytic lung inflammation (H&E stains) induced by A2, line 19, or Long (not shown), consistent with published data comparing A2 and line 19 (29).

View larger version (12K): [in this window] [in a new window]

FIG. 1. Lung IL-13 levels in mice infected with RSV strains A2, line 19, and Long. BALB/cJ mice were mock infected or infected with 105 PFU of A2, line 19, or Long RSV (five mice per group). The lungs were harvested 8 days p.i., and IL-13 was quantified by an ELISA. Each symbol represents an individual mouse. The horizontal dotted line depicts the limit of detection. The short horizontal lines show the means for the different groups. *, P < 0.05 comparing line 19 to mock, A2, or Long (ANOVA). Results are representative of three experiments.

View larger version (55K): [in this window] [in a new window]

FIG. 2. Pulmonary mucin expression induced by RSV strains A2, line 19, and Long. BALB/cJ mice were mock infected or infected with 105 PFU of A2, line 19, or Long RSV. The lungs were harvested 8 days p.i., and sections were stained with PAS. Airways were scored 0 to 4 for PAS positivity (Materials and Methods). Fifteen to 40 airways were scored per mouse. The results of two experiments combined are shown. (A) Examples of airway mucin scores. Bright pink PAS-positive cells are indicated by black arrows. (B) Total numbers of mice and airways scored for each group. The pie charts show the percentage of total airways in each group receiving each mucin score. (C) Percentage of airways with a score of 3 or 4. Each symbol represents one mouse. The mean and standard error of the mean (error bar) are indicated. *, P < 0.05 (ANOVA) comparing line 19 to mock, A2, or Long.

We previously measured gob-5 protein expression as a marker of pulmonary mucus and showed that line 19 induces gob-5 expression in the airways of mice, whereas the A2 strain does not (21, 22, 29). Here, we quantified gob-5 levels 8 days p.i. in BALB/cJ mice that were mock infected or infected with line 19 or Long strain. Line 19 strain infection increased lung gob-5 levels, whereas Long strain infection did not (Fig. 3). Together, these data show that RSV strain line 19 induced lung IL-13 expression, high levels of airway mucin expression, and lung gob-5 expression, whereas the Long strain did not.

View larger version (49K): [in this window] [in a new window]

FIG. 3. BALB/cJ mice were mock infected or infected with 105 PFU of RSV line 19 or Long strain. The lungs were harvested 8 days p.i. The left lungs were processed for gob-5 Western blotting. Each lane contains 100 µg of lung homogenate protein from one mouse. The positive control (+ control) is lung homogenate pooled from RSV-infected STAT1-deficient mice which exhibit increased mucus expression compared to BALB/c mice (21). The membrane was probed with anti-gob-5, then stripped, and reprobed with anti-actin as a loading control.

Chimeric A2 RSV strain with F-gene substitutions from line 19 or Long strain. As most of the coding differences between RSV strains line 19 and Long are in the F gene and line 19 is more mucogenic in BALB/cJ mice than the Long strain is, we hypothesized that the line 19 F gene plays a role in RSV infection-induced pulmonary mucus production. In order to test the hypothesis, we generated recombinant, chimeric A2 strain RSVs that express either the F gene of A2, line 19, or Long strain (rA2-A2F, rA2-line19F, and rA2-LongF). We compared the in vitro growth of the chimeric and parental RSV strains in HEp-2 cells. The Long and rA2-LongF viruses grew to higher titers in vitro than the other RSV strains (Fig. 4A). Overall, the F-chimeric viruses grew to titers similar to those of the parental virus from which the F gene was derived (Fig. 4A).

View larger version (18K): [in this window] [in a new window]

FIG. 4. In vitro growth and in vivo viral load of F-chimeric RSV strains. (A) Infectious yield in supernatants of HEp-2 cells infected at a multiplicity of infection (MOI) of 0.5 with RSV A2, line 19, Long, rA2-A2F, rA2-line19F, and rA2-LongF. Virus titers from cells infected with Long and rA2-LongF were greater than those from cells infected with other viruses (P < 0.05 by ANOVA) as indicated by the asterisks. Error bars represent standard errors of the means for three separate infections. (B) BALB/cJ mice were infected with 105 PFU of rA2-A2F, rA2-line19F, or rA2-LongF (four mice per group). The lungs were harvested at the indicated days p.i., and infectious RSV was titrated by plaque assay. Values for the rA2-line19F-infected group were significantly different (P < 0.05 by ANOVA) from the values for the rA2-A2F- or rA2-LongF-infected group as indicated by the asterisk. Values for the rA2-line19F-infected group were significantly different (P < 0.05 by ANOVA) from the values for the rA2-LongF-infected group as indicated by the dagger symbol. The dotted line represents the limit of detection. Data from two experiments are shown (n = 8 per data point). (C) BALB/cJ mice were infected with 105 PFU of A2, line 19, Long, rA2-A2F, rA2-line19F, or rA2-LongF (five mice per group). The lungs were harvested 4 days p.i., and RSV RNA levels were quantified by qRT-PCR using RSV F-specific primers. Each symbol represents one mouse. Short horizontal lines show the means and standard errors of the means. P < 0.05 by ANOVA, as indicated by an asterisk above a bracket. NS, not significantly different (P > 0.05 by ANOVA).

F protein of line 19 RSV enhances rA2 RSV viral load in vivo. We measured viral load over a time course (day 2, 4, 6, and 8 p.i.) in the lungs of BALB/cJ mice infected with 10⁵ PFU of rA2-A2F, rA2-line19F, or rA2-LongF. The rA2-line19F lung viral load was 2 log units higher than the rA2-A2F and rA2-LongF lung viral loads at 4 days p.i. (Fig. 4B). The rA2-A2F virus had measurable viral titers at 6 days p.i., whereas there was no detectable infectious rA2-LongF at any time point (Fig. 4B). It is likely that these titers of rA2-A2F are lower than the typical titers reported for A2 RSV in BALB/c mice because we used a relatively low infecting dose (10⁵ PFU) in this study. We also compared virus levels of the F-chimeric RSVs with the parental A2, line 19, and Long strains. We used qRT-PCR as a surrogate of viral load because the plaque titers of rA2-A2F and rA2-LongF were at/near the limit of detection (Fig. 4B). Consistent with the plaque assay data, rA2-line19F infection resulted in higher RSV RNA (F mRNA and antigenomic RNA) levels 4 days p.i. than rA2-A2F and rA2-LongF infection did (Fig. 4C). The levels of rA2-line19F were significantly higher than the levels of the other RSV strains (Fig. 4C). Line 19 levels were slightly but not significantly higher than A2 and Long levels (Fig. 4C). Taken together, these data show that the line 19 F protein increased rA2 viral load in the lungs of BALB/cJ mice. Furthermore, line 19 F residues 79F, 191F, 357F, 371F, and/or 557F were implicated with increased viral load in rA2 infection compared to the Long F protein.

rA2-line19F elicits lower type I IFN levels than rA2-A2F and rA2-LongF. Interferon signaling limits RSV viral load in mice (21). As the line 19 F protein enhanced viral replication in vivo, we hypothesized that the RSV line 19 F protein modulates the type I IFN response. A2 strain RSV infection induces high levels of IFN- in the lungs of BALB/c mice 24 h p.i., and then IFN- levels rapidly decline (25). We quantified IFN- in the lungs of RSV-infected mice 24 h p.i. The lungs of line 19 RSV strain-infected mice had significantly lower levels of IFN- than the lungs of mice infected with either A2 or Long strain (Fig. 5A). Similar to the parental A2, line 19, and Long RSV strains, infection with rA2-line19F resulted in lower levels of IFN- than infection with either rA2-A2F or rA2-LongF RSV strains did (Fig. 5B). We also measured IFN- 48 h p.i. in the lungs of mice infected with rA2-A2F, rA2-LongF, or rA2-line19F RSV strain. The levels were at/near the limit of detection of the ELISA in all the groups (data not shown). The data show that infection with RSV line 19 results in lower IFN- levels in vivo 24 h p.i. compared to infection with A2 and Long.

View larger version (17K): [in this window] [in a new window]

FIG. 5. Lung IFN- levels 24 h p.i. (A) BALB/cJ mice were mock infected or infected with 105 PFU of RSV strain A2, line 19, or Long (five mice per group). The lungs were harvested 24 h p.i., and the levels of IFN- (in picograms per milliliter) were quantified by an ELISA. (B) BALB/cJ mice were mock infected or infected with 105 PFU of rA2-A2, rA2-line19F, or rA2-LongF (five mice per group). The lungs were harvested 24 h p.i., and IFN- was quantified by an ELISA. Each symbol represents an individual mouse. The horizontal dotted line depicts the limit of detection. The short horizontal lines show the means and standard errors of the means. P values were calculated using ANOVA and Bonferroni posttest. Values that were significantly different (P < 0.05 by ANOVA using Tukey posttest) are indicated by an asterisk above the bracket.

rA2-line19F RSV induces pulmonary IL-13 and mucus production and AHR. We tested the hypothesis that the RSV line 19 F gene contributes to pulmonary IL-13 and mucin expression in vivo. BALB/cJ mice were mock infected or infected with rA2-A2F, rA2-line19F, or rA2-LongF, and the lungs were harvested 8 days p.i. rA2-line19F infection resulted in lung IL-13 protein levels that were significantly greater than those caused by rA2-A2F, rA2-LongF, or mock infection (Fig. 6). We assessed airway mucin expression 8 days p.i. in mice that were mock infected or infected with rA2-A2F, rA2-line19F, or rA2-LongF (Fig. 7A). rA2-line19F infection induced high levels of airway mucin expression, whereas rA2-A2F, rA2-LongF, and mock infection did not (Fig. 7B). There was no difference between airway mucin levels induced by parental line 19 and rA2-line19F (compare Fig. 2C and 7B). We quantified lung gob-5 level in mice infected with A2, line 19, Long, rA2-A2F, rA2-line19F, and rA2-Long F. The line 19 and rA2-line19F RSV strain induced equivalent and high lung gob-5 levels (Fig. 8). Thus, the F gene of line 19 is sufficient for augmented airway mucin expression induced by this RSV strain.

View larger version (16K): [in this window] [in a new window]

FIG. 6. Lung IL-13 levels in mice infected with rA2-A2, rA2-line19F, or rA2-LongF. BALB/cJ mice were mock infected or infected with 105 PFU of rA2-A2, rA2-line19F, or rA2-LongF (four or five mice per group). The lungs were harvested 8 days p.i., and the level of IL-13 (in picograms per milliliter) was quantified by an ELISA. Each symbol represents an individual mouse. The horizontal dotted line depicts the limit of detection. The short horizontal lines show the means of the different groups. Values for the rA2-line19F-infected group were significantly different (P < 0.05 by ANOVA) from values for the mock-infected and rA2-A2F- and rA2-LongF-infected groups. Results of three experiments combined are shown.

View larger version (28K): [in this window] [in a new window]

FIG. 7. Pulmonary mucin expression induced by rA2-A2, rA2-line19F, or rA2-LongF. BALB/cJ mice were mock infected or infected with 105 PFU of rA2-A2, rA2-line19F, or rA2-LongF (four or five mice per group). The lungs were harvested 8 days p.i., and sections were stained with PAS. Individual airways were scored 0 to 4 for PAS positivity. Results of two experiments are shown. (A) Total numbers of mice and airways scored for each group. The pie charts show the percentage of airways receiving each mucin score (0 to 4). (B) Percentage of airways with a score of 3 or 4. Each symbol represents one mouse. The means and standard errors of the means are indicated by short horizontal lines. Values for the rA2-line19F-infected group were significantly different (P < 0.05 by ANOVA) from values for the mock-infected and rA2-A2F- or rA2-LongF-infected groups.

View larger version (54K): [in this window] [in a new window]

FIG. 8. BALB/cJ mice were infected with 105 PFU of A2, line 19, Long, rA2-A2F, rA2-line19F, or 19 or rA-LongF (five mice per group). The lungs were harvested 8 days p.i and processed for gob-5 Western blotting. Each lane contains 100 µg of lung homogenate protein total pooled from five mice. The membrane was probed with anti-gob-5, then stripped, and reprobed with anti-actin as a loading control.

The most important sequela of RSV infection is airway dysfunction. We tested whether RSV line 19F contributes to RSV-induced AHR using methacholine-induced airway constriction (21, 29, 37). Infection of BALB/cJ mice with rA2-line19F resulted in significant AHR (Fig. 9). In contrast, infection with rA2-A2F or rA2-LongF did not increase lung resistance greater than mock infection did (Fig. 9). Some mice infected with rA2-line19F died with higher doses of methacholine. Thus, only the 30-mg/ml dose is shown. The mean level of resistance with rA2-line19F infection was 9.9 cm H₂O /ml/s, consistent with published AHR data on infection of BALB/c mice with 10⁵ PFU of line 19 (29).

View larger version (22K): [in this window] [in a new window]

FIG. 9. BALB/cJ mice were mock infected or infected with 105 PFU of rA2-A2, rA2-line19F, or rA2-LongF (five mice per group). AHR was measured 9 days p.i. Results of two experiments are shown (n = 10 per data point). The means ± standard errors of the means (error bars) are shown. Values for the rA2-line19F-infected group were significantly different (P < 0.05 by ANOVA) from values for the mock-, rA2-A2F-, and rA2-LongF-infected groups at a 30-mg/ml methacholine dose as indicated by the asterisk. The values for the 30-mg/ml methacholines were significantly different (P < 0.05 by ANOVA) from the value for the baseline 0-mg/ml methacholine dose as indicated by the dagger symbol.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
We determined that the F protein of RSV plays a role in viral strain-dependent increased airway mucin expression and airway dysfunction. Using a virus rescue system, we replaced the F gene of the nonmucogenic A2 strain of RSV with the F gene of the mucogenic line 19 RSV strain or the F gene of the nonmucogenic Long strain. Infection of BALB/cJ mice with rA2-line19F resulted in higher levels of pulmonary IL-13 production, mucus expression, and AHR than infection with rA2-A2F or rA2-LongF RSV strain. There are six nucleotide differences between the F genes of RSV line 19 and Long strain, and these result in six amino acid differences (positions 79F, 191F, 357F, 371F, 515F, and 557F). However, the 515N residue of line 19 (mucogenic) is also present in strain A2 (nonmucogenic) and thus is not unique to line 19. These data indicate that one or more of the five residues 79F, 191F, 357F, 371F, and/or 557F are involved in the mechanism of RSV-induced mucus production. These residues do not lie directly in described glycosylation sites, proteolytic sites, epitopes, or heparin-binding domains that mediate infectivity (3, 9, 13, 18). Further studies could define precisely the molecular basis of RSV-induced IL-13 and mucus production, which in turn may lead to targeted therapies for RSV disease as well as a basis for RSV strain comparisons.

The mucogenic phenotype of the rA2-line19F RSV correlated with increased viral load. Infection with rA2-line19F resulted in higher viral loads than infection with A2, line 19, Long, rA2-A2F, and rA2-LongF. Why does the rA2-line19F chimeric virus result in a higher viral load than both native A2 and native line 19? As RSV F is important for viral entry, it is possible that line 19F has enhanced entry in target cells in the mouse lung and that other elements in the A2 genome enhance viral load in vivo compared to line 19. Alternatively, line 19F may increase viral load via suppression of type I IFN or some other mechanism. Given the sequence differences between the F proteins of line 19 and Long (described above), the 79F, 191F, 357F, 371F, and/or 557F residues of line 19F are responsible for enhanced viral load in vivo compared to the Long F chimeric virus.

The mucogenic effect of line 19F compared to LongF may be a consequence of increased viral load. Viral replication is required for the mucogenic effect of wild-type line 19 because UV-inactivated line 19 is not mucogenic (33, 57). Increased viral load of rA2-line19F may result in mucus expression via increased expression of other viral elements in the A2 genome that stimulate mucus production and airway dysfunction. RSV factors, such as nonstructural protein 1 (NS1), which inhibits type I IFN, or immunodominant epitopes may have mucogenic effects in BALB/c mice in the context of higher viral loads (50, 58). On the other hand, native line 19 strain viral loads were not significantly higher than A2 and Long strain viral loads as measured by qRT-PCR, and line 19 infection was clearly more mucogenic than A2 and Long infection, as measured by gob-5 expression and PAS staining (Fig. 4C, Fig. 8, and reference 29). This observation suggests that elevated RSV viral load per se is not sufficient for RSV-induced pulmonary mucus expression. In contrast to rA2-line19F, the increased mucogenicity of native line 19 compared to A2 and Long did not correlate with increased viral load. Line 19 and rA2-line19F RSV strains may induce mucus production and AHR by different mechanisms.

We hypothesized that line 19F exerts an early immunologic effect that may result in increased viral replication and subsequent mucus expression. Strikingly, line 19 and rA2-line19F induced significantly lower IFN- expression in the lungs of BALB/cJ mice than Long or rA2-LongF did at 24 h p.i. The difference in IFN- levels between A2 (Fig. 5A) and rA2-A2F (Fig. 5B) may reflect possible sequence differences outside of the F gene between the A2 strain in our laboratory and the A2 strain encoded by the rA2 plasmid. Our results showing that the Long strain induced higher IFN- levels in mice than the A2 strain did are consistent with published data that Long induces higher IFN- levels than A2 in human epithelial cell lines and human plasmacytoid dendritic cells (pDCs) (45). Comparing rA2-line19F with rA2-LongF, we show that RSV F contributes to modulation of the early type I IFN response to primary infection in vivo. The data correlate lower IFN- levels induced by rA2-line19F compared to rA2-LongF with increased viral load and mucus expression. Line 19F may play a direct role in modulating type I IFN. An alternative explanation is that increased viral load of rA2-line19F results in increased NS1 levels which inhibit type I IFN. It is not known at this time whether RSV line 19F modulates type I IFN directly. One possibility is that line 19F has an effect on DCs. Infection of BALB/c mice with either RSV A2 or line 19 increases the number of pDCs in the lungs of BALB/c mice, and pDCs are a major source of IFN- in RSV-infected mice (49, 60). Depletion of pDCs in line 19-infected mice results in increased viral load and exacerbated airway mucous expression (49). We speculate that line 19 may induce lower type I IFN expression in pDCs than A2 and Long do. Further studies will be required to determine the roles of IFN- and pDCs in line 19F-induced mucus production.

The glycoproteins of RSV (G, SH, and F) mediate immunomodulatory effects. RSV G (attachment) protein is important for replication in vivo (55). RSV G also inhibits the host immune response. The secreted form of G protein modulates lung inflammation and pathogenicity, although there is controversy as to whether it enhances or diminishes these effects (2, 30, 47). The conserved cysteine-rich region of RSV G protein inhibits IL-6 production by monocytes and inhibits T-cell responses (20, 40). RSV G and/or SH may modulate NK cell and neutrophil recruitment (57). The SH protein of RSV inhibits tumor necrosis factor alpha signaling (16). The F protein of RSV can mediate fusion of cells derived from a wide variety of vertebrate species (4). RSV F is also immunogenic and immunomodulatory. RSV F elicits T- and B-cell responses in mice and humans (11). Purified RSV F protein induces Toll-like receptor signaling (27). RSV infection suppresses T-cell responses in peripheral blood lymphocyte cultures (41, 42, 44). Type I IFNs and direct contact of peripheral blood lymphocytes with RSV F protein have been implicated in the mechanism of RSV-mediated T-cell suppression (10, 41, 46). RSV line 19F may modulate DC/T-cell interactions and suppress IFN- responses, leading to increased viral replication as well as IL-13 and mucus expression.

RSV strains within antigenic subgroup A exhibit approximately 20% amino acid variability in the G protein and 3% variability in the F protein (53). A significant finding of our study is that two antigenic subgroup A RSV strains, line 19 and Long, have very similar genotypes (<1% amino acid variability in G proteins and 1% amino acid variability in F proteins) but elicit differential IL-13 and mucus responses in mice. A limitation of our study is that the cell culture passage histories of line 19 and Long are not defined. Further studies of RSV pathogenesis with RSV clinical isolates will determine whether strain differences contribute to the differential disease phenotypes. Specific RSV genotypes (clades) have been correlated with illness severity in some cases (17, 31).

RSV strain differences may contribute to differential immunologic phenotypes in humans. RSV disease has been associated with elevated levels of T_H2 cytokines by some laboratory groups, but not others (35). Mixed T_H1/T_H2 responses are found in RSV-infected children (15, 34, 56). Circulating RSV strain differences in patient cohorts may contribute to differences reported on the effect of RSV infection on the development of asthma (48, 51, 52). A better understanding of the impact of RSV strain differences on pathogenesis and immune protection may lead to specific therapies and enhanced vaccine strategies.

 
This work was supported by NIH HL069949, AI054660, AI 070672, HL090664, and GM15431. M.L.M. was supported by T32 GM07569, T32 HL069765, and the Thrasher Research Fund New Researcher Award. P.L.C., C.L., and U.J.B. were supported by the Intramural Research Program of the NIAID, NIH.

We thank Frank Cook (University of Kentucky) for the pLG 338-30 plasmid. We thank Barney Graham for helpful discussions and for providing RSV A2 and Long strains.

 
* Corresponding author. Present address for Martin L. Moore: Department of Pediatrics, Emory University, Atlanta, GA. Phone: (404) 727-9162. Fax: (404) 727-9223. E-mail: martin.moore{at}emory.edu. Mailing address for R. Stokes Peebles, Jr.: T-1218 MCN, Vanderbilt University Medical Center, Nashville, TN 37232-2650. Phone: (615) 322-3412. Fax: (615) 343-7448. E-mail: stokes.peebles{at}vanderbilt.edu

Published ahead of print on 11 February 2009.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Aherne, W., T. Bird, S. D. Court, P. S. Gardner, and J. McQuillin. 1970. Pathological changes in virus infections of the lower respiratory tract in children. J. Clin. Pathol. 23:7-18.[Abstract/Free Full Text]
2
2. Arnold, R., B. Konig, H. Werchau, and W. Konig. 2004. Respiratory syncytial virus deficient in soluble G protein induced an increased proinflammatory response in human lung epithelial cells. Virology 330:384-397.[CrossRef][Medline]
3
3. Begona Ruiz-Arguello, M., L. Gonzalez-Reyes, L. J. Calder, C. Palomo, D. Martin, M. J. Saiz, B. Garcia-Barreno, J. J. Skehel, and J. A. Melero. 2002. Effect of proteolytic processing at two distinct sites on shape and aggregation of an anchorless fusion protein of human respiratory syncytial virus and fate of the intervening segment. Virology 298:317-326.[CrossRef][Medline]
4
4. Branigan, P. J., C. Liu, N. D. Day, L. L. Gutshall, R. T. Sarisky, and A. M. Del Vecchio. 2005. Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein. Virol. J. 2:54.[CrossRef][Medline]
5
5. Buchholz, U. J., S. Finke, and K. K. Conzelmann. 1999. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 73:251-259.[Abstract/Free Full Text]
6
6. Buchholz, U. J., H. Granzow, K. Schuldt, S. S. Whitehead, B. R. Murphy, and P. L. Collins. 2000. Chimeric bovine respiratory syncytial virus with glycoprotein gene substitutions from human respiratory syncytial virus (HRSV): effects on host range and evaluation as a live-attenuated HRSV vaccine. J. Virol. 74:1187-1199.[Abstract/Free Full Text]
7
7. Bukreyev, A., I. M. Belyakov, J. A. Berzofsky, B. R. Murphy, and P. L. Collins. 2001. Granulocyte-macrophage colony-stimulating factor expressed by recombinant respiratory syncytial virus attenuates viral replication and increases the level of pulmonary antigen-presenting cells. J. Virol. 75:12128-12140.[Abstract/Free Full Text]
8
8. Cane, P. A. 2001. Molecular epidemiology of respiratory syncytial virus. Rev. Med. Virol. 11:103-116.[CrossRef][Medline]
9
9. Chang, J., A. Srikiatkhachorn, and T. J. Braciale. 2001. Visualization and characterization of respiratory syncytial virus F-specific CD8⁺ T cells during experimental virus infection. J. Immunol. 167:4254-4260.[Abstract/Free Full Text]
10
10. Chi, B., H. L. Dickensheets, K. M. Spann, M. A. Alston, C. Luongo, L. Dumoutier, J. Huang, J. C. Renauld, S. V. Kotenko, M. Roederer, J. A. Beeler, R. P. Donnelly, P. L. Collins, and R. L. Rabin. 2006. Alpha and lambda interferon together mediate suppression of CD4 T cells induced by respiratory syncytial virus. J. Virol. 80:5032-5040.[Abstract/Free Full Text]
11
11. Collins, P. L., J. E. Crowe, Jr., D. M. Knipe, and P. M. Howley. 2006. Respiratory syncytial virus and metapneumovirus, p. 1601-1646. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 5th ed. Lippincott Williams & Wilkins, Philadelphia, PA.
12
12. Collins, P. L., M. G. Hill, E. Camargo, H. Grosfeld, R. M. Chanock, and B. R. Murphy. 1995. Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development. Proc. Natl. Acad. Sci. USA 92:11563-11567.[Abstract/Free Full Text]
13
13. Crim, R. L., S. A. Audet, S. A. Feldman, H. S. Mostowski, and J. A. Beeler. 2007. Identification of linear heparin-binding peptides derived from human respiratory syncytial virus fusion glycoprotein that inhibit infectivity. J. Virol. 81:261-271.[Abstract/Free Full Text]
14
14. Cunningham, T. P., R. C. Montelaro, and K. E. Rushlow. 1993. Lentivirus envelope sequences and proviral genomes are stabilized in Escherichia coli when cloned in low-copy-number plasmid vectors. Gene 124:93-98.[CrossRef][Medline]
15
15. de Waal, L., L. P. Koopman, I. J. van Benten, A. H. Brandenburg, P. G. Mulder, R. L. de Swart, W. J. Fokkens, H. J. Neijens, and A. D. Osterhaus. 2003. Moderate local and systemic respiratory syncytial virus-specific T-cell responses upon mild or subclinical RSV infection. J. Med. Virol. 70:309-318.[CrossRef][Medline]
16
16. Fuentes, S., K. C. Tran, P. Luthra, M. N. Teng, and B. He. 2007. Function of the respiratory syncytial virus small hydrophobic protein. J. Virol. 81:8361-8366.[Abstract/Free Full Text]
17
17. Gilca, R., G. De Serres, M. Tremblay, M. L. Vachon, E. Leblanc, M. G. Bergeron, P. Dery, and G. Boivin. 2006. Distribution and clinical impact of human respiratory syncytial virus genotypes in hospitalized children over 2 winter seasons. J. Infect. Dis. 193:54-58.[CrossRef][Medline]
18
18. Gonzalez-Reyes, L., M. B. Ruiz-Arguello, B. Garcia-Barreno, L. Calder, J. A. Lopez, J. P. Albar, J. J. Skehel, D. C. Wiley, and J. A. Melero. 2001. Cleavage of the human respiratory syncytial virus fusion protein at two distinct sites is required for activation of membrane fusion. Proc. Natl. Acad. Sci. USA 98:9859-9864.[Abstract/Free Full Text]
19
19. Graham, B. S., M. D. Perkins, P. F. Wright, and D. T. Karzon. 1988. Primary respiratory syncytial virus infection in mice. J. Med. Virol. 26:153-162.[Medline]
20
20. Harcourt, J., R. Alvarez, L. P. Jones, C. Henderson, L. J. Anderson, and R. A. Tripp. 2006. Respiratory syncytial virus G protein and G protein CX3C motif adversely affect CX3CR1+ T cell responses. J. Immunol. 176:1600-1608.[Abstract/Free Full Text]
21
21. Hashimoto, K., J. E. Durbin, W. Zhou, R. D. Collins, S. B. Ho, J. K. Kolls, P. J. Dubin, J. R. Sheller, K. Goleniewska, J. F. O'Neal, S. J. Olson, D. Mitchell, B. S. Graham, and R. S. Peebles, Jr. 2005. Respiratory syncytial virus infection in the absence of STAT 1 results in airway dysfunction, airway mucus, and augmented IL-17 levels. J. Allergy Clin. Immunol. 116:550-557.[CrossRef][Medline]
22
22. Hashimoto, K., B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, J. F. O'Neal, and R. S. Peebles, Jr. 2004. Respiratory syncytial virus in allergic lung inflammation increases Muc5ac and gob-5. Am. J. Respir. Crit. Care Med. 170:306-312.[Abstract/Free Full Text]
23
23. Herlocher, M. L., M. Ewasyshyn, S. Sambhara, M. Gharaee-Kermani, D. Cho, J. Lai, M. Klein, and H. F. Maassab. 1999. Immunological properties of plaque purified strains of live attenuated respiratory syncytial virus (RSV) for human vaccine. Vaccine 17:172-181.[CrossRef][Medline]
24
24. Hershey, G. K. 2003. IL-13 receptors and signaling pathways: an evolving web. J. Allergy Clin. Immunol. 111:677-690.[Medline]
25
25. Jewell, N. A., N. Vaghefi, S. E. Mertz, P. Akter, R. S. Peebles, Jr., L. O. Bakaletz, R. K. Durbin, E. Flano, and J. E. Durbin. 2007. Differential type I interferon induction by respiratory syncytial virus and influenza A virus in vivo. J. Virol. 81:9790-9800.[Abstract/Free Full Text]
26
26. Kuo, L., R. Fearns, and P. L. Collins. 1997. Analysis of the gene start and gene end signals of human respiratory syncytial virus: quasi-templated initiation at position 1 of the encoded mRNA. J. Virol. 71:4944-4953.[Abstract]
27
27. Kurt-Jones, E. A., L. Popova, L. Kwinn, L. M. Haynes, L. P. Jones, R. A. Tripp, E. E. Walsh, M. W. Freeman, D. T. Golenbock, L. J. Anderson, and R. W. Finberg. 2000. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat. Immunol. 1:398-401.[CrossRef][Medline]
28
28. Lugo, R. A., and M. C. Nahata. 1993. Pathogenesis and treatment of bronchiolitis. Clin. Pharm. 12:95-116.[Medline]
29
29. Lukacs, N. W., M. L. Moore, B. D. Rudd, A. A. Berlin, R. D. Collins, S. J. Olson, S. B. Ho, and R. S. Peebles, Jr. 2006. Differential immune responses and pulmonary pathophysiology are induced by two different strains of respiratory syncytial virus. Am. J. Pathol. 169:977-986.[Abstract/Free Full Text]
30
30. Maher, C. F., T. Hussell, E. Blair, C. J. Ring, and P. J. Openshaw. 2004. Recombinant respiratory syncytial virus lacking secreted glycoprotein G is attenuated, non-pathogenic but induces protective immunity. Microbes Infect. 6:1049-1055.[CrossRef][Medline]
31
31. Martinello, R. A., M. D. Chen, C. Weibel, and J. S. Kahn. 2002. Correlation between respiratory syncytial virus genotype and severity of illness. J. Infect. Dis. 186:839-842.[CrossRef][Medline]
32
32. Mentel, R., U. Wegner, R. Bruns, and L. Gurtler. 2003. Real-time PCR to improve the diagnosis of respiratory syncytial virus infection. J. Med. Microbiol. 52:893-896.[Abstract/Free Full Text]
33
33. Miller, A. L., C. Gerard, M. Schaller, A. D. Gruber, A. A. Humbles, and N. W. Lukacs. 2006. Deletion of CCR1 attenuates pathophysiologic responses during respiratory syncytial virus infection. J. Immunol. 176:2562-2567.[Abstract/Free Full Text]
34
34. Mobbs, K. J., R. L. Smyth, U. O'Hea, D. Ashby, P. Ritson, and C. A. Hart. 2002. Cytokines in severe respiratory syncytial virus bronchiolitis. Pediatr. Pulmonol. 33:449-452.[CrossRef][Medline]
35
35. Moore, M. L., and R. S. Peebles, Jr. 2006. Respiratory syncytial virus disease mechanisms implicated by human, animal model, and in vitro data facilitate vaccine strategies and new therapeutics. Pharmacol. Ther. 112:405-424.[CrossRef][Medline]
36
36. Oomens, A. G., K. P. Bevis, and G. W. Wertz. 2006. The cytoplasmic tail of the human respiratory syncytial virus F protein plays critical roles in cellular localization of the F protein and infectious progeny production. J. Virol. 80:10465-10477.[Abstract/Free Full Text]
37
37. Peebles, R. S., Jr., J. R. Sheller, J. E. Johnson, D. B. Mitchell, and B. S. Graham. 1999. Respiratory syncytial virus infection prolongs methacholine-induced airway hyperresponsiveness in ovalbumin-sensitized mice. J. Med. Virol. 57:186-192.[CrossRef][Medline]
38
38. Peret, T. C., C. B. Hall, G. W. Hammond, P. A. Piedra, G. A. Storch, W. M. Sullender, C. Tsou, and L. J. Anderson. 2000. Circulation patterns of group A and B human respiratory syncytial virus genotypes in 5 communities in North America. J. Infect. Dis. 181:1891-1896.[CrossRef][Medline]
39
39. Peret, T. C., C. B. Hall, K. C. Schnabel, J. A. Golub, and L. J. Anderson. 1998. Circulation patterns of genetically distinct group A and B strains of human respiratory syncytial virus in a community. J. Gen. Virol. 79:2221-2229.[Abstract]
40
40. Polack, F. P., P. M. Irusta, S. J. Hoffman, M. P. Schiatti, G. A. Melendi, M. F. Delgado, F. R. Laham, B. Thumar, R. M. Hendry, J. A. Melero, R. A. Karron, P. L. Collins, and S. R. Kleeberger. 2005. The cysteine-rich region of respiratory syncytial virus attachment protein inhibits innate immunity elicited by the virus and endotoxin. Proc. Natl. Acad. Sci. USA 102:8996-9001.[Abstract/Free Full Text]
41
41. Preston, F. M., P. L. Beier, and J. H. Pope. 1995. Identification of the respiratory syncytial virus-induced immunosuppressive factor produced by human peripheral blood mononuclear cells in vitro as interferon-alpha. J. Infect. Dis. 172:919-926.[Medline]
42
42. Preston, F. M., P. L. Beier, and J. H. Pope. 1992. Infectious respiratory syncytial virus (RSV) effectively inhibits the proliferative T cell response to inactivated RSV in vitro. J. Infect. Dis. 165:819-825.[Medline]
43
43. Quinn, S. F., S. Erickson, D. Oshman, and F. Hayden. 1985. Lobar collapse with respiratory syncytial virus pneumonitis. Pediatr. Radiol. 15:229-230.[CrossRef][Medline]
44
44. Roberts, N. J., Jr., A. H. Prill, and T. N. Mann. 1986. Interleukin 1 and interleukin 1 inhibitor production by human macrophages exposed to influenza virus or respiratory syncytial virus. Respiratory syncytial virus is a potent inducer of inhibitor activity. J. Exp. Med. 163:511-519.[Abstract/Free Full Text]
45
45. Schlender, J., V. Hornung, S. Finke, M. Gunthner-Biller, S. Marozin, K. Brzozka, S. Moghim, S. Endres, G. Hartmann, and K. K. Conzelmann. 2005. Inhibition of Toll-like receptor 7- and 9-mediated alpha/beta interferon production in human plasmacytoid dendritic cells by respiratory syncytial virus and measles virus. J. Virol. 79:5507-5515.[Abstract/Free Full Text]
46
46. Schlender, J., G. Walliser, J. Fricke, and K. K. Conzelmann. 2002. Respiratory syncytial virus fusion protein mediates inhibition of mitogen-induced T-cell proliferation by contact. J. Virol. 76:1163-1170.[Abstract/Free Full Text]
47
47. Schwarze, J., and U. Schauer. 2004. Enhanced virulence, airway inflammation and impaired lung function induced by respiratory syncytial virus deficient in secreted G protein. Thorax 59:517-521.[Abstract/Free Full Text]
48
48. Sigurs, N., P. M. Gustafsson, R. Bjarnason, F. Lundberg, S. Schmidt, F. Sigurbergsson, and B. Kjellman. 2005. Severe respiratory syncytial virus bronchiolitis in infancy and asthma and allergy at age 13. Am. J. Respir. Crit. Care Med. 171:137-141.[Abstract/Free Full Text]
49
49. Smit, J. J., B. D. Rudd, and N. W. Lukacs. 2006. Plasmacytoid dendritic cells inhibit pulmonary immunopathology and promote clearance of respiratory syncytial virus. J. Exp. Med. 203:1153-1159.[Abstract/Free Full Text]
50
50. Spann, K. M., K. C. Tran, and P. L. Collins. 2005. Effects of nonstructural proteins NS1 and NS2 of human respiratory syncytial virus on interferon regulatory factor 3, NF-B, and proinflammatory cytokines. J. Virol. 79:5353-5362.[Abstract/Free Full Text]
51
51. Stein, R. T., D. Sherrill, W. J. Morgan, C. J. Holberg, M. Halonen, L. M. Taussig, A. L. Wright, and F. D. Martinez. 1999. Respiratory syncytial virus in early life and risk of wheeze and allergy by age 13 years. Lancet 354:541-545.[CrossRef][Medline]
52
52. Stensballe, L. G., J. B. Simonsen, S. F. Thomsen, A. M. Larsen, S. H. Lysdal, P. Aaby, K. O. Kyvik, A. Skytthe, V. Backer, and H. Bisgaard. 2009. The causal direction in the association between respiratory syncytial virus hospitalization and asthma. J. Allergy Clin. Immunol. 123:131-137.e1.[CrossRef][Medline]
53
53. Sullender, W. M. 2000. Respiratory syncytial virus genetic and antigenic diversity. Clin. Microbiol. Rev. 13:1-15.[Abstract/Free Full Text]
54
54. Tekkanat, K. K., H. F. Maassab, D. S. Cho, J. J. Lai, A. John, A. Berlin, M. H. Kaplan, and N. W. Lukacs. 2001. IL-13-induced airway hyperreactivity during respiratory syncytial virus infection is STAT6 dependent. J. Immunol. 166:3542-3548.[Abstract/Free Full Text]
55
55. Teng, M. N., S. S. Whitehead, and P. L. Collins. 2001. Contribution of the respiratory syncytial virus G glycoprotein and its secreted and membrane-bound forms to virus replication in vitro and in vivo. Virology 289:283-296.[CrossRef][Medline]
56
56. Tripp, R. A., D. Moore, A. Barskey, L. Jones, C. Moscatiello, H. Keyserling, and L. J. Anderson. 2002. Peripheral blood mononuclear cells from infants hospitalized because of respiratory syncytial virus infection express T helper-1 and T helper-2 cytokines and CC chemokine messenger RNA. J. Infect. Dis. 185:1388-1394.[CrossRef][Medline]
57
57. Tripp, R. A., D. Moore, L. Jones, W. Sullender, J. Winter, and L. J. Anderson. 1999. Respiratory syncytial virus G and/or SH protein alters Th1 cytokines, natural killer cells, and neutrophils responding to pulmonary infection in BALB/c mice. J. Virol. 73:7099-7107.[Abstract/Free Full Text]
58
58. Varga, S. M., E. L. Wissinger, and T. J. Braciale. 2000. The attachment (G) glycoprotein of respiratory syncytial virus contains a single immunodominant epitope that elicits both Th1 and Th2 CD4+ T cell responses. J. Immunol. 165:6487-6495.[Abstract/Free Full Text]
59
59. Walter, D. M., J. J. McIntire, G. Berry, A. N. McKenzie, D. D. Donaldson, R. H. DeKruyff, and D. T. Umetsu. 2001. Critical role for IL-13 in the development of allergen-induced airway hyperreactivity. J. Immunol. 167:4668-4675.[Abstract/Free Full Text]
60
60. Wang, H., N. Peters, and J. Schwarze. 2006. Plasmacytoid dendritic cells limit viral replication, pulmonary inflammation, and airway hyperresponsiveness in respiratory syncytial virus infection. J. Immunol. 177:6263-6270.[Abstract/Free Full Text]
61
61. Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, and J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J. Clin. Investig. 103:779-788.[Medline]

---

Journal of Virology, May 2009, p. 4185-4194, Vol. 83, No. 9
0022-538X/09/$08.00+0     doi:10.1128/JVI.01853-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Moore, M. L. Articles by Peebles, R. S. Search for Related Content PubMed PubMed Citation Articles by Moore, M. L. Articles by Peebles, R. S., Jr.