This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eng, F. J.
Right arrow Articles by Branch, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eng, F. J.
Right arrow Articles by Branch, A. D.
Right arrowPubmed/NCBI databases
*Protein

 Previous Article  |  Next Article 

Journal of Virology, April 2009, p. 3104-3114, Vol. 83, No. 7
0022-538X/09/$08.00+0     doi:10.1128/JVI.01679-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Internal Initiation Stimulates Production of p8 Minicore, a Member of a Newly Discovered Family of Hepatitis C Virus Core Protein Isoforms{triangledown}

Francis J. Eng,1 Jose L. Walewski,1 Arielle L. Klepper,1 Sarah L. Fishman,1 Suresh M. Desai,2 Laura K. McMullan,3,{dagger} Matthew J. Evans,3,{ddagger} Charles M. Rice,3 and Andrea D. Branch1*

Division of Liver Diseases, Mount Sinai School of Medicine, New York, New York 10029,1 Abbott Laboratories, Abbott Park, Illinois 60064,2 Center for the Study of Hepatitis C, The Rockefeller University, New York, New York 100213

Received 6 August 2008/ Accepted 28 December 2008


arrow
ABSTRACT
 
The hepatitis C virus (HCV) core gene is more conserved at the nucleic acid level than is necessary to preserve the sequence of the core protein, suggesting that it contains information for additional functions. We used a battery of anticore antibodies to test the hypothesis that the core gene directs the synthesis of core protein isoforms. Infectious viruses, replicons, and RNA transcripts expressed a p8 minicore containing the C-terminal portion of the p21 core protein and lacking the N-terminal portion. An interferon resistance mutation, U271A, which creates an AUG at codon 91, upregulated p8 expression in Con1 replicons, suggesting that p8 is produced by an internal initiation event and that 91-AUG is the preferred, but not the required, initiation codon. Synthesis of p8 was independent of p21, as shown by the abundant production of p8 from transcripts containing an UAG stop codon that blocked p21 production. Three infectious viruses, JFH-1 (2a core), J6/JFH (2a core), and H77/JFH (1a core), and a bicistronic construct, Bi-H77/JFH, all expressed both p8 and larger isoforms. The family of minicores ranges in size from 8 to 14 kDa. All lack the N-terminal portion of the p21 core. In conclusion, the core gene contains an internal signal that stimulates the initiation of protein synthesis at or near codon 91, leading to the production of p8. Infectious viruses of both genotype 1 and 2 HCV express a family of larger isoforms, in addition to p8. Minicores lack significant portions of the RNA binding domain of p21 core. Studies are under way to determine their functions.


arrow
INTRODUCTION
 
The hepatitis C virus (HCV) core gene has structural and functional complexity that is unusual for the nucleocapsid gene of a positive-sense RNA virus. Bioinformatics provided the first evidence that the HCV core gene has unusual properties. Comparative sequence analysis revealed that the nucleotide sequence is far more conserved than is necessary to preserve the amino acid sequence of the nucleocapsid (core) protein (21, 38, 50). The extent of nucleotide conservation is explained in part by the presence of embedded RNA structures, including stem-loop IV (SLIV) (18), which positions the AUG start codon for the initiation of polyprotein synthesis, and SLV and SLVI, which enhance HCV polyprotein synthesis through unknown mechanisms (29, 46). In addition to SLIV, SLV, and SLVI, the core gene contains several putative RNA structures that were identified by application of thermodynamic folding programs and comparative phylogenetic analysis (38, 43, 49). Further evidence that the RNA of the core gene contains complex structures was provided by cell-free enzymatic studies showing that it is a substrate for cleavage by both RNase P (30) and RNase III (7), two RNA processing enzymes that recognize three-dimensional RNA structures.

In addition to multiple intramolecular interactions that create RNA structures, the core gene contains not only the nucleocapsid coding sequence, which comprises the initial portion of the main open reading frame (ORF) of the virus, but also a conserved overlapping ORF whose products are referred to as alternate reading frame proteins (ARFPs) (11, 50), frameshift proteins (10, 54), and core + 1 (45). ARFPs stimulate specific immune responses during natural infections (10, 13, 22, 40, 45, 50, 54) and have been associated with the induction of interleukin-8 (14), suppression of cellular p21 (6), perturbation of the tubulin cytoskeleton (41), and enhancement of c-myc activity (27, 53). Like the hypervariable region of the HCV E2 envelope protein (15), products of the N-terminal portion of ARFPs are not required for HCV infection (29). The ARFPs may be analogous to the L* proteins of Theiler's virus (23), which are required for viral persistence but not for viral replication (44). The following three different mechanisms have been reported to mediate expression of HCV's ARF: ribosomal frameshifting (10, 54), transcriptional slippage (10, 33, 54), and internal initiation (5, 47). One explanation for the inconsistencies in the data about the biochemical processes leading to ARF expression could be that the RNA in this portion of the HCV genome contains a number of structures and signals whose ability to recruit ribosomes is regulated. Interestingly, a recent study showed that translation of the ARF is inhibited by the core protein (52).

The presence of unexplained sequence constraints, reports of two different signals for ribosomal frameshifting in the main reading frame (10, 54), and the presence of three signals for the internal initiation of protein synthesis in the +1 reading frame (5, 47) suggested to us that signals within the core gene may mediate interactions with ribosomes that lead to the synthesis of novel variants of the core protein. To test this hypothesis, we obtained a battery of antibodies directed against epitopes spanning the length of the core protein and used Western blots to seek evidence of core protein isoforms.

We examined extracts of Huh-7.5 cells supporting three infectious viruses, namely, JHF-1 (26, 48, 55), J6/JFH, and H77/JFH (29), and a bicistronic construct, namely, Bi-H77/JFH, for core protein isoforms. Using monoclonal antibodies (MAbs) directed against distal portions of the core protein, we found a family of minicore proteins ranging in size from 8 kDa to 14 kDa. Antibodies specific for the proximal portion of the core protein did not detect the minicores, indicating that these variant forms lack the N-terminal portion of the core protein. In extracts of cells replicating JFH-1, the expression level of these minicore proteins was comparable to that of the mature, 21-kDa core protein, p21. The 8-kDa (p8) minicore protein was also detected in Huh-7.5 cells supporting full-length genotype 1b neomycin-selectable replicons. Expression of p8 was enhanced in replicons with a U271A mutation in codon 91 that confers clinically significant interferon resistance (1-3). Experiments with in vitro transcripts revealed that p8 synthesis is not dependent on the synthesis of the mature p21 core protein and occurs in 293T cells transfected with transcripts in which the AUG of the main reading frame has been replaced by a UAG stop codon. Our experiments demonstrate that the HCV core gene contains a signal that stimulates the internal initiation of protein synthesis at or near codon 91, and they show that infectious HCV expresses a newly discovered family of core protein isoforms.


arrow
MATERIALS AND METHODS
 
Cells and culture conditions. Huh-7.5 cells (9) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 0.1 mM nonessential amino acids, and 1x penicillin-streptomycin-glutamine. HCV replicons were maintained in Huh-7.5 cells grown in the presence of G418 (specific activity, 0.35 mg/ml). The replicons are described elsewhere (42). Briefly, Con1-FLneo is a full-length genotype 1b construct which contains an S2204I mutation in NS5A and a neomycin resistance gene (8, 9). Variants of Con1-FLneo with site-directed changes at either codon 70 (to CGG) or codon 91 (to AUG) and a new line of parental Con1-FLneo were selected in the presence of G418 (specific activity, 0.35 mg/ml) in Huh-7.5 cells after RNA transfection. HEK293T (human embryonic kidney) cells were maintained in DMEM with 10% FBS and 1x penicillin-streptomycin-glutamine.

Plasmid constructions. The plasmid pFL-J6/JFH, which contains a chimeric full-length 2a genome, was previously described (26). It carries the JFH-1 sequence for the 5'-untranslated region (5' UTR), the J6 sequence for core through NS2, and the JFH-1 sequence for NS3 through the end of the genome. The virus derived from this plasmid is called J6/JFH. The pJFH-1 plasmid, which contains the complete JFH-1 genome, was made by cloning a synthetic JFH-1 DNA fragment containing the JFH-1 5' UTR and extending into NS3 (AgeI to AvrII sites) into pJ6/JFH-1. The virus derived from this plasmid is called JFH-1. The plasmid pFL-H77/JFH-1 carries a 1a/2a chimeric genome in which the 5' UTR and coding region for core through NS2 are the H77 sequence and NS3 through the 3' UTR is the JFH-1 sequence. There are adaptive mutations in the coding regions for E1 (I348S) and NS3 (S1103T), facilitating virus production in Huh-7.5 cells. The virus derived from this plasmid is called H77/JFH. The bicistronic construct pBiNS2H-JFH-1 (S+T) is a chimera of H77 and JFH-1. The infectious virus associated with this construct is referred to as Bi-H77/JFH in this report. The entire 5' UTR and the ORF through NS2 are derived from the H77 genome. The second cistron is expressed by the encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES), with an AUG codon introduced at the beginning of NS3. The coding region for NS3 through the end of the genome is from JFH-1. The E1 protein has an adaptive I-to-S mutation in its 57th amino acid, and the NS3 protein has an adaptive S-to-T mutation in its 77th amino acid. Together, these mutations enhance virus production in Huh-7.5 cells. Several intermediate cloning steps were used to generate the bicistronic construct pBiNS2H-JFH-1 (S+T). A PmeI site was introduced immediately before the EMCV IRES in pBiNS2J6-JFH-1 (LKM 554), where the EMCV IRES was positioned between the J6 sequence of core through NS2 and the JFH-1 sequence of NS3 through NS5B. To introduce the H77 sequence into the first cistron, an intermediate bicistronic plasmid, pBiNS2H-JFH-1 (LKM 556), was created by a triple ligation. The first piece was an AgeI-to-SacI fragment from pH-JFH-1 (S+T) (ME/LKM 491), where the 5' UTR was the JFH-1 sequence, core through NS2 was the H77 sequence, and NS3 through the 3' UTR was the JFH-1 sequence. The second fragment was a SacI-to-PmeI fragment generated by PCR using the H77 sequence as a template. The third fragment was a PmeI-to-AgeI fragment from the vector pBiNS2J6-JFH-1 (LKM 554). The adaptive mutations of I348S in E1 and S1103T in NS3 were introduced to produce pNS2BiH-JFH-1 (S+T) (LKM 557). To generate the 5' UTR from the H77 sequence, pH-JFH-1 (S+T) (LKM 491) was digested with EcoRI, the ends were filled in with Klenow fragment, and then the plasmid was digested with KpnI. The plasmid pH(L+I) (LKM 145) was digested with XbaI, the ends were filled in with Klenow fragment, and then the plasmid was digested with KpnI. These two fragments were ligated to create pH(5' UTR-NS2)-JFH-1(NS3-3' UTR) (V+T) (LKM 520). pBiNS2H77-JFH-1 (S+T) (LKM 697) was created by triple ligation. Vector pBiNS2H-JFH-1 (S+T) (LKM 557) was digested with BglII and EcoRI, and the resultant fragment was ligated with a second, KpnI-to-BglII fragment from pBiNS2H-JFH-1 (S+T) (LKM 557) and a third, EcoRI-to-KpnI fragment from pH(5'UTR-NS2)-JFH-1(NS3-3' UTR) (S+T) (LKM 520).

The plasmids used to generate in vitro-synthesized transcripts for RNA transfection into HEK293T cells have the backbone of vector pIRES-hrGFP II (Stratagene). This plasmid has both a cytomegalovirus promoter to allow RNA transcription in eukaryotic cells and a bacteriophage T7 promoter to allow RNA transcription in vitro. Plasmids pLPE/IRES-Core-E1 and pMFX/IRES-Core-E1 (genotypes 1a and 1b, respectively) contain the HCV genome from the 5' UTR through the first two-thirds of the E1 gene. Most of this segment was cloned from patient sera via reverse transcription-PCR (RT-PCR) and was ligated as an EcoRI-to-SwaI fragment into EcoRI and EcoRV sites in pIRES-hrGFPII. pLPE/IRES-Core-E1 and pMFX/IRES-Core-E1 have 38 nucleotides of the 5' UTR derived from synthetic consensus 1a and 1b sequences, respectively. Both clones end with the appropriate 1a or 1b consensus sequence containing E1 nucleotides 1296 to 1321. The consensus sequences were incorporated into the primers used in PCR amplification. Plasmid pHIJ, which contains the core gene of HCV-J (genotype 1b), was made by excising HCV nucleotides 340 to 914 from an HCV-J-pcDNA3.1 (Invitrogen) plasmid kindly provided by W. Schmidt (University of Iowa) (51), using PmeI and NotI, and inserting the fragment into the EcoRV and NotI sites of pIRES-hrGFP II. pHIJ encodes 191 amino acids of the HCV core and an additional 100 upstream nucleotides (GGGAGACCCAAGCTTCTGGAGGCCCGGGCTTTCAGGGTACCGAAGAAGGATCCAAGGA GGAATTCTGCAGATAAACTTAAGCTTGGTACCGAGCTCGGAT), derived from the vector's multiple cloning site, after the T7 promoter. Transcripts from this plasmid are referred to as HCV-J.

RT-PCR and cloning of clinical isolates of HCV. Sera from HCV-infected patients were collected with institutional review board approval. Viral RNA was isolated using a QIAamp Viral RNA Mini kit (Qiagen) and reverse transcribed in a 20-µl reaction mix with a primer (5'-CGTAGGGGACCAGTTCATCATCAT) that anneals to nucleotides 1305 to 1328 in E1 and with Transcriptor reverse transcriptase (Roche), with incubation at 60°C for 10 min followed by incubation at 65°C for 40 min. Two microliters of the RT product was amplified by two rounds of PCR using Phusion high-fidelity PCR kits (Finnzymes). In the first round, the RT primer and a second primer, 5'-GGGCGACACTCCACCAT, which binds nucleotides 17 to 34, were used. In the second round, the genotype 1a LPE amplicons were primed with 1A-RI-5' UTR (5'-GCCTAGAATTCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATC), which contains consensus genotype 1a nucleotides 1 to 38 and an EcoRI site, and 1A-E1Rev-Swa (5'-CCTATATTTAAATGACCAGTTCATCATCATATCCCATGC), which contains a reverse complement consensus 1a sequence, nucleotides 1321 to 1296, and a SwaI site. Similarly, the 1b MFX amplicons were primed with 1B-RI-5' UTR (5'-GCCTAGAATTCGCCAGCCCCCGATTGGGGGCGACACTCCACCATAGATC) and 1B-E1Rev-Swa (5'-CCTATATTTAAATGACCAGTTCATCATCATATCCCAAGC). PCR was performed using a Phusion high-fidelity PCR kit (Finnzymes). In the first-round PCR, a 20-µl reaction mix was incubated at 98°C for 40 s and then subjected to 35 cycles of 98°C for 10 s, 62°C for 30 s, and 72°C for 45 s. In the second-round PCR, 2 µl of the first-round product was amplified for 28 cycles as described above, except without the annealing step of 62°C for 30 s. Plasmid pMFX/Core-E1, which contains the HCV sequence from nucleotides 331 to 1321, was derived from pMFX by subcloning a PCR product obtained using primers MFX-SL4-RI-Fwd (5'-GCGCGAATTCGACCGTGCACCATGAGCACG) and MFX-E1-NotI-Rev (5'-GGGTGCGGCCGCACCAGTTCATCATCATATCCCAAGCCAT). The PCR product was digested with EcoRI and NotI and inserted into the EcoRI and NotI sites of a pIRES-hrGFPII vector from which the EMCV IRES and green fluorescent protein gene had been removed by BstEII and XhoI digestion, followed by incubation with the Klenow fragment and religation. This plasmid contains bases that produce SLIV of HCV (which contains the HCV initiation codon), and the sequence extends through the first two-thirds of E1 fused to an in-frame 3x FLAG epitope. Transcripts from this construct appear to be processed correctly at the core-E1 junction by the signal peptidase and the signal peptide peptidase, since p21 core is produced. Transcripts from pLPE/IRES-Core-E1, pMFX/IRES-Core-E1, pMFX/Core-E1/91UUG, and pMFX/Core-E1/91AUG have a 65-base-long segment, GGGAGACCCAAGCTTCTGGAGGCCCGGGCTTTCAGGGTACCGAAGAAGGATCCAAGGAGGAATTC, upstream of the HCV sequence that is derived from the vector.

Site-directed mutagenesis. Mutagenesis was performed using a QuikChange XL site-directed mutagenesis kit (Stratagene) to create pHIJ/UAG, which expresses a UAG stop codon rather than the AUG start codon, and pMFX/Core-E1/91UUG, which expresses UUG at codon 91, rather than AUG. For the directed mutagenesis of codon 70 (CAG to CGG) or 91 (UUG to AUG) in Con1-FLneo, the method of Higuchi et al. was utilized (17). A 2.2-kb PmeI-NotI fragment carrying the mutation was then inserted into the Con1-FLneo plasmid. Sequence analysis was performed to confirm the site-directed mutations.

In vitro transcription. To generate in vitro transcripts representing JFH-1, J6/JFH, H77/JFH, and Bi-H77/JFH for transfection into Huh-7.5 cells, plasmids were linearized with XbaI, purified using MinElute PCR purification kits (Qiagen), and incubated overnight using a T7 RiboMax large-scale RNA production system (Promega) or incubated with T7 MEGAscript (Ambion). RNA transcripts were treated with DNase for 20 min and purified using RNeasy Mini kits (Qiagen). Similar methods were used to produce transcripts for electroporation into Huh-7.5 cells. To generate transcripts for transfection into HEK293T cells, the pIRES-hrGFP II-based plasmids were linearized with BstEII, which cuts just before the EMCV IRES. Uncapped transcripts were made using T7 MEGAscript (Ambion), and capped transcripts were made using Message Machine T7 Ultra (Ambion). The transcripts were DNase treated, polyadenylated using a poly(A) tailing kit (Ambion), and purified with MEGAclear (Ambion).

Transfection and electroporation. Transfection of full-length genomic transcripts into Huh-7.5 cells was performed with Lipofectamine 2000 (Invitrogen). Either 3 x 105 to 4 x 105 cells (six-well dishes) or 2.0 x 106 to 2.4 x 106 cells (10-cm dishes) were plated approximately 24 h before transfection. For six-well dishes, 2.5 µg of RNA in 250 µl Opti-Mem (Invitrogen) was mixed with 5.0 µl of Lipofectamine 2000 in 250 µl Opti-Mem for 20 min and then added to the cells, which were in 2 ml of DMEM complete for Huh-7.5 cells without antibiotics. For 10-cm dishes, 15.0 µg RNA in 1.5 ml Opti-Mem was mixed with 30 µl Lipofectamine 2000 in 1.5 ml Opti-Mem for 20 min and then added to the cells, which were in 15 ml culture medium. The transfection complexes were left on the cells for approximately 24 h. Cells were washed with phosphate-buffered saline and then cultured in medium lacking antibiotics. Transfection of transcripts into HEK293T cells was performed with TransMessenger reagent (Qiagen). A total of 8 x 106 cells (near confluence) were plated in 10-cm dishes 24 h before transfection. For transfection, 40 µl of Enhancer R was mixed with 950 µl of EC-R buffer, 20 µg of RNA was added and incubated for 5 min, 80 µl of TransMessenger reagent was added and incubated for 10 min, 9 ml of serum-free culture medium was added, and the mixture was applied to cells and incubated for 3 h. Extracts were prepared 18 to 20 h after the transfection complexes were put on the cells. Transfection of DNA plasmids into HEK293T cells was performed with Fugene 6 reagent (Roche). Cells were plated in 10-cm dishes to approximately 50% confluence 1 day before and were incubated with 15 µg DNA and 45 µl Fugene 6 for 18 to 24 h. Extracts were prepared at 2 days posttransfection.

Electroporation of HCV RNA into Huh-7.5 cells was performed as follows. Subconfluent Huh-7.5 cells were trypsinized and washed twice with ice-cold phosphate-buffered saline. One microgram of HCV RNA transcript was mixed with 0.4 ml of cells in a suspension of 1.5 x 107 cells/ml and electroporated in a 2-mm-gap cuvette, using a BTX ElectroSquarePorator set to 820 V for five pulses, with a 99-µs pulse length and 1.1-s intervals. After 10 min at room temperature, the RNA and cells were transferred to 9.6 ml of DMEM complete with 10% FBS and nonessential amino acids. Cells were plated into six-well dishes.

Protein extraction and Western blot analysis. Protein extracts from Huh-7.5 cells containing virus or replicons were prepared by adding 2x NuPAGE sample buffer (Invitrogen) containing 5.0% beta-mercaptoethanol directly to the culture dish after the cells had been washed three times with phosphate-buffered saline. Proteins were extracted from cells replicating infectious HCV 3 to 5 days after transfection. A total of 4 x 106 cells were lysed per 100 µl of 2x sample buffer. Samples were sonicated to reduce viscosity, heated at 98°C for 10 min, and stored at –80°C. Protein extracts from HEK293T cells were prepared using cold lysis buffer (10 mM Tris, pH 7.5, 1% Triton X-100, 1% sodium deoxycholate, and 150 mM NaCl) containing EDTA-free protease inhibitors (Complete; Roche). Extracts were sonicated and centrifuged (16,000 x g) at 4°C, and supernatants were stored at –80°C. Prior to electrophoresis, extracts (30 to 50 µl) were reheated at 98°C for 10 min. The samples were fractionated by electrophoresis in NuPAGE 4 to 12% Bis-Tris gels and blotted onto polyvinylidene difluoride membranes with a 0.2-µm pore size (Invitrogen). Proteins were detected using a WesternBreeze chemiluminescence immunodetection system (Invitrogen) and anticore MAb C7-50 (Affinity Bioreagents), MAb 1, and MAb 2 at 1 µg/ml. The epitopes of the MAbs used in this study are given in Table 1. In Western blots, MAb 1 binds the core proteins of H77 and JFH-1 but does not bind J6 efficiently, while MAb 2 binds JFH-1 and J6 but does not bind H77 efficiently. MAb C7-50 binds the JFH-1, J6, and H77 p21 core proteins efficiently.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Epitopes and sources of anticore antibodies

Immunoprecipitation. HEK293T cells were transfected with capped HCV-J transcripts, incubated, and lysed, and 100-µl aliquots of the lysate were incubated overnight at 4°C with anticore MAbs and 20 µl protein G Sepharose 4 fast-flow beads (Amersham Biosciences). The anticore antibodies used were MAb 1F6 (1 µg) (Biodesign International), MAb 7A1 (1.5 µg) (Biodesign International), MAb 1 (1.7 µg), and MAb 2 (2.6 µg).

Real-time PCR quantitation of HCV RNA production. To quantitate HCV RNA relative to β-actin mRNA, a one-step RT-PCR TaqMan assay was performed using a Roche LightCycler 480 RNA master hydrolysis probe kit according to the manufacturer's instructions. Briefly, total RNA was extracted from Huh-7.5 cells and Huh-7.5-containing replicons by use of an RNeasy Mini kit (Qiagen). TaqMan real-time PCRs were performed in 20-µl reaction volumes, using 0.25 µg of total RNA per reaction. Each reaction was performed in triplicate. Primers were used at a final concentration of 375 nM, and the probe was used at a 100 nM concentration. β-Actin control primers and a 6-carboxyfluorescein/BHQ probe were obtained from Applied Biosystems. The HCV primers and probe targeted 5' UTR nucleotides 62 to 309 (forward primer, 5'-CTTCACGCAGAAAGCGTCTA-3'; reverse primer, 5'-ACACCGGAATTGCCAGGACG-3' [both primers were from IDT]; and hydrolysis probe, 5'-6-carboxyfluorescein-TATGAGTGTCGTGCAGCC-BHQ-3'). RT (63°C for 3 min), denaturation (95°C for 30 s), amplification (95°C for 12 s, 55°C for 30 s, and 72°C for 1 s), and detection were performed using a Roche LightCycler 480 real-time PCR system. HCV RNA levels were expressed as changes relative to the β-actin mRNA level.

Nucleotide sequence accession numbers. HCV sequences used in this study and their GenBank accession numbers are as follows: Con1, AJ238799; HCV-J, D90208; MFX, FJ477240; LPE, FJ477239; JFH-1, AB047639; J6, AF177036; and H77, AF009606.


arrow
RESULTS
 
Detection of a signal for internal initiation that promotes expression of an 8-kDa core isoform, p8. A U271A mutation in codon 91 of the HCV core gene predicts interferon/ribavirin resistance and treatment failure for patients with high viral loads of genotype 1b virus (1-3). We introduced this mutation into Con1-FLneo replicons (Fig. 1A and B) and tested the impact of this change, which creates an AUG codon at position 91, on HCV core gene expression. The parental Con1 sequence does not contain any AUG codons in the vicinity of codon 91 in the main ORF; its only in-frame AUG codons are at positions 1 and 134.


Figure 1
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 1. An interferon resistance mutation upregulates expression of p8 minicore. (A) Diagram of the Con1-FLneo replicon. The HCV 5'- and 3'-nontranslated regions and the EMCV IRES are depicted as RNA structures. The HCV proteins are identified as follows: C (core), E1 (envelope 1), E2 (envelope 2), p7, NS2, NS3, 4A (NS4A), 4B (NS4B), NS4A, NS5B, and A (ARFP). Segments of the Con1 protein coding domain are highlighted with wavy lines; the neomycin resistance sequence (Neo) is shown in black. (B) Western blot developed using MAb 1, demonstrating that the Con1-FLneo replicon with AUG at codon 91 (lane d) produces more p8 minicore than do replicons with UUG at codon 91 (lanes b and c). A CAG-to-CGG mutation in codon 70 did not impact p8 expression (lane c). Extracts of Huh-7.5 cells are shown in lane a. The position of p21 core is indicated by an arrow; the position of p8 is identified by a dot. (C) Results of quantitative RT-PCR analysis of HCV RNA (normalized to β-actin mRNA) from four separate cultures of parental 91-UUG Con1-FLneo replicons compared to four separate cultures of 91-AUG Con1-FLneo replicons. The ratio of HCV RNA to β-actin mRNA in the 91-AUG replicons was slightly but significantly lower than that for the 91-UUG replicons (P = 0.025). As expected, no HCV RNA was detected in control cultures of Huh-7.5 cells.

RNA transcripts of the 271A and 271U replicons were transfected into Huh-7.5 cells. Replicon-containing cells were selected with neomycin. Protein extracts of the cells were prepared and analyzed by Western blotting using MAb 1, which recognizes amino acids 104 to 110 in the C-terminal portion of the core protein (Table 1). Both replicons expressed a p8 minicore protein that has not been reported previously, to our knowledge (Fig. 1B, lanes b and d). The conventional p21 core protein was also expressed by both replicons. The amount of p8 expressed by the 271A replicon (91-AUG) (lane d) was greater than the amount produced by the parental 271U replicon (91-UUG) (lane b), suggesting that p8 is produced by internal initiation rather than by cleavage of p21 core protein. Quantitative RT-PCR showed that the increase in p8 was not due to enhanced HCV RNA replication (Fig. 1C). To the contrary, the ratio of HCV RNA to β-actin mRNA in 271A replicon cells (91-AUG) was slightly but consistently lower than the ratio in cells harboring the parental Con1 replicon (P = 0.025 for the comparison). These experiments show that genotype 1b replicons express two core proteins, the conventional p21 core and a p8 minicore isoform. They also indicate that p8 is produced by an internal initiation event in which 91-AUG is the preferred, but not the essential, initiation codon.

Extracts of Huh-7.5 cells did not contain any proteins that reacted significantly with the anticore antibody used in these studies (Fig. 1B, lane a). An interferon sensitivity mutation, A209G, was also introduced into the parental Con1 replicon. This mutation did not alter the level of expression of p8 minicore (Fig. 1B, lane c) and was not explored further.

Further evidence that p8 minicore is not a cleavage product of p21 core but is a core isoform. To rule out the possibility that p8 minicore is produced by cleavage of p21 core, the AUG start codon of the main ORF was changed to a UAG stop codon in DNA plasmids containing HCV-J, a genotype 1b isolate that has 91-AUG. Plasmids were transcribed in vitro with bacteriophage T7 polymerase. RNA transcripts were polyadenylated, modified by the addition of a 5' cap (to enhance stability), and transfected into HEK293T cells (Fig. 2A). These transcripts contained the HCV core gene and lacked the conventional HCV IRES. Western blot analysis using MAb 1 demonstrated that as much or more p8 minicore was produced from transcripts with a UAG stop codon at position 1 than from transcripts with the AUG start codon (Fig. 2B, lanes a and b, lower band). In contrast, far less p21 core was produced from transcripts with the stop codon (Fig. 2B, lane b). This result shows that p8 is produced by internal initiation and is not a cleavage product of p21 core. Qualitatively similar results were obtained using transcripts without a 5' cap, although the quantities of both p21 and p8 were reduced, presumably due to the reduced stability of the uncapped RNAs. The UAG-containing transcript expressed more p8 than the parental transcript, suggesting that initiation at the conventional AUG start codon diminishes initiation at 91-AUG and thereby diminishes p8 production (Fig. 2C). These results show that p8 can be made from transcripts lacking a 5' cap, the conventional HCV IRES, and the start codon of the main ORF.


Figure 2
View larger version (48K):
[in this window]
[in a new window]

  		FIG. 2. Expression of p8 is dependent on an internal signal for the initiation of translation and is not dependent on the AUG start codon or on p21 synthesis; however, p8 is an isoform of the core protein and reacts with four different anticore antibodies. (A) Diagrams of in vitro RNA transcripts. All four transcripts lacked the HCV IRES and contained codons 2 to 191 of the HCV-J core protein sequence, followed by stop codons and a poly(A) tail. (B and C) Western blots of proteins from HEK293T cells transfected with transcripts and probed with MAb 1. Transcripts with a 5' cap are analyzed in panel B. Those without an AUG start codon produced p21 core and p8 minicore, while those with a UAG stop codon in place of the AUG start codon produced p8 minicore but no p21 core. Transcripts without a 5' cap are analyzed in panel C. Those with an AUG start codon produced a small amount of both p21 core and p8 core, while those with a UAG stop codon in place of the AUG start codon produced no detectable p21 core but readily detectable amounts of p8 minicore. (D) Western blot showing that the p8 isoform can be immunoprecipitated with four different anticore MAbs that recognize epitopes in the C-terminal portion of the core protein. The top transcript shown in panel A was transfected into HEK293T cells. Proteins were immunoprecipitated (IP) using MAb 1F6, MAb 7A1, MAb 1, or MAb 2, and the Western blot was developed using MAb 1. The positions of the IgG heavy (H) and light (L) chains, p21 core, and p8 minicore are marked. Lanes with extracts of cells that were not transfected are marked (–), as are those with extracts of transfected cells (+).

Immunoprecipitation/Western blot analysis was used to verify that p8 is an isoform of the core protein. Protein extracts of transfected cells were incubated with four different antibodies that have epitopes in the C-terminal portion of the core protein, namely, MAb 1, MAb 2, MAb 1F6, and MAb 7A1 (Table 1). Antibody-antigen complexes were precipitated by incubation with beads coated with staphylococcal G protein. Proteins were released from the beads and analyzed by Western blotting using MAb 1 for detection. All four antibodies pulled down both the p8 minicore and p21 core (Fig. 2D). Control lanes, which contained extracts of HEK293T cells that had not been transfected, had neither p8 nor p21 bands.

Confirmation that an AUG start codon is not required for internal initiation. Production of p8 or a closely related isoform by parental Con1 replicons (Fig. 1B, lane b) suggested that the core gene contains an RNA signal that is capable of stimulating the initiation of protein synthesis at or near codon 91, even in the absence of an AUG codon. To confirm this in a second genotype 1b sequence, plasmids with either 91-AUG or 91-UUG were made and transfected into HEK293T cells (Fig. 3A). A clinical genotype 1b isolate, MFX, was the source of the HCV sequence. Unlike Con1, the parental form of MFX carries the 271A interferon resistance mutation and thus has 91-AUG. Western blots showed that p8 minicore was produced from plasmids with both 91-AUG and 91-UUG. Consistent with the results obtained using Con1 replicons, more p8 was produced from the 91-AUG construct (Fig. 3B).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 3. 91-AUG is the preferred initiation codon for p8 synthesis but is not required for production of a p8 isoform. (A) Diagrams of transcripts expected to be produced from DNA plasmids transfected into HEK293T cells. The transcripts have a 5' cap, the HCV IRES, the MFX (genotype 1b) core with either AUG at codon 91 or UUG at codon 91, the N-terminal two-thirds of E1, stop codons, and a poly(A) tail. (B) Western blots developed using MAb 1. Cells expressing the 91-AUG or 91-UUG codon produced p8, but cells expressing the 91-AUG codon produced more p8 than the others.

To further explore the signals stimulating p8 minicore production, the core proteins expressed from transcripts of MFX were compared to those of LPE, a clinical isolate of genotype 1a HCV. Like the majority of genotype 1a sequences, LPE has 91-UGC (cysteine). As is characteristic of HCV genomes, the LPE core gene has no AUG codon in the vicinity of codon 91; its only AUG codons are at positions 1 and 134. In the RNA transcripts used in this experiment, the HCV core genes were adjacent to the conventional HCV IRES. The transcripts contained the 5' UTR through base 1312 of the E1 envelope gene (Fig. 4A). They were transfected into HEK293T cells, and proteins were analyzed by Western blotting using MAb 1. Both LPE and MFX transcripts expressed a p8 minicore, confirming that a 91-AUG codon is not required for production of this isoform (Fig. 4B). Both capped and uncapped MFX transcripts expressed detectable levels of p8, but only the capped version of LPE expressed detectable levels of p8 (Fig. 4B).


Figure 4
View larger version (48K):
[in this window]
[in a new window]

  		FIG. 4. HCV RNA of genotype 1b HCV with 91-AUG expresses more p8 minicore than does HCV RNA of genotype 1a with 91-UGC. (A) Diagrams of four in vitro RNA transcripts that were transfected into HEK293T cells and analyzed using MAb 1. All four transcripts have the HCV IRES, the complete core region, and the N-terminal two-thirds of E1 followed by stop codons and a poly(A) tail. Transcripts with a 5' cap are analyzed in panel B, while those without a cap are analyzed in panel C. Two separately prepared extracts of LPE (genotype 1a) and MFX (genotype 1b) are shown.

The p8 minicore is a member of a family of core protein isoforms produced by infectious HCV. To study HCV core gene expression in the context of HCV replication and virion production, we transfected Huh-7.5 cells with transcripts of infectious viruses (Fig. 5A). The viruses were JFH-1, a genotype 2a isolate; J6/JFH, a chimeric virus that has a J6 genotype 2a core gene; and H77/JFH, a second chimeric virus that has a genotype 1a core gene. A bicistronic construct, Bi-H77/JFH, which has a genotype 1a core gene, was included in the study. Both transfection and electroporation were used to introduce the in vitro RNA transcripts into cells. As is typical of core genes outside the genotype 1b subtype, the core genes of JFH, J6, and H77 contain only two AUG codons (at positions 1 and 134). At codon 91, these sequences have CUC (JFH and J6) or UGC (H77).


Figure 5
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 5. Mature p21 core and minicore proteins are produced by infectious HCV in Huh-7.5 cells. (A) Diagrams of replicating HCV RNA genomes. The 5'- and 3'-nontranslated regions (NTRs) are depicted as RNA structures. Segments of the JFH-1 (genotype 2a) protein coding domain are shown in dark gray, segments of the J6 (genotype 2a) coding domain are shown in light gray, and segments of the H77 (genotype 1a) protein coding domain are shown in white. Polyprotein synthesis is driven by the HCV IRES within the 5'-nontranslated region. For the Bi-H77/JFH construct, proteins NS3 through NS5B are produced from an EMCV IRES. (B to G) Western blots. The blot in panel B was developed using MAb 1, which recognizes core amino acids 104 to 110 in the C-terminal portion of the p21 core protein. Lane a, JFH-1; lane b, mock-transfected Huh-7.5 cells. An arrow identifies the p21 core band, and molecular size markers are indicated. Dots identify four minicore isoforms, which are numbered 1 to 4, from the slowest, p14, to the fastest, p8. Band 3 is underlined to indicate that it migrates as a doublet. The blot in panel C was developed using MAb C7-50, which recognizes core amino acids in the N-terminal portion of the p21 core protein. Lane a, JFH-1; lane b, mock-transfected Huh-7.5 cells. The filter was subsequently incubated with MAb 2, which recognizes amino acids 115 to 121, and the blot is shown in panel D. The blots in panels E and F were developed using MAb C7-50 and MAb 2, respectively. The lanes depict Huh-7.5 (a) and J6/JFH (b and c). The blot in panel G was developed using MAb 1. The lanes depict H77/JFH (a), Bi-H77/JFH (b), and mock-transfected Huh-7.5 cells (c). Extracts were prepared at 3 to 5 days posttransfection.

All three infectious viruses and the bicistronic construct produced p21 core and p8 minicore. In addition, these viruses expressed a family of larger minicore isoforms (Fig. 5B, D, F, and G). Including p8, which was the smallest isoform that was consistently observed, the minicores ranged in size from about 8 to 14 kDa. They are numbered 1 to 4, from slowest (p14) to fastest (p8); band 3 expressed by genotype 2a migrates as a doublet. Two MAbs were used in this experiment: MAb 1, which targets core amino acids 104 to 110, detects JFH-1 and H77 but not J6; and MAb 2, which targets core amino acids 115 to 121, detects JFH-1 and J6 but not H77. As expected, the minicore proteins were not present in extracts of control Huh-7.5 cells (Fig. 5B to G).

The p21 core protein (arrows), but not the minicore proteins (dots), reacted with MAb C7-50, which recognizes the N-terminal portion of the HCV core protein (Fig. 5C and E; Table 1). When blots of JFH-1 proteins that were initially incubated with MAb C7-50 (Fig. 5C) were reprobed with MAb 2, the minicore proteins were readily detected (Fig. 5D). Thus, their absence from blots incubated with C7-50 occurred because they lack the N-terminal portion of the core protein. The failure of all of the minicores to react with C7-50 and the failure to detect N-terminal core fragments demonstrate that minicore proteins are specific isoforms of the core protein and are not random degradation products of the p21 core protein.

The patterns of isoforms expressed by all three core genes were similar to each other in both the number and mobility of the bands; however, there was variation in the intensities of the bands relative to p21 core and relative to each other. JFH-1 expressed comparable amounts of p21 core and the minicores (Fig. 5B, lane a), whereas H77 expressed a large excess of p21 core (Fig. 5G, lane a). JFH-1 and J6, which contain genotype 2a core genes, expressed greater quantities of bands 2 and 3 (doublet) than bands 1 and 4, whereas H77/JFH, which contains a genotype 1a core gene, expressed primarily p8 (Fig. 5G, lane a) and the Bi-H77/JFH construct expressed roughly equal amounts of all four minicore isoforms (Fig. 5G, lane b). The production of minicore proteins by JFH-1, J6, and H77 core genes suggests that the minicore proteins are important, functional components of the HCV protein repertoire.


arrow
DISCUSSION
 
The results of this study add two new activities to the list of HCV core gene functions, namely, expression of a translational signal that stimulates the internal initiation of protein synthesis in the central region of the gene and production of a family of core protein isoforms that contain the C-terminal portion of the core protein. The isoforms range in size from about 8 kDa to 14 kDa. The core genes of JFH-1 and H77 have only 81.5% nucleotide identity and thus represent divergent members of the global HCV population. The production of core protein isoforms by both genotype 1 and genotype 2 HCVs indicates that their expression is a conserved function of the HCV core gene. In Huh-7.5 cells replicating infectious JFH-1, the minicore proteins were expressed in amounts comparable to that of the mature p21 core protein. Detection of the minicore proteins was made possible by the availability of MAbs 1 and 2, which recognize amino acids in the C-terminal portion of the core protein and retain their binding ability in Western blots. The minicore proteins do not react with antibodies directed against the N-terminal portion of the p21 core protein, which is the target of most anticore antibodies.

Internal initiation of HCV protein synthesis. Analysis of p8 minicore expression indicated that the core gene contains a signal for the internal initiation of protein synthesis. Synthesis of p8 was undiminished (possibly enhanced) in cells transfected with RNA transcripts in which the AUG start codon of the main ORF was replaced with a UAG stop codon, whereas production of p21 was greatly reduced. The production of p8 in the absence of production of p21 demonstrates that p8 cannot be a cleavage product of p21 and therefore must arise from an independent initiation event. The introduction of a U271A mutation into a Con1 replicon created an AUG at position 91 and enhanced p8 expression. Because AUG is the canonical start codon, this enhancement provides additional evidence that p8 is produced by internal initiation. This experiment suggests that the N terminus of p8 is at codon 91, at least in sequences that have 91-AUG. In other sequences, it is possible that internal initiation occurs at a nearby codon. CUG is one of the more frequently used noncanonical start codons; it is possible that 98-CUG, which is present in about 95% of all HCV sequences, promotes p8 synthesis in some of the sequences lacking 91-AUG.

Expression of p8 by parental Con1 replicons, LPE transcripts, and infectious viruses that lack 91-AUG shows that although AUG is preferred, it is not required for internal initiation to occur. Thus, 91-AUG must be only one component of a more complex initiation signal. The other components are likely to include RNA structural elements. The central region of the core gene is predicted to form a stable stem-loop element, SL_248 (43); however, the predicted structure of this element has not been confirmed experimentally. More work is needed to determine the structures in this region and to understand how the ribosomes that perform internal initiation are recruited to the HCV RNA. It is possible that the ribosomes are recruited by the conventional HCV IRES and that they reach the internal initiation site as a result of leaky scanning (24). Alternatively, they may be recruited to the central portion of the core gene by a recently described mechanism termed ribosomal clustering (12) or by an as yet unidentified second IRES. Interestingly, two start sites for ARFP synthesis are located near codon 91, at ARF codons 85 and 87 (47), suggesting that this portion of HCV RNA contains a number of translation signals.

Our identification of a signal that promotes the internal initiation of protein synthesis provides new insight into the molecular correlates of the U271A mutation. This mutation is associated clinically with interferon resistance in Japanese patients with genotype 1b HCV and high viral loads (1-3). The U271A mutation is predicted to cause a leucine-to-methionine substitution in the p21 core protein. The clinical phenotype (interferon resistance) has been attributed to this highly conservative amino acid substitution. As an alternative explanation, our findings suggest that the clinical phenotype may result from the strengthening of the initiation signal that occurs when the 91-AUG codon is created and/or from upregulation of p8.

A signal for internal initiation might provide a backup to the main AUG start codon, allowing polyprotein synthesis to occur even under conditions when the conventional IRES cannot function. Our data indicate that the RNA machinery promoting p8 expression does not require the conventional HCV IRES: p8 was expressed from replicons in which the core gene was downstream of the EMCV IRES (Fig. 1) and from in vitro transcripts lacking any IRES (Fig. 2). Previous investigators have also suggested that HCV may have several mechanisms for translation initiation (25) and have proposed that the expression of viral proteins can occur in the absence of conventional IRES function (34).

If internal initiation is an important step in the HCV life cycle, it may seem paradoxical that 91-AUG occurs only in genotype 1b sequences; however, 91-AUG may not be the major site of internal initiation. A virtually invariant AUG codon occurs at position 134. Initiation at this site would yield a minicore lacking the epitopes recognized by the antibodies used in this study. We are using alternative strategies to investigate the translational signals that may be located in and around codon 134.

The process giving rise to production of the larger minicore proteins is not known. They were found only in cells making infectious viruses and may be generated from p21 while infectious particles are being assembled. They may result from internal initiation or from some other process. We have relied on gel mobility to estimate the sizes of the minicore proteins; however, this is an imprecise method for determining molecular weight. A complementary method, such as mass spectroscopy, is needed to establish the actual termini of the minicore isoforms and to determine whether they differ in protein modifications and initiation and termination sites. This information may shed light on the processes that give rise to them.

A family of core protein isoforms lacking the N-terminal portion of the p21 core protein. To our knowledge, this is the first report of isoforms of the core protein produced from replicating HCV. Until now, it has been assumed that a single product, the mature p21 core protein, performs all of the many biological activities attributed to the core protein. Our results indicate that a variety of isoforms exist. One or more of the minicores may, in fact, mediate some of the biological effects attributed to p21.

To narrow down the functions that minicore proteins might perform, it is useful to consider the activities associated with p21 (19). Domain 1 contains the N-terminal amino acids 1 to 118. The N-terminal portion of domain 1 may be analogous to the nucleocapsid proteins of flaviviruses, which are highly basic RNA binding proteins that are typically much smaller than the p21 HCV core protein. The RNA binding activity of the HCV core protein maps to amino acids 1 to 75, which is a highly basic region (35). Minicore proteins beginning after codon 75 would not be expected to bind RNA efficiently. Those beginning after codon 90 would lack all or most of the homotypic core-core interaction domains that map within amino acids 36 to 91 (28) and 82 to 102 (31).

Whereas the minicores lack much of domain 1, they are predicted to contain domain 2 (amino acids 119 to about 179). Domain 2 is hydrophobic and mediates interactions with cellular organelles. Localization to cellular lipid storage droplets (4) is associated with a conserved proline knot motif that involves proline amino acids at positions 138 and 143 and a YATG motif at amino acids 164 to 167 (20). The proline knot motif is well conserved in the sequences used in this study; the only divergence is an L139V substitution in JFH and J6. The YATG motif is also well conserved, with the only divergence being a Y-to-F substitution in J6. Based on their amino acid content, minicores are predicted to bind lipid droplets and thus may participate in some of the same reactions taking place at these organelles as those involving p21 core. These reactions may include modulation of cellular lipid deposition and virion assembly (4, 37).

In addition to lipid droplets, the core protein interacts with the outer mitochondrial membrane. This interaction is mediated by a conserved signal at amino acids 149 to 158 (36). A mitochondrial and endoplasmic reticulum localization signal maps to amino acids 112 to 152 (39). Mitochondria play a central role in cellular apoptosis and resistance to apoptosis. Many viruses modulate cellular apoptosis by interacting with mitochondria (32). It is possible that minicores mediate interactions between HCV and mitochondria.

Minicore function was not explored in this study; however, because the U271A interferon resistance mutation enhances p8 expression, it is reasonable to consider that p8 counters the effects of interferon. The idea that p8 enhances interferon resistance is supported by our finding that genotype 1 core genes express larger amounts of p8 relative to the other minicores than genotype 2 core genes do and by published data showing that patients with genotype 1 HCV are less likely to respond to interferon than patients with genotype 2 HCV (reviewed in reference 16).

In summary, the HCV core gene contains a signal that promotes the internal initiation of protein synthesis, leading to expression of a p8 minicore protein. This isoform is expressed from transcripts, replicons, and infectious viruses. Its expression is enhanced by an interferon resistance mutation. The RNA signals and translational events that lead to p8 production may provide an alternative pathway for expression of downstream polyprotein sequences. In addition to p8, infectious viruses of both genotype 1 and genotype 2 express a family of larger core protein isoforms. The expression of these larger isoforms from infectious viruses is compatible with a role in virus particle formation. The minicores contain mainly domain 2 of the mature core protein and thus may interact with the viral and cellular components that interact with domain 2, potentially augmenting the functions carried out by p21 core and also potentially downmodulating these functions. Research is under way to determine the biological properties of the minicore proteins and, specifically, to examine their impact on p21 localization, cellular interferon pathways, viral kinetics, and virion production.


arrow
ACKNOWLEDGMENTS
 
We thank T. Wakita and W. Schmidt for providing access to JFH-1 and HCV-J sequences, respectively, and Donna Tscherne for providing stocks of Huh-7.5 cells with and without HCV replicons.

This work was supported in part by NIH grants DA016156 and DK066939 (to A.D.B.), NIH grants CA57973, AI40034, and AI075099, the Greenberg Medical Research Institute, the Starr Foundation (to C.M.R.), and an American Liver Foundation scholar's award (to F.J.E.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Liver Diseases, Mount Sinai School of Medicine, 1425 Madison Ave., Box 11-20, New York, NY 10029. Phone: (212) 659-8371. Fax: (212) 348-3517. E-mail: Andrea.Branch{at}mssm.edu Back

{triangledown} Published ahead of print on 7 January 2009. Back

{dagger} Present address: Molecular Section, Special Pathogens Branch, Centers for Disease Control and Prevention, Atlanta, GA 30333. Back

{ddagger} Present address: Department of Microbiology, The Mount Sinai School of Medicine, New York, NY 10029. Back


arrow
REFERENCES
 
    1
  1. Akuta, N., F. Suzuki, Y. Kawamura, H. Yatsuji, H. Sezaki, Y. Suzuki, T. Hosaka, M. Kobayashi, M. Kobayashi, Y. Arase, K. Ikeda, and H. Kumada. 2007. Predictive factors of early and sustained responses to peginterferon plus ribavirin combination therapy in Japanese patients infected with hepatitis C virus genotype 1b: amino acid substitutions in the core region and low-density lipoprotein cholesterol levels. J. Hepatol. 46:403-410.[CrossRef][Medline]
    2. 2
  2. Akuta, N., F. Suzuki, Y. Kawamura, H. Yatsuji, H. Sezaki, Y. Suzuki, T. Hosaka, M. Kobayashi, M. Kobayashi, Y. Arase, K. Ikeda, and H. Kumada. 2007. Predictors of viral kinetics to peginterferon plus ribavirin combination therapy in Japanese patients infected with hepatitis C virus genotype 1b. J. Med. Virol. 79:1686-1695.[CrossRef][Medline]
    3. 3
  3. Akuta, N., F. Suzuki, Y. Kawamura, H. Yatsuji, H. Sezaki, Y. Suzuki, T. Hosaka, M. Kobayashi, M. Kobayashi, Y. Arase, K. Ikeda, Y. Miyakawa, and H. Kumada. 2007. Prediction of response to pegylated interferon and ribavirin in hepatitis C by polymorphisms in the viral core protein and very early dynamics of viremia. Intervirology 50:361-368.[CrossRef][Medline]
    4. 4
  4. Barba, G., F. Harper, T. Harada, M. Kohara, S. Goulinet, Y. Matsuura, G. Eder, Z. Schaff, M. J. Chapman, T. Miyamura, and C. Brechot. 1997. Hepatitis C virus core protein shows a cytoplasmic localization and associates to cellular lipid storage droplets. Proc. Natl. Acad. Sci. USA 94:1200-1205.[Abstract/Free Full Text]
    5. 5
  5. Baril, M., and L. Brakier-Gingras. 2005. Translation of the F protein of hepatitis C virus is initiated at a non-AUG codon in a +1 reading frame relative to the polyprotein. Nucleic Acids Res. 33:1474-1486.[Abstract/Free Full Text]
    6. 6
  6. Basu, A., R. Steele, R. Ray, and R. B. Ray. 2004. Functional properties of a 16 kDa protein translated from an alternative open reading frame of the core-encoding genomic region of hepatitis C virus. J. Gen. Virol. 85:2299-2306.[Abstract/Free Full Text]
    7. 7
  7. Beguiristain, N., H. D. Robertson, and J. Gomez. 2005. RNase III cleavage demonstrates a long range RNA: RNA duplex element flanking the hepatitis C virus internal ribosome entry site. Nucleic Acids Res. 33:5250-5261.[Abstract/Free Full Text]
    8. 8
  8. Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation of HCV RNA replication in cell culture. Science 290:1972-1974.[Abstract/Free Full Text]
    9. 9
  9. Blight, K. J., J. A. McKeating, and C. M. Rice. 2002. Highly permissive cell lines for subgenomic and genomic hepatitis C virus RNA replication. J. Virol. 76:13001-13014.[Abstract/Free Full Text]
    10. 10
  10. Boulant, S., M. Becchi, F. Penin, and J. P. Lavergne. 2003. Unusual multiple recoding events leading to alternative forms of hepatitis C virus core protein from genotype 1b. J. Biol. Chem. 278:45785-45792.[Abstract/Free Full Text]
    11. 11
  11. Branch, A. D., D. D. Stump, J. A. Gutierrez, F. Eng, and J. L. Walewski. 2005. The hepatitis C virus alternate reading frame (ARF) and its family of novel products: the alternate reading frame protein/F-protein, the double-frameshift protein, and others. Semin. Liver Dis. 25:105-117.[CrossRef][Medline]
    12. 12
  12. Chappell, S. A., G. M. Edelman, and V. P. Mauro. 2006. Ribosomal tethering and clustering as mechanisms for translation initiation. Proc. Natl. Acad. Sci. USA 103:18077-18082.[Abstract/Free Full Text]
    13. 13
  13. Cohen, M., L. Bachmatov, Z. Ben Ari, Y. Rotman, R. Tur-Kaspa, and R. Zemel. 2007. Development of specific antibodies to an ARF protein in treated patients with chronic HCV infection. Dig. Dis. Sci. 52:2427-2432.[CrossRef][Medline]
    14. 14
  14. Fiorucci, M., S. Boulant, A. Fournillier, J. D. Abraham, J. P. Lavergne, G. Paranhos-Baccala, G. Inchauspe, and C. Bain. 2007. Expression of the alternative reading frame protein of hepatitis C virus induces cytokines involved in hepatic injuries. J. Gen. Virol. 88:1149-1162.[Abstract/Free Full Text]
    15. 15
  15. Forns, X., R. Thimme, S. Govindarajan, S. U. Emerson, R. H. Purcell, F. V. Chisari, and J. Bukh. 2000. Hepatitis C virus lacking the hypervariable region 1 of the second envelope protein is infectious and causes acute resolving or persistent infection in chimpanzees. Proc. Natl. Acad. Sci. USA 97:13318-13323.[Abstract/Free Full Text]
    16. 16
  16. Hayashi, N., and T. Takehara. 2006. Antiviral therapy for chronic hepatitis C: past, present, and future. J. Gastroenterol. 41:17-27.[CrossRef][Medline]
    17. 17
  17. Higuchi, R., B. Krummel, and R. K. Saiki. 1988. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16:7351-7367.[Abstract/Free Full Text]
    18. 18
  18. Honda, M., M. R. Beard, L. H. Ping, and S. M. Lemon. 1999. A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation. J. Virol. 73:1165-1174.[Abstract/Free Full Text]
    19. 19
  19. Hope, R. G., and J. McLauchlan. 2000. Sequence motifs required for lipid droplet association and protein stability are unique to the hepatitis C virus core protein. J. Gen. Virol. 81:1913-1925.[Abstract/Free Full Text]
    20. 20
  20. Hope, R. G., D. J. Murphy, and J. McLauchlan. 2002. The domains required to direct core proteins of hepatitis C virus and GB virus-B to lipid droplets share common features with plant oleosin proteins. J. Biol. Chem. 277:4261-4270.[Abstract/Free Full Text]
    21. 21
  21. Ina, Y., M. Mizokami, K. Ohba, and T. Gojobori. 1994. Reduction of synonymous substitutions in the core protein gene of hepatitis C virus. J. Mol. Evol. 38:50-56.[Medline]
    22. 22
  22. Komurian-Pradel, F., A. Rajoharison, J. L. Berland, V. Khouri, M. Perret, M. Van Roosmalen, S. Pol, F. Negro, and G. Paranhos-Baccala. 2004. Antigenic relevance of F protein in chronic hepatitis C virus infection. Hepatology 40:900-909.[CrossRef][Medline]
    23. 23
  23. Kong, W. P., and R. P. Roos. 1991. Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus. J. Virol. 65:3395-3399.[Abstract/Free Full Text]
    24. 24
  24. Kozak, M. 2002. Pushing the limits of the scanning mechanism for initiation of translation. Gene 299:1-34.[CrossRef][Medline]
    25. 25
  25. Lancaster, A. M., E. Jan, and P. Sarnow. 2006. Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site. RNA 12:894-902.[Abstract/Free Full Text]
    26. 26
  26. Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wolk, T. L. Tellinghuisen, C. C. Liu, T. Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, and C. M. Rice. 2005. Complete replication of hepatitis C virus in cell culture. Science 309:623-626.[Abstract/Free Full Text]
    27. 27
  27. Ma, H. C., T. W. Lin, H. Li, S. M. Iguchi-Ariga, H. Ariga, Y. L. Chuang, J. H. Ou, and S. Y. Lo. 2008. Hepatitis C virus ARFP/F protein interacts with cellular MM-1 protein and enhances the gene trans-activation activity of c-Myc. J. Biomed. Sci. 15:417-425.[CrossRef][Medline]
    28. 28
  28. Matsumoto, M., S. B. Hwang, K. S. Jeng, N. Zhu, and M. M. Lai. 1996. Homotypic interaction and multimerization of hepatitis C virus core protein. Virology 218:43-51.[CrossRef][Medline]
    29. 29
  29. McMullan, L. K., A. Grakoui, M. J. Evans, K. Mihalik, M. Puig, A. D. Branch, S. M. Feinstone, and C. M. Rice. 2007. Evidence for a functional RNA element in the hepatitis C virus core gene. Proc. Natl. Acad. Sci. USA 104:2879-2884.[Abstract/Free Full Text]
    30. 30
  30. Nadal, A., M. Martell, J. R. Lytle, A. J. Lyons, H. D. Robertson, B. Cabot, J. I. Esteban, R. Esteban, J. Guardia, and J. Gomez. 2002. Specific cleavage of hepatitis C virus RNA genome by human RNase P. J. Biol. Chem. 277:30606-30613.[CrossRef]
    31. 31
  31. Nolandt, O., V. Kern, H. Muller, E. Pfaff, L. Theilmann, R. Welker, and H. G. Krausslich. 1997. Analysis of hepatitis C virus core protein interaction domains. J. Gen. Virol. 78:1331-1340.[Abstract]
    32. 32
  32. O'Brien, V. 1998. Viruses and apoptosis. J. Gen. Virol. 79:1833-1845.[Medline]
    33. 33
  33. Ratinier, M., S. Boulant, C. Combet, P. Targett-Adams, J. McLauchlan, and J. P. Lavergne. 2008. Transcriptional slippage prompts recoding in alternate reading frames in the hepatitis C virus (HCV) core sequence from strain HCV-1. J. Gen. Virol. 89:1569-1578.[Abstract/Free Full Text]
    34. 34
  34. Revie, D., M. O. Alberti, R. S. Braich, D. Bayles, J. G. Prichard, and S. Z. Salahuddin. 2006. Discovery of significant variants containing large deletions in the 5'UTR of human hepatitis C virus (HCV). Virol. J. 3:82.[CrossRef][Medline]
    35. 35
  35. Santolini, E., G. Migliaccio, and N. La Monica. 1994. Biosynthesis and biochemical properties of the hepatitis C virus core protein. J. Virol. 68:3631-3641.[Abstract/Free Full Text]
    36. 36
  36. Schwer, B., S. Ren, T. Pietschmann, J. Kartenbeck, K. Kaehlcke, R. Bartenschlager, T. S. Yen, and M. Ott. 2004. Targeting of hepatitis C virus core protein to mitochondria through a novel C-terminal localization motif. J. Virol. 78:7958-7968.[Abstract/Free Full Text]
    37. 37
  37. Shavinskaya, A., S. Boulant, F. Penin, J. McLauchlan, and R. Bartenschlager. 2007. The lipid droplet binding domain of hepatitis C virus core protein is a major determinant for efficient virus assembly. J. Biol. Chem. 282:37158-37169.[Abstract/Free Full Text]
    38. 38
  38. Smith, D. B., and P. Simmonds. 1997. Characteristics of nucleotide substitution in the hepatitis C virus genome: constraints on sequence change in coding regions at both ends of the genome. J. Mol. Evol. 45:238-246.[CrossRef][Medline]
    39. 39
  39. Suzuki, R., S. Sakamoto, T. Tsutsumi, A. Rikimaru, K. Tanaka, T. Shimoike, K. Moriishi, T. Iwasaki, K. Mizumoto, Y. Matsuura, T. Miyamura, and T. Suzuki. 2005. Molecular determinants for subcellular localization of hepatitis C virus core protein. J. Virol. 79:1271-1281.[Abstract/Free Full Text]
    40. 40
  40. Troesch, M., E. Jalbert, S. Canobio, M. R. Boulassel, J. P. Routy, N. F. Bernard, J. Bruneau, N. Lapointe, M. Boucher, and H. Soudeyns. 2005. Characterization of humoral and cell-mediated immune responses directed against hepatitis C virus F protein in subjects co-infected with hepatitis C virus and HIV-1. AIDS 19:775-784.[Medline]
    41. 41
  41. Tsao, M. L., C. H. Chao, and C. T. Yeh. 2006. Interaction of hepatitis C virus F protein with prefoldin 2 perturbs tubulin cytoskeleton organization. Biochem. Biophys. Res. Commun. 348:271-277.[CrossRef][Medline]
    42. 42
  42. Tscherne, D. M., M. J. Evans, T. von Hahn, C. T. Jones, Z. Stamataki, J. A. McKeating, B. D. Lindenbach, and C. M. Rice. 2007. Superinfection exclusion in cells infected with hepatitis C virus. J. Virol. 81:3693-3703.[Abstract/Free Full Text]
    43. 43
  43. Tuplin, A., D. J. Evans, and P. Simmonds. 2004. Detailed mapping of RNA secondary structures in core and NS5B-encoding region sequences of hepatitis C virus by RNase cleavage and novel bioinformatic prediction methods. J. Gen. Virol. 85:3037-3047.[Abstract/Free Full Text]
    44. 44
  44. van Eyll, O., and T. Michiels. 2002. Non-AUG-initiated internal translation of the L* protein of Theiler's virus and importance of this protein for viral persistence. J. Virol. 76:10665-10673.[Abstract/Free Full Text]
    45. 45
  45. Varaklioti, A., N. Vassilaki, U. Georgopoulou, and P. Mavromara. 2002. Alternate translation occurs within the core coding region of the hepatitis C viral genome. J. Biol. Chem. 277:17713-17721.[Abstract/Free Full Text]
    46. 46
  46. Vassilaki, N., P. Friebe, P. Meuleman, S. Kallis, A. Kaul, G. Paranhos-Baccala, G. Leroux-Roels, P. Mavromara, and R. Bartenschlager. 2008. Role of the hepatitis C virus core+1 open reading frame and core cis-acting RNA elements in viral RNA translation and replication. J. Virol. 82:11503-11515.[Abstract/Free Full Text]
    47. 47
  47. Vassilaki, N., and P. Mavromara. 2003. Two alternative translation mechanisms are responsible for the expression of the HCV ARFP/F/core+1 coding open reading frame. J. Biol. Chem. 278:40503-40513.[Abstract/Free Full Text]
    48. 48
  48. Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A. Habermann, H. G. Krausslich, M. Mizokami, R. Bartenschlager, and T. J. Liang. 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 11:791-796.[CrossRef][Medline]
    49. 49
  49. Walewski, J. L., J. A. Gutierrez, W. Branch-Elliman, D. D. Stump, T. R. Keller, A. Rodriguez, G. Benson, and A. D. Branch. 2002. Mutation Master: profiles of substitutions in hepatitis C virus RNA of the core, alternate reading frame, and NS2 coding regions. RNA 8:557-571.[Abstract]
    50. 50
  50. Walewski, J. L., T. R. Keller, D. D. Stump, and A. D. Branch. 2001. Evidence for a new hepatitis C virus antigen encoded in an overlapping reading frame. RNA 7:710-721.[Abstract]
    51. 51
  51. Wen, F., M. Y. Abdalla, C. Aloman, J. Xiang, I. M. Ahmad, J. Walewski, M. L. McCormick, K. E. Brown, A. D. Branch, D. R. Spitz, B. E. Britigan, and W. N. Schmidt. 2004. Increased prooxidant production and enhanced susceptibility to glutathione depletion in HepG2 cells co-expressing HCV core protein and CYP2E1. J. Med. Virol. 72:230-240.[CrossRef][Medline]
    52. 52
  52. Wolf, M., M. Dimitrova, T. F. Baumert, and C. Schuster. 2008. The major form of hepatitis C virus alternate reading frame protein is suppressed by core protein expression. Nucleic Acids Res. 36:3054-3064.[Abstract/Free Full Text]
    53. 53
  53. Wu, W. B., S. W. Shao, L. J. Zhao, J. Luan, J. Cao, J. Gao, S. Y. Zhu, and Z. T. Qi. 2007. Hepatitis C virus F protein up-regulates c-myc and down-regulates p53 in human hepatoma HepG2 cells. Intervirology 50:341-346.[CrossRef][Medline]
    54. 54
  54. Xu, Z., J. Choi, T. S. Yen, W. Lu, A. Strohecker, S. Govindarajan, D. Chien, M. J. Selby, and J. Ou. 2001. Synthesis of a novel hepatitis C virus protein by ribosomal frameshift. EMBO J. 20:3840-3848.[CrossRef][Medline]
    55. 55
  55. Zhong, J., P. Gastaminza, G. Cheng, S. Kapadia, T. Kato, D. R. Burton, S. F. Wieland, S. L. Uprichard, T. Wakita, and F. V. Chisari. 2005. Robust hepatitis C virus infection in vitro. Proc. Natl. Acad. Sci. USA 102:9294-9299.[Abstract/Free Full Text]

Journal of Virology, April 2009, p. 3104-3114, Vol. 83, No. 7
0022-538X/09/$08.00+0     doi:10.1128/JVI.01679-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eng, F. J.
Right arrow Articles by Branch, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eng, F. J.
Right arrow Articles by Branch, A. D.
Right arrowPubmed/NCBI databases
*Protein

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»