Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wang, W. Articles by Simmons, D. T. Search for Related Content PubMed PubMed Citation Articles by Wang, W. Articles by Simmons, D. T.

 Previous Article  |  Next Article 

Journal of Virology, April 2009, p. 3312-3322, Vol. 83, No. 7
0022-538X/09/$08.00+0     doi:10.1128/JVI.01867-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Simian Virus 40 Large T Antigen Can Specifically Unwind the Central Palindrome at the Origin of DNA Replication

Weiping Wang and Daniel T. Simmons^*

Department of Biological Sciences, University of Delaware, Newark, Delaware 19716-2590

Received 4 September 2008/ Accepted 7 January 2009

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The hydrophilic channels between helicase domains of simian virus 40 (SV40) large T antigen play a critical role in DNA replication. Previous mutagenesis of residues in the channels identified one class of mutants (class A: D429A, N449S, and N515S) with normal DNA binding and ATPase and helicase activities but with a severely reduced ability to unwind origin DNA and to support SV40 DNA replication in vitro. Here, we further studied these mutants to gain insights into how T antigen unwinds the origin. We found that the mutants were compromised in melting the imperfect palindrome (EP) but normal in untwisting the AT-rich track. However, the mutants' defect in EP melting was not the major reason they failed to unwind the origin because supplying an EP region as a mismatched bubble, or deleting the EP region altogether, did not rescue their unwinding deficiency. These results suggested that specific separation of the central palindrome of the origin (site II) is an essential step in unwinding origin DNA by T antigen. In support of this, wild-type T antigen was able to specifically unwind a 31-bp DNA containing only site II in an ATPase-dependent reaction, whereas D429A and N515S failed to do so. By performing a systematic mutagenesis of 31-bp site II DNA, we identified discrete regions in each pentanucleotide necessary for normal origin unwinding. These data indicate that T antigen has a mechanism to specifically unwind the central palindrome. Various models are proposed to illustrate how T antigen could separate the central origin.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DNA replication is a vital process by which cells transmit genetic information from one cell generation to the next. This requires the accurate and complete duplication of each DNA strand exactly once before cell division. Simian virus 40 (SV40) has long proven to be particularly useful for studying eukaryotic DNA replication. Compared to complicated eukaryotic cells, the small DNA virus has a unique well-defined origin of replication and depends on a single virus-encoded protein, large T antigen, for DNA replication. With the exception of large T antigen, all of the proteins required for viral DNA replication are supplied by the cell (6, 17, 47).

The viral origin consists of multiple distinct elements. Although the presence of regulatory elements increases the efficiency of replication, the 64-bp core origin is sufficient for replication in vitro (11, 15). Mutational analysis defined three functional domains within the core: a central palindrome (site II) containing four 5'-GAGGC-3' sequence repeats, an imperfect palindrome on the SV40 early flank (EP region), and an AT-rich element on the late side (AT track) (9, 14). The organization of the four 5'-GAGGC-3' pentanucleotides in the central palindrome is critical for optimal DNA unwinding by T antigen and subsequent DNA replication (47). All four pentamers (P1 to P4) are oriented toward a single base pair in the middle of the palindrome that is designated nucleotide (nt) 1 on the conventional SV40 map, and a 1-bp spacer separates each pentamer (see Fig. 7) (47). It has been known for a long time that all four pentamers are required for unwinding circular SV40 DNA (9, 25). However, particular pairs of pentanucleotides are sufficient for supporting double-hexamer formation and structural alterations of the flanking AT and EP regions (25).

View larger version (57K): [in this window] [in a new window]

FIG. 7. Effects of substitutions of various base pairs in site II on origin unwinding by wild-type T antigen. The 31-bp origin DNA consists of nt 5228 through 15. The sequence of the DNA is shown at the top of the figure, and the four horizontal arrows represent pentanucleotides in the central palindrome region. The lowercase letters represent nucleotides between pentamers. Single-base substitutions at each site are indicated below the wild-type sequence. The histogram shows the unwinding activity of wild-type T antigen with mutated 31-bp DNA as a percentage of the activity with wild-type 31-bp site II DNA. Error bars represent standard deviations obtained from five data sets. Asterisks and the diamond represent data points that are significantly lower than for the wild type (P < 0.01). WT, wild type.

The multifunctional large T antigen, which contains 708 amino acids, plays vital roles in coordinating viral DNA replication and transformation (6, 18, 47, 51). Three major structural and functional domains of T antigen include an N-terminal J domain, an origin binding domain (OBD) and a C-terminal helicase domain. The structure of the J domain, which is involved in transformation and virus replication, was solved in complex with a portion of the retinoblastoma protein (Rb) (27). The OBD, which spans residues 131 to 259, is essential for recognizing and binding to the viral origin of replication (2, 33, 46, 50). The nuclear magnetic resonance structure of the T antigen OBD in the absence of origin DNA (31) shows a tightly folded domain with two loops (A1 and B2) that were proposed to interact directly with origin DNA based on biochemical analysis of mutant proteins (48, 56). The crystal structure of the OBD hexamer (34) reveals an open "lock washer" structure with six OBD monomers forming a left-handed spiral. The structure of the OBD complexed with origin DNA has also been solved by X-ray crystallography (3, 28). This dimer structure shows how the A1 and B2 loops of the OBD make base and backbone contacts with both strands of the GAGGC pentanucleotides. The crystal structure of the helicase domain has also been determined in the presence or absence of nucleotides (20, 29). The structures illustrate six T antigen monomers assembled into a hexameric ring with a positively charged central channel that is large enough to accommodate single-stranded DNA (ssDNA). The hexamer ring has two layers (or tiers) of different diameters (29). Within a hexamer, hydrophobic channels are present in the small tiers between adjacent monomers, while hydrophilic channels are located in the large tiers. In the central channel, six β-hairpin and loop structures emanating from each subunit are believed to move longitudinally to translocate double-stranded DNA (dsDNA) into the helicase domain and separate it (16, 21, 29, 45).

Biochemical and structural evidence demonstrates that T antigen recognizes site II and binds specifically to at least pairs of pentanucleotides (P1 and P3 preferentially, or P2 and P4) through the A1 and B2 motifs of the OBD. Other T antigen monomers are recruited in the presence of ATP or ADP to assemble a double hexamer. Various solved structures of the OBD bound with DNA (3, 28) have indicated that a major structural reorientation of this domain occurs during hexamerization, resulting in a shift of the A1 and B2 motifs away from DNA and toward the helicase domains. Engaging origin DNA also depends on the helicase domain, which binds DNA nonspecifically (24, 30). This interaction is primarily with the EP and AT regions flanking site II, which results in the melting of the EP region and untwisting of the AT track (4-6, 10, 36, 49). These reactions are followed by the bidirectional unwinding of the entire origin, which depends on T antigen's 3' to 5' DNA helicase activity and associated ATPase activity (22, 49, 55).

It has been established that ssDNA loops generated by the helicase activity serve as templates for leading and lagging strand synthesis (1, 8, 39, 43, 47, 53). A nuclear-magnetic-resonance-based study of the T antigen OBD complexed with ssDNA suggested that ssDNA passes over one face of the T antigen OBD hexamer and then transits through a gap in the open "lock washer" structure (35). Bochkareva et al. (3), however, proposed that the hexameric OBD undergoes a conformation switch from a "open spiral" to a "closed ring" structure during origin DNA melting, and it is the ssDNA-binding protein RPA that "pulls" the ssDNA totally out of OBD before the formation of the OBD ring structure. How ssDNA is routed through the helicase domain is not clear. It could be threaded on the surface of the helicase domain (35), through side channels between small and large tiers (21), or through hydrophilic channels between adjacent large tiers of helicase domains (52).

Previously, we studied the roles of the helicase domain hydrophilic channels in DNA replication by generating point mutations at residues that line these channels. The mutants were characterized biochemically in oligomerization, ATP hydrolysis, DNA binding, DNA unwinding, and in vitro DNA replication assays. The mutants fell into four classes (classes A to D) according to their properties. We identified mutant proteins (those in classes A and C) as being abnormal in the ability to unwind origin DNA, and these were consequently unable to support DNA replication. We hypothesized that the wild-type residues (D429, N449, N515, K446, and T536) that are altered in the class A and C mutants are involved in transitioning the double-stranded origin to a partially melted structure, the precursor to the formation of two replication forks.

In the present study, we intended to precisely identify the role of the three class A residues in DNA replication and to better understand the mechanism of DNA unwinding. The location of the three wild-type residues in a hydrophilic channel is shown in Fig. 1. We focused on this class of mutants because they were normal in helicase activity and could potentially tell us how the origin is unwound. To this aim, we examined their structural distortion activities and determined which elements at the origin are responsible for the mutants' inability to unwind origin DNA. Our data indicate that T antigen has an activity that specifically unwinds the central palindrome at the SV40 origin and that this activity is a component of the unwinding of the entire origin. Furthermore, residues in the hydrophilic channels play an important role in this reaction.

View larger version (80K): [in this window] [in a new window]

FIG. 1. Location of the residues in the hydrophilic channel altered in the class A mutants. Ribbon representations of the large T antigen dimer structure (1SVL) (21) showing the hydrophilic channel between two monomers (red and blue). The β-hairpin structures intruding into the central channel are also depicted here in white. The side chains of the three residues are indicated in yellow. Images were prepared with Visual Molecular Dynamics version 1.8.3 (23).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
KMnO₄ oxidation assays. Structural distortion (KMnO₄ oxidation) assays were performed as described previously (5, 24). A total of 800 ng of T antigen was incubated with 600 ng of origin-containing plasmid pSVO2792 DNA (50) in replication buffer (30 mM HEPES-KOH [pH 8.0], 7 mM MgCl₂, 40 mM creatine phosphate, 1 mM dithiothreitol, and 0.1 mg of bovine serum albumin [BSA]/ml) containing 4 mM ATP for 20 min at 37°C. KMnO₄ was then added to the reaction mixture to a final concentration of 6 mM to oxidize improperly base-paired thymine residues. The reaction was terminated by the addition of 2-mercaptoethanol to a final concentration of 1.0 M. The modified DNA was then purified through a Centri-Spin 20 column (Princeton Separations, Inc.). A primer extension assay was performed by using a ³²P-end-labeled pBR322 EcoRI primer (New England Biolabs). The extended products were subjected to electrophoresis in a 7% sequencing gel at 1,500 V for 3 h (24). Gels were dried and exposed to PhosphorImager screens (Molecular Dynamics).

Preparation of DNA substrates. The 64-bp origin DNA was generated from two complementary oligonucleotides (26). The sequences of the top and bottom strands were as follows: top, 5'-CACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTA-3'; and bottom, 5'-TAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTG AGCTATTCCAGAAGTAGTG-3'.

To prepare the labeled dsDNA substrate, 400 ng of the top-strand oligonucleotide was ³²P labeled at the 5' end with T4 polynucleotide kinase (New England Biolabs) followed by passage through a Centri-Spin 20 column (Princeton Separations) to remove unincorporated [-³²P]ATP. The radiolabeled top strand was mixed a with threefold excess of the bottom strand in annealing buffer (50 mM Tris-HCl [pH 8.0] and 10 mM MgCl₂), heated to 95°C, and then allowed to cool slowly to room temperature. The annealed origin DNA was further purified by applying the reaction mixture to a 7% native acrylamide gel, followed by electroelution of the desired DNA fragment from gel slices, extractions with phenol and chloroform, ethanol precipitation, and resuspension in 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA.

Similar procedures were used to label and purify the 79-bp EP bubble-containing origin DNA, 47-bp origin DNA containing only AT and site II regions, and 48-bp origin DNA containing only EP and site II regions. End-labeled wild-type 31-bp origin DNA containing only site II, 31-bp nonspecific DNA and 31-bp site II DNA containing substitutions were also obtained in the same way.

The sequences of each EP bubble strand were as follows: top, 5'-GTCGATCAGGAGTGCCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCT CGGCCTCTGCATAAATAAAAAAAATTA-3'; and bottom, 5'-TAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGTACCATGT AGCAGTCATGCACTCCTGATCGAC-3'. The sequences of each strand in 47-bp origin DNA containing only AT and site II were as follows: top, 5'-TAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAG-3'; and bottom, 5'-CTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTA-3'. The sequences of each strand in 48-bp origin DNA containing only EP and site II were as follows: top, 5'-TGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTG-3'; and bottom, 5'-CACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCA-3'. The sequences of the 31-bp origin DNAs containing only the central palindrome region were as follows: top, 5'-TGCAGAGGCCGAGGCCGCCTCGGCCTCTGAG-3'; and bottom, 5'-CTCAGAGGCCGAGGCGGCCTCGGCCTCTGCA-3'. The 31-bp nonspecific DNA contained the same nucleotide content as the wild-type 31-bp origin DNA but with a scrambled sequence. The sequences were as follows: top, 5'-GAGCTAGCTCGCACGCGCTGCGACGCCTCGG-3'; and bottom, 5'-CCGAGGCGTCGCAGCGCGTGCGAGCTAGCTC-3'.

Double substitutions in 31-bp origin DNA were made by mutating the GC base pairs at the third and fourth positions in each pentamer to TA base pairs. For example, the sequences of the strands of DNA with substitutions in P1 were as follows: top, 5'-CTCAGATTCCGAGGCGGCCTCGGCCTCTGCA-3'; and bottom, 5'-TGCAGAGGCCGAGGCCGCCTCGGAATCTGAG-3'.

Mutated 31-bp origin DNAs with single base pair substitutions at each position between nt 5232 and 11 were obtained by making GC-to-TA or AT-to-CG base pair mutations as shown in Fig. 7.

DNA unwinding assays. The ³²P-end-labeled DNA substrates described above were used for origin DNA unwinding assays. A total of 800 ng of T antigen was incubated with 2 ng of end-labeled DNA substrate at 37°C for 90 min in either complete replication buffer (monopolymerase buffer [MPB] containing 30 mM HEPES-KOH [pH 8.0]; 7 mM MgCl₂; 40 mM creatine phosphate; 4 mM ATP; 0.2 mM [each] CTP, GTP, and UTP; 0.1 mM [each] dATP, dGTP, and dTTP; 20 µM dCTP; 25 µg of creatine phosphokinase/ml; 0.5 mM dithiothreitol; 50 µg of BSA/ml) or replication buffer (30 mM HEPES-KOH [pH 8.0], 7 mM MgCl₂, 40 mM creatine phosphate, 1 mM dithiothreitol, 0.1 mg of BSA/ml) modified by the addition of creatine phosphokinase (25 µg/ml), and 4 mM ATP, ADP, or ATPS as indicated. After the addition of 5 µl of stop buffer (2% sodium dodecyl sulfate, 0.1% EDTA, 1 mg of proteinase K/ml), the reaction mixtures were loaded onto a 7% acrylamide (for 64- and 79-bp DNA substrates) or 9% acrylamide (for 31-, 47-, and 48-bp DNA substrates) nondenaturing gels and subjected to electrophoresis at 110 V for 3 h in Tris-borate-EDTA buffer at 3°C. The gels were dried and exposed to phosphor screens (Molecular Dynamics). Unwinding activity was quantified from the values obtained with a PhosphorImager (Molecular Dynamics) and ImageQuant 5.0 software.

DNA-binding assays. The same DNA substrates used in DNA unwinding assays were also utilized to test for binding by T antigen. All binding reactions were carried out by either incubating 800 ng of T antigen with 2 ng of end-labeled DNA in modified replication buffer with 4 mM ADP (instead of ATP) for 90 min at 37°C or complete replication buffer (MPB) for 90 min at 37°C. The DNA-protein complexes were then cross-linked with 0.1% glutaraldehyde for an additional 10 min at 37°C before being loaded onto a composite 2.5% acrylamide-0.6% agarose gel and being run at 25 mA for 3 h at 3°C in Tris-borate-EDTA buffer. The gels were dried and exposed to phosphor screens.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Class A mutants are compromised in EP melting activity. Previous results showed that class A mutants (D429A, N449S, and N515S) bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication (52). To investigate the deficiency of the class A mutants in unwinding origin DNA, we first performed potassium permanganate (KMnO₄) oxidation assays to determine whether the structural distortion activity of the mutants was compromised. Figure 2 shows that, compared to wild-type T antigen, all class A mutants were defective in EP region melting activity but normal in AT untwisting activity. N515S was the most defective and D429A was the least. These data suggested that the inability of class A mutants to melt the EP region could be responsible for their failure to unwind origin DNA.

View larger version (36K): [in this window] [in a new window]

FIG. 2. Structural distortion assay of wild-type and class A mutant T antigens. Reaction mixtures containing 800 ng of T antigen were incubated with origin-containing plasmid pSVO?2792 DNA at 37°C for 20 min. KMnO4 was added, followed by mercaptoethanol to stop the reaction. The positions of modified thymine were detected by primer extension using a 32P-labeled primer. After denaturation, the labeled DNA was analyzed on a sequencing gel and detected with a PhosphorImager. The locations of melted EP region and untwisted AT track are indicated. The EP melting and AT untwisting activities of each mutant were quantitated and normalized to that of wild-type T antigen, and these numbers are shown as percentages in the chart on the right. WT, wild type.

Class A mutants are unable to unwind origin DNA containing a melted EP region. To determine whether the class A mutants' EP melting defect was the only cause for their inability to unwind the origin, we introduced a 17-nt DNA bubble in the EP region to mimic the melted EP region, asking if the bubble could rescue the mutants' defect in origin unwinding. The 64-bp core origin DNA was extended by another 15-bp of GC-rich dsDNA in order to eliminate potential Y-fork unwinding reactions, which could start from free single-stranded ends. Unlike wild-type T antigen, all class A mutants were unable to separate the EP bubble substrates (Fig. 3A, lanes 1, 2, and 3, and Fig. 3B). The results from DNA-binding assays (Fig. 3C) ruled out the possibility that the mutants' failure to unwind the EP bubble origin DNA was due to a defect in binding to this DNA. Under the conditions used for binding in the presence of ADP, only double hexamers formed (Fig. 3C).

View larger version (31K): [in this window] [in a new window]

FIG. 3. Unwinding and binding assays of wild-type and mutant T antigens with a 79-bp origin with an EP bubble. (A) A total of 400 ng of wild-type or mutant T antigen was incubated with 2 ng of end-labeled 79-bp synthetic origin with a bubble over the EP region in the presence of ATP. The DNA was deproteinized and applied to a 7% acrylamide gel. The positions of the labeled DNA strand and the separated ssDNA are shown. The EP bubble origin DNA unwinding activity of each mutant was measured by quantification of the released labeled ssDNA and expressed as a percentage of the wild-type T antigen's activity in chart. (B) Statistical results were obtained from four data sets. (C) Representative gel of DNA-binding assays performed with T antigen (400 ng) and the same labeled 79-bp synthetic DNA in the presence of ADP. Protein complexes were separated from the free DNA by electrophoresis on a composite acrylamide-agarose gel. The positions of bound and free DNAs are shown. WT, wild type.

Class A mutants are defective at unwinding origin DNA with a deletion of the EP region or AT track. To investigate the mutants' defects further, we generated origin DNAs containing site II and the EP region and site II and the AT track only (EP1234 and AT1234) and introduced them in unwinding reactions with wild-type and mutant T antigens. As shown in Fig. 4A and B, the class A mutants were impaired in separating these DNAs, although they could bind to them at a normal level (Fig. 4C). Altogether, the findings strongly suggest that, in addition to an EP melting defect, the class A mutants are unable to denature the site II region of the core origin implying that wild-type T antigen must be able to unwind the central palindrome directly.

View larger version (40K): [in this window] [in a new window]

FIG. 4. Unwinding and binding assays of wild-type and mutant T antigens with origin DNAs containing the EP region and site II (EP1234) or AT track and site II (AT1234). (A) Unwinding reactions of wild-type and class A mutants. 800 ng of wild-type or mutant T antigen was incubated with 2 ng of 32P end-labeled AT1234 (left) or EP1234 (right). (B) Bar graph of unwinding activities of class A mutants as measured by the released labeled single-stranded DNA. Activity is expressed as a percentage of that of wild-type T antigen. (C) Bar graph of binding activities of class A mutants. Binding reactions were carried out under the same conditions as those for unwinding (90 min at 37°C) before cross-linking with glutaraldehyde. Binding activity of each mutant with each substrate was compared to that of wild-type T antigen using a PhosphorImager and ImageQuant 5.0. WT, wild type.

T antigen has an activity to specifically unwind the central palindrome. To gain direct evidence that T antigen can unwind the central palindrome region, we generated 31-bp DNA substrates containing site II plus 4 bp of origin DNA on each end (see Fig. 7) and performed unwinding assays with wild-type and mutant T antigens. As predicted, we observed separation of the site II origin DNA by wild-type T antigen (Fig. 5A, lane 3). Mutants D429A and N515S were severely impaired in unwinding the 31-bp substrate (Fig. 5A, lanes 4 and 6, and Fig. 5B), while N449S displayed normal activity (Fig. 5A, lane 5, and Fig. 5B). None of the three substitutions affected the mutants' binding to the 31-bp origin DNA (Fig. 5C), although the mobility of the DNA protein complexes varied slightly. To determine whether the unwinding of this substrate was sequence specific, we generated a 31-bp DNA substrate with the same nucleotide content as site II but with a scrambled sequence. Wild-type T antigen could not unwind this substrate (Fig. 5D, lane 7, and Fig. 5E), although it could bind to it as well as origin DNA under the same conditions (1.5 h at 37°C) (data not shown).

View larger version (44K): [in this window] [in a new window]

FIG. 5. 31-bp origin DNA unwinding and binding assays of wild-type and mutant T antigens. (A) A total of 800 ng of wild-type or class A mutant T antigen was incubated with 2 ng of end-labeled 31-bp long DNA containing only the central palindrome region in MPB. After 90 min at 37°C, the reactions were terminated with stopping buffer, and samples were applied to a 9% nondenaturing polyacrylamide gel. The positions of the double-stranded site II DNA and the unwound products are shown. (B) The site II DNA unwinding efficiency of each mutant was plotted as a percentage of that for wild-type T. (C) Binding of class A mutants to the 31-bp site II DNA. The assay was performed as described in Fig. 3. The positions of bound and free DNAs are shown. (D) Unwinding activity of wild-type T antigen with 31-bp long DNA under various conditions. In lanes 3 to 5, 800 ng of wild-type T was incubated with 31-bp site II origin DNA in replication buffer in the presence of ATP, ADP, or ATPS. In lanes 6 and 7, 800 ng of wild-type T was incubated in MPB with wild-type 31-bp site II DNA or 31-bp nonspecific DNA with the same nucleotide content as origin DNA but with a scrambled sequence. Lanes 8 and 9 are control reactions without T antigen. Unwinding assays were carried out under the same conditions as in panel A. (E) The percentage of 31-bp DNA unwound for lanes 3 to 7 in panel D was plotted. WT, wild type.

We also carried out 31-bp origin DNA unwinding assays in the presence of different nucleotides in order to understand the energy requirement of this activity. As shown in Fig. 5D and E, neither ATPS nor ADP supported the unwinding of this substrate, indicating that ATP hydrolysis is required. We conclude that certain residues within T antigen's hydrophilic channels participate in the sequence-specific unwinding of the central palindrome of the origin in an ATP hydrolysis-dependent manner.

Pentanucleotides 1 and 4 are critical for unwinding of site II. To investigate the sequence requirement for site II specific unwinding activity by T antigen, we made base-pair substitutions at the third and fourth positions within each of the four pentanucleotide repeats and tested the ability of wild-type T antigen to bind and unwind each of the four mutant origins. GC-to-TA exchanges were chosen because these substitutions would be expected to have the greatest effects on potential interactions with proteins (13, 32). As an example, the substitutions made to generate the double mutations in P1 are shown in Fig. 6C. Although having no effect on binding (Fig. 6B), substitutions of the third- and fourth-position GC base pairs to TA in P1 or P4 significantly reduced the unwinding activity (Fig. 6A). In contrast, the same mutations in P2 or P3 had no effect on unwinding (Fig. 6A). These results indicated that P1 is the most important pentanucleotide for unwinding by wild-type T antigen, followed by P4, whereas P2 and P3 are not critical.

View larger version (38K): [in this window] [in a new window]

FIG. 6. Unwinding and binding activities of wild-type T antigen with double-mutated 31-bp origin DNA. (A) Quantitation of unwinding assays. 800 ng of wild-type T antigen was incubated in MPB for 90 min at 37°C with 2 ng of each of four 31-bp site II DNAs containing substitutions (GC to TA) at the third and fourth positions of one pentanucleotide. As an example, the changes introduced in the DNA to make the P1 mutant are shown in italics in panel C. The reactions were terminated and applied to a 9% acrylamide gel. The unwinding activity of wild-type T with the altered origins was compared to that with wild-type 31-bp origin. (B) Quantitation of binding assays. 800 ng of wild-type T antigen was incubated with the same double-mutated 31-bp site II DNAs for 90 min at 37°C in replication buffer with ADP before cross-linking with glutaraldehyde. The percentage of mutant DNA bound by wild-type T antigen was plotted relative to the binding to wild-type 31-bp origin DNA. WT, wild type.

To pinpoint the important base pairs in the central palindrome domain for DNA unwinding, we generated mutant 31-bp DNAs with a single base-pair substitution at each site within the central palindrome. Figure 7 summarizes the effects of point substitutions on origin unwinding. We found that mutation (GC to TA) of the third or fourth position in P1 or of the fourth position in P2, P3, or P4 (asterisks in Fig. 7) significantly reduced the ability of T antigen to unwind the DNA. Consistent with the effects of double substitutions on unwinding, single base-pair changes in P1 had the greatest impact on unwinding. A GC-to-TA mutation between pentanucleotides 1 and 2 (at nt 5237) was also inhibitory (Fig. 7, diamond). Again, abnormal unwinding activity could not be explained by a defect in T antigen binding to these substrates (data not shown). Interestingly, T antigen exhibited greater than normal activity in unwinding several mutated 31-bp origin DNAs, including those containing a change at the second position (AT to CG) in P1 or P2 (nt 5233 and nt 5239, respectively), as well two others with GC-to-TA mutations at the fifth position of P2 (nt 5242) or first position of P3 (nt 5) (Fig. 7). The unexpected enhanced unwinding activity with some mutated DNAs is likely linked to the exact mechanism by which the central palindrome in unwound (see Discussion). Overall, mutations at different positions exerted different effects on the unwinding reaction. These data support the idea that T antigen participates in unwinding site II by actively interacting with specific sequences of the DNA.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
We report in this study that mutation of a number of residues in the hydrophilic channels (D429, N449, and N515) interfered with structural distortion of the EP flanking region of the origin but not with AT untwisting (Fig. 2). Previously (7), we showed that mutation of residues on the N-terminal side of the OBD of T antigen reduced AT untwisting but not EP melting. Together, these and other (5, 11, 12, 44) data argue strongly that the two structural distortion reactions are distinct from one another and involve different regions of the T antigen helicase domain.

Although the three class A mutants are defective in EP melting, the introduction of a melted EP region in origin DNA did not rescue the mutants' failure to unwind the origin (Fig. 3). We also showed that the mutants were compromised in unwinding origin DNA missing the EP region or AT track (Fig. 4). These results imply that at least three residues in the hydrophilic channel are involved in the separation of the central palindrome. Specific unwinding of site II must be independent of EP melting or AT untwisting.

As evidence for this, we showed that T antigen has the ability to specifically unwind the central palindrome in the absence of origin flanking sequences (Fig. 5A). As expected, this reaction was ATP hydrolysis and origin dependent, since neither ADP nor ATPS could support the reaction and a DNA with a scrambled origin sequence could not be unwound (Fig. 5D and E). Importantly, two of the class A mutants (D429A and N515S) were nearly completely defective in unwinding site II-only DNA (Fig. 5A and B). These observations point to the conclusion that the sequence-specific melting of the central palindrome by T antigen is a component of the process of origin unwinding and residues D429 and N515 in the hydrophilic channel play important roles (see Fig. 1 for the location of these residues in the channel). The unwinding of the 31-bp DNA is a rather slow reaction. It is three to six times slower than with longer DNAs containing both the EP and AT regions (unpublished data), demonstrating the importance the EP and AT regions in facilitating core origin unwinding.

Further, by mutating the third- and fourth-position GC base pairs within each pentanucleotide to TA base pairs, we showed that pentanucleotides 1 and 4 appear to be far more important for unwinding of the central palindrome than pentanucleotides 2 and 3 (Fig. 6A). These differences were not due to a defect in binding these mutant truncated origins (Fig. 6B). It should be pointed out that this preference for the integrity of pentanucleotides 1 and 4 differs from the preference that the OBDs have for the origin. They bind to P3 with highest affinity, followed by P1, P4, and P2, as determined by fluorescence anisotropy (19).

Then, systematic mutation of each base pair within the entire site II region (Fig. 7) showed that some base pairs within each pentanucleotide sequence were more important than others. In particular, the third and fourth GC base pairs of pentanucleotide 1 were the most important, followed by the fourth positions of pentanucleotides 2, 3, and 4. Mutation of the GC base pair between pentanucleotides 1 and 2 also affected unwinding (Fig. 7), although changes in the other "in-between" base pairs had no effect. Overall, these data point to the presence of distinct sequences within site II for contributing uniquely to the melting reaction after binding has occurred.

How does T antigen specifically unwind the site II sequence? Modeling of the presumptive double hexamer structure over 31-bp DNA using published structure information (3, 20, 25, 28, 29, 35, 36) shows that the ends of the DNA, if present in the central channel, would be positioned at the junction between the small and large tiers of the hexamerized helicase domains (Fig. 8, top). Therefore, direct contact between the β-hairpins in the large tiers and this DNA is not possible. In the context of a complete origin, the flanking EP and AT sequences would associate with the large tiers, where the β-hairpin structures would be able to melt or untwist them (36). One possibility (Fig. 8, arrow 1) is that the OBDs melt the DNA in the central palindrome (P1 and P4) when they first bind to them or later when they associate with one another in the form of a lock washer hexamer (28). In the case of papillomaviruses, binding of a single OBD dimer of E1 to the origin is reported to cause local distortion at the origin (37). This distortion becomes even more pronounced and leads to the ultimate melting at the origin as E1 assembles into a hexamer or double hexamer (40). However, we have failed to detect any DNA unwinding with the T antigen OBD alone or in combination with the helicase domain (data not shown). Nonetheless, it is possible that in the intact protein, the helicase domains actively participate in unwinding the central palindrome by connection with the OBDs. If true, residues in the hydrophilic channels would have to be involved in the reaction. They may participate by transducing the chemical energy generated in the P-pocket of the hydrophilic channel to a mechanical force that separates site II DNA by the OBDs, perhaps by the "open spiral" to "closed ring" mechanism suggested by Bochkareva et al. (3). It is clear that the binding of the OBD by itself to the origin appears to be insufficient to alter the DNA structure and permit origin unwinding (3). In support of this model, the base pairs in each pentanucleotide important for DNA unwinding (Fig. 7) are similar, although not identical, to those needed for initial binding of the OBDs to the origin (19). One difficulty with the model is that TA-to-GC substitutions at the second positions of P1 and P2 should make unwinding more difficult, not easier as is the case (Fig. 7). In truth, the model cannot readily explain why any origin mutation would facilitate unwinding.

View larger version (31K): [in this window] [in a new window]

FIG. 8. Models of unwinding of the central palindrome at the origin. The top illustration shows the modeling of a 31-bp DNA over a double hexamer of T antigen based on available structure information. The ends of the DNA lie at the junction between the small and large tiers within the central channel. In model 1 (left), the OBDs are assumed to melt pentanucleotides 1 and 4 as they bind the DNA or as hexamerized OBDs form after DNA binding. In model 2 (center), the small tiers of the helicase domains, with the help of the large tiers, attach to the DNA and melt it, presumably starting at pentanucleotides 1 and 4. In model 3 (right), the helicase domains move inward toward the center of the origin in the presence of ATP. At the same time, the OBDs release their bound DNA and move out toward the surface of the helicase domain. After this reaction, the DNA is unwound from the ends. The 5' ends of each strand associate with the β-hairpin structures in the central channel of the helicase domain, and the 3' ends are routed to the surface of the helicase domain.

Another possibility (Fig. 8, arrow 2) is that the two tiers of the helicase domain untwist and twist relative to each other to separate site II DNA. An "iris" mechanism of DNA unwinding was previously proposed based on the crystal structure of the T antigen helicase (21, 29). In the "iris" motion, the hydrophobic interactions at the D1-D1 interface and hydrophilic interaction at the D2-D2 interface of neighboring helicase domains might allow the large and small tiers to slide against each other in response to ATP binding and hydrolysis and somehow induce the small tiers to unwind DNA. Here, mutation of the hydrophilic channel residues interfere with the "iris" motion. This second model, however, cannot readily explain the specific origin sequence requirement for T antigen to melt 31-bp DNA. Furthermore, this idea suffers from the lack of any data supporting the possibility that the small tiers of the helicase domain can participate in DNA unwinding.

A third explanation (Fig. 8, arrow 3) is that there is a major structural reorganization of the double-hexamer structure that causes the helicase domains to move inward toward the center of the origin and that displaces the OBDs toward the surface of the small tiers of the helicase domain. This dramatic change would permit the β-hairpin structure of the large tier of the helicase domain to attach to the ends of the DNA. In this mechanism, unwinding is mediated by the helicase domain directly. The 5' end of each strand would be threaded through the central channel, and the 3' end of each strand would go around on the outside of the helicase domain (Fig. 8, arrow 3), perhaps in between monomers through one of the hydrophilic channels. One conceptual advantage of this model is that the separated single strands would be threaded through the helicase in the same way as with a complete origin. Mutations of D429 and N515 (see Fig. 1) severely affected unwinding of site II DNA (Fig. 5), so perhaps these residues are involved in interacting with the separated strands (N515 with the strand in the central channel and D429 with the displaced strand). However, as in model 2, it is difficult to completely understand how certain mutations in site II interfere with unwinding. Mutations that enhance unwinding might do so by permitting, in model 3, easier threading of separated strands. Our interpretation of both effects is complicated by the fact that the OBDs have to initiate binding to the 31-bp DNA and, therefore, base pair substitutions affecting proper binding and complex assembly would also impact the efficiency of unwinding.

Although there is no direct evidence supporting any of the three models, there is some evidence supporting model 3. Borowiec et al. (5) have observed that the pattern of structural distortion moves from the EP region and AT track inwards by 15 bp toward the center of the origin as ATP is hydrolyzed, suggesting that the helicase domain gains access to the fringes of the central palindrome in an energy-dependent reaction. In the context of a complete origin, it has been proposed that the EP region is melted and the AT track untwisted directly by the helicase domains as they assemble over those regions of the origin (36). With ATP hydrolysis, this melting and/or untwisting might spread inward to separate the DNA strands in P1 and P4, in agreement with our observation that these two pentanucleotides are critical for unwinding the central palindrome (Fig. 6). This model is also supported by the proposed mechanism of helicase assembly in papillomaviruses. With these viruses, E2 is the origin recognition protein and, after it binds, E1, the helicase, is recruited (38, 41, 42). As E1 assembles into a hexamer, E2 is displaced and E1 occupies the central region of the origin (54). This is an interesting and appealing parallel with model 3.

Although D429A and N515S were clearly defective at unwinding the central palindrome by itself, N449S was normal (Fig. 5A and B). However, N449S was unable to unwind site II plus the EP region or site II plus the AT track (Fig. 4), nor could it unwind an origin containing both flanking sequences (52) or an origin containing a melted EP region (Fig. 3). Our explanation for mutant N449S is that, although able to unwind 31-bp DNA, it is unable to thread separated DNA strands into the proper places in the helicase from longer DNAs, perhaps because key contacts are missing. Additional mutational analyses are needed to clarify this difference.

In conclusion, we presented data that strongly indicate that T antigen has the ability to unwind the central palindrome specifically and that this energy-requiring reaction is part of a complex process that is used to unwind the complete origin.

 
This study was supported by PHS grant CA36118 to D.T.S.

We are indebted to Rupa Roy for technical support.

 
* Corresponding author. Mailing address: Department of Biological Sciences, University of Delaware, Newark, DE 19716-2590. Phone: (302) 831-8547. Fax: (302) 831-2281. E-mail: dsimmons{at}udel.edu

Published ahead of print on 14 January 2009.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Alexandrov, A. I., M. R. Botchan, and N. R. Cozzarelli. 2002. Characterization of simian virus 40 T-antigen double hexamers bound to a replication fork: the active form of the helicase. J. Biol. Chem. 277:44886-44897.[Abstract/Free Full Text]
2
2. Arthur, A. K., A. Höss, and E. Fanning. 1988. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids. J. Virol. 62:1999-2006.[Abstract/Free Full Text]
3
3. Bochkareva, E., D. Martynowski, A. Seitova, and A. Bochkarev. 2006. Structure of the origin-binding domain of simian virus 40 large T antigen bound to DNA. EMBO J. 25:5961-5969.[CrossRef][Medline]
4
4. Borowiec, J. A., F. B. Dean, and J. Hurwitz. 1991. Differential induction of structural changes in the simian virus 40 origin of replication by T antigen. J. Virol. 65:1228-1235.[Abstract/Free Full Text]
5
5. Borowiec, J. A., and J. Hurwitz. 1988. Localized melting and structural changes in the SV40 origin of replication induced by T-antigen. EMBO J. 7:3149-3158.[Medline]
6
6. Bullock, P. A. 1997. The initiation of simian virus 40 DNA replication in vitro. Crit. Rev. Biochem. Mol. Biol. 32:503-568.[Medline]
7
7. Chen, L., W. S. Joo, P. A. Bullock, and D. T. Simmons. 1997. The N-terminal side of the origin-binding domain of simian virus 40 large T antigen is involved in A/T untwisting. J. Virol. 71:8743-8749.[Abstract]
8
8. Cook, P. R. 1999. The organization of replication and transcription. Science 284:1790-1795.[Abstract/Free Full Text]
9
9. Dean, F. B., J. A. Borowiec, Y. Ishimi, S. Deb, P. Tegtmeyer, and J. Hurwitz. 1987. Simian virus 40 large tumor antigen requires three core replication origin domains for DNA unwinding and replication in vitro. Proc. Natl. Acad. Sci. USA 84:8267-8271.[Abstract/Free Full Text]
10
10. Dean, F. B., and J. Hurwitz. 1991. Simian virus 40 large T antigen untwists DNA at the origin of DNA replication. J. Biol. Chem. 266:5062-5071.[Abstract/Free Full Text]
11
11. Deb, S., A. L. DeLucia, C. P. Baur, A. Koff, and P. Tegtmeyer. 1986. Domain structure of the simian virus 40 core origin of replication. Mol. Cell. Biol. 6:1663-1670.[Abstract/Free Full Text]
12
12. Deb, S., A. L. DeLucia, A. Koff, S. Tsui, and P. Tegtmeyer. 1986. The adenine-thymine domain of the simian virus 40 core origin directs DNA bending and coordinately regulates DNA replication. Mol. Cell. Biol. 6:4578-4584.[Abstract/Free Full Text]
13
13. Deb, S., S. Tsui, A. Koff, A. L. DeLucia, R. Parsons, and P. Tegtmeyer. 1987. The T-antigen-binding domain of the simian virus 40 core origin of replication. J. Virol. 61:2143-2149.[Abstract/Free Full Text]
14
14. Deb, S. P., and P. Tegtmeyer. 1987. ATP enhances the binding of simian virus 40 large T antigen to the origin of replication. J. Virol. 61:3649-3654.[Abstract/Free Full Text]
15
15. DeLucia, A. L., S. Deb, K. Partin, and P. Tegtmeyer. 1986. Functional interactions of the simian virus 40 core origin of replication with flanking regulatory sequences. J. Virol. 57:138-144.[Abstract/Free Full Text]
16
16. Enemark, E. J., and L. Joshua-Tor. 2006. Mechanism of DNA translocation in a replicative hexameric helicase. Nature 442:270-275.[CrossRef][Medline]
17
17. Fanning, E. 1992. Simian virus 40 large T antigen: the puzzle, the pieces, and the emerging picture. J. Virol. 66:1289-1293.[Free Full Text]
18
18. Fanning, E., and R. Knippers. 1992. Structure and function of simian virus 40 large tumor antigen. Annu. Rev. Biochem. 61:55-85.[CrossRef][Medline]
19
19. Fradet-Turcotte, A., C. Vincent, S. Joubert, P. A. Bullock, and J. Archambault. 2007. Quantitative analysis of the binding of simian virus 40 large T antigen to DNA. J. Virol. 81:9162-9174.[Abstract/Free Full Text]
20
20. Gai, D., D. Li, C. V. Finkielstein, R. D. Ott, P. Taneja, E. Fanning, and X. S. Chen. 2004. Insights into the oligomeric states, conformational changes, and helicase activities of SV40 large tumor antigen. J. Biol. Chem. 279:38952-38959.[Abstract/Free Full Text]
21
21. Gai, D., R. Zhao, D. Li, C. V. Finkielstein, and X. S. Chen. 2004. Mechanisms of conformational change for a replicative hexameric helicase of SV40 large tumor antigen. Cell 119:47-60.[CrossRef][Medline]
22
22. Goetz, G. S., F. B. Dean, J. Hurwitz, and S. W. Matson. 1988. The unwinding of duplex regions in DNA by the simian virus 40 large tumor antigen-associated DNA helicase activity. J. Biol. Chem. 263:383-392.[Abstract/Free Full Text]
23
23. Humphrey, W., A. Dalke, and K. Schulten. 1996. VMD: visual molecular dynamics. J. Mol. Graph. 14:27-38.
24
24. Jiao, J., and D. T. Simmons. 2003. Nonspecific double-stranded DNA binding activity of simian virus 40 large T antigen is involved in melting and unwinding of the origin. J. Virol. 77:12720-12728.[Abstract/Free Full Text]
25
25. Joo, W. S., H. Y. Kim, J. D. Purviance, K. R. Sreekumar, and P. A. Bullock. 1998. Assembly of T-antigen double hexamers on the simian virus 40 core origin requires only a subset of the available binding sites. Mol. Cell. Biol. 18:2677-2687.[Abstract/Free Full Text]
26
26. Joo, W. S., X. Luo, D. Denis, H. Y. Kim, G. J. Rainey, C. Jones, K. R. Sreekumar, and P. A. Bullock. 1997. Purification of the simian virus 40 (SV40) T antigen DNA-binding domain and characterization of its interactions with the SV40 origin. J. Virol. 71:3972-3985.[Abstract]
27
27. Kim, H. Y., B. Y. Ahn, and Y. Cho. 2001. Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen. EMBO J. 20:295-304.[CrossRef][Medline]
28
28. Kumar, A., G. Meinke, D. K. Reese, S. Moine, P. J. Phelan, A. Fradet-Turcotte, J. Archambault, A. Bohm, and P. A. Bullock. 2007. Model for T-antigen-dependent melting of the simian virus 40 core origin based on studies of the interaction of the beta-hairpin with DNA. J. Virol. 81:4808-4818.[Abstract/Free Full Text]
29
29. Li, D., R. Zhao, W. Lilyestrom, D. Gai, R. Zhang, J. A. DeCaprio, E. Fanning, A. Jochimiak, G. Szakonyi, and X. S. Chen. 2003. Structure of the replicative helicase of the oncoprotein SV40 large tumour antigen. Nature 423:512-518.[CrossRef][Medline]
30
30. Lin, H.-J. L., R. Upson, and D. T. Simmons. 1992. Nonspecific DNA binding activity of simian virus 40 large T antigen: evidence for the cooperation of two regions for full activity. J. Virol. 66:5443-5452.[Abstract/Free Full Text]
31
31. Luo, X., D. G. Sanford, P. A. Bullock, and W. W. Bachovchin. 1996. Solution structure of the origin DNA-binding domain of SV40 T-antigen. Nat. Struct. Biol. 3:1034-1039.[CrossRef][Medline]
32
32. McClarin, J. A., C. A. Frederick, B. C. Wang, P. Greene, H. W. Boyer, J. Grable, and J. M. Rosenberg. 1986. Structure of the DNA-EcoRI endonuclease recognition complex at 3 Å resolution. Science 234:1526-1541.[Abstract/Free Full Text]
33
33. McVey, D., M. Strauss, and Y. Gluzman. 1989. Properties of the DNA-binding domain of the simian virus 40 large T antigen. Mol. Cell. Biol. 9:5525-5536.[Abstract/Free Full Text]
34
34. Meinke, G., P. A. Bullock, and A. Bohm. 2006. Crystal structure of the simian virus 40 large T-antigen origin-binding domain. J. Virol. 80:4304-4312.[Abstract/Free Full Text]
35
35. Reese, D. K., G. Meinke, A. Kumar, S. Moine, K. Chen, J. L. Sudmeier, W. Bachovchin, A. Bohm, and P. A. Bullock. 2006. Analyses of the interaction between the origin binding domain from simian virus 40 T antigen and single-stranded DNA provide insights into DNA unwinding and initiation of DNA replication. J. Virol. 80:12248-12259.[Abstract/Free Full Text]
36
36. Reese, D. K., K. R. Sreekumar, and P. A. Bullock. 2004. Interactions required for binding of simian virus 40 T antigen to the viral origin and molecular modeling of initial assembly events. J. Virol. 78:2921-2934.[Abstract/Free Full Text]
37
37. Sanders, C. M., and A. Stenlund. 1998. Recruitment and loading of the E1 initiator protein: an ATP-dependent process catalysed by a transcription factor. EMBO J. 17:7044-7055.[CrossRef][Medline]
38
38. Sanders, C. M., and A. Stenlund. 2000. Transcription factor-dependent loading of the E1 initiator reveals modular assembly of the papillomavirus origin melting complex. J. Biol. Chem. 275:3522-3534.[Abstract/Free Full Text]
39
39. Schiedner, G., R. Wessel, M. Scheffner, and H. Stahl. 1990. Renaturation and DNA looping promoted by the SV40 large tumour antigen. EMBO J. 9:2937-2943.[Medline]
40
40. Sclafani, R. A., R. J. Fletcher, and X. S. Chen. 2004. Two heads are better than one: regulation of DNA replication by hexameric helicases. Genes Dev. 18:2039-2045.[Free Full Text]
41
41. Sedman, J., and A. Stenlund. 1995. Co-operative interaction between the initiator E1 and the transcriptional activator E2 is required for replicator specific DNA replication of bovine papillomavirus in vivo and in vitro. EMBO J. 14:6218-6228.[Medline]
42
42. Sedman, J., and A. Stenlund. 1998. The papillomavirus E1 protein forms a DNA-dependent hexameric complex with ATPase and DNA helicase activities. J. Virol. 72:6893-6897.[Abstract/Free Full Text]
43
43. Seinsoth, S., H. Uhlmann-Schiffler, and H. Stahl. 2003. Bidirectional DNA unwinding by a ternary complex of T antigen, nucleolin and topoisomerase I. EMBO Rep. 4:263-268.[CrossRef][Medline]
44
44. SenGupta, D. J., and J. A. Borowiec. 1994. Strand and face: the topography of interactions between the SV40 origin of replication and T-antigen during the initiation of replication. EMBO J. 13:982-992.[Medline]
45
45. Shen, J., D. Gai, A. Patrick, W. B. Greenleaf, and X. S. Chen. 2005. The roles of the residues on the channel beta-hairpin and loop structures of simian virus 40 hexameric helicase. Proc. Natl. Acad. Sci. USA 102:11248-11253.[Abstract/Free Full Text]
46
46. Simmons, D. T. 1986. DNA-binding region of the simian virus 40 tumor antigen. J. Virol. 57:776-785.[Abstract/Free Full Text]
47
47. Simmons, D. T. 2000. SV40 large T antigen: functions in DNA replication and transformation. Adv. Virus Res. 55:75-134.[CrossRef][Medline]
48
48. Simmons, D. T., G. Loeber, and P. Tegtmeyer. 1990. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding. J. Virol. 64:1973-1983.[Abstract/Free Full Text]
49
49. Stahl, H., M. Scheffner, M. Wiekowski, and R. Knippers. 1988. DNA unwinding function of the SV40 large tumor antigen. Cancer Cells 6:105-112.[CrossRef]
50
50. Strauss, M., P. Argani, I. J. Mohr, and Y. Gluzman. 1987. Studies on the origin-specific DNA-binding domain of simian virus 40 large T antigen. J. Virol. 61:3326-3330.[Abstract/Free Full Text]
51
51. Sullivan, C. S., and J. M. Pipas. 2002. T antigens of simian virus 40: molecular chaperones for viral replication and tumorigenesis. Microbiol. Mol. Biol. Rev. 66:179-202.[Abstract/Free Full Text]
52
52. Wang, W., D. Manna, and D. T. Simmons. 2007. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication. J. Virol. 81:4510-4519.[Abstract/Free Full Text]
53
53. Wessel, R., U. Ramsperger, H. Stahl, and R. Knippers. 1992. The interaction of SV40 large T antigen with unspecific double-stranded DNA: an electron microscopic study. Virology 189:293-303.[CrossRef][Medline]
54
54. West, M., and V. G. Wilson. 2002. Hydrophobic residue contributions to sequence-specific DNA binding by the bovine papillomavirus helicase E1. Virology 296:52-61.[CrossRef][Medline]
55
55. Wiekowski, M., M. W. Schwarz, and H. Stahl. 1988. Simian virus 40 large T antigen DNA helicase. Characterization of the ATPase-dependent DNA unwinding activity and its substrate requirements. J. Biol. Chem. 263:436-442.[Abstract/Free Full Text]
56
56. Wun-Kim, K., R. Upson, W. Young, T. Melendy, B. Stillman, and D. T. Simmons. 1993. The DNA-binding domain of simian virus 40 tumor antigen has multiple functions. J. Virol. 67:7608-7611.[Abstract/Free Full Text]

---

Journal of Virology, April 2009, p. 3312-3322, Vol. 83, No. 7
0022-538X/09/$08.00+0     doi:10.1128/JVI.01867-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wang, W. Articles by Simmons, D. T. Search for Related Content PubMed PubMed Citation Articles by Wang, W. Articles by Simmons, D. T.