Previous Article | Next Article ![]()
Journal of Virology, February 2009, p. 1800-1810, Vol. 83, No. 4
0022-538X/09/$08.00+0 doi:10.1128/JVI.02112-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Plum Island Animal Disease Center, North Atlantic Area, Agricultural Research Service, U.S. Department of Agriculture, Greenport, New York 11944
Received 7 October 2008/ Accepted 24 November 2008
|
|
|---|
B (NF-
B). Bioinformatics analysis suggests that Lpro contains a SAP (for SAF-A/B, Acinus, and PIAS) domain, a protein structure associated in some cases with the nuclear retention of molecules involved in transcriptional control. We have introduced a single or a double mutation in conserved amino acid residues contained within this domain of Lpro. Although three stable mutant viruses were obtained, only the double mutant displayed an attenuated phenotype in cell culture. Indirect immunofluorescence analysis showed that Lpro subcellular distribution is altered in cells infected with the double mutant virus. Interestingly, nuclear p65/RelA staining disappeared from wild-type (WT) FMDV-infected cells but not from double mutant virus-infected cells. Consistent with these results, NF-
B-dependent transcription was not inhibited in cells infected with double mutant virus in contrast to cells infected with WT virus. However, degradation of the translation initiation factor eIF-4G was very similar for both the WT and the double mutant viruses. Since Lpro catalytic activity was demonstrated to be a requirement for p65/RelA degradation, our results indicate that mutation of the SAP domain reveals a novel separation-of-function activity for FMDV Lpro. |
|
|---|
Studies in our laboratory have demonstrated that Lpro plays a critical role in the pathogenesis of FMDV. Viruses lacking the Lpro coding region (leaderless) are attenuated in vitro and in vivo (5, 8, 39). One of the reasons for this attenuation is the inability of the leaderless virus to block host cell translation, in particular, translation of type I alpha/beta interferon (IFN-
/β) (9). In most cell types, expression of IFN is induced in response to viral infection. Subsequently, IFN protein is secreted and binds to specific cell surface receptors acting in an autocrine or paracrine manner. The interaction between IFN and its receptor induces a series of signal transduction events that lead to the expression of IFN-stimulated genes (ISGs) which have antiviral and/or antiproliferative properties (22, 23). Among the ISGs, the IFN-induced double-stranded RNA-dependent protein kinase (PKR) and the IFN-induced RNase L (RNase L) have been shown to inhibit FMDV replication (10, 13). Therefore, the general block in cap-dependent cellular translation induced by Lpro results in the limited synthesis of IFN protein and IFN-triggered antiviral effects.
Recent data have demonstrated that Lpro also inhibits the induction of transcription of various cellular genes including IFN-β, regulated upon activation, normal T-cell expressed, and secreted (RANTES) and tumor necrosis factor alpha (TNF-
) (13). In uninfected cells, transcription of IFN-β is not detectable, but upon viral infection latent transcription factors, including nuclear factor
B (NF-
B), IFN regulatory factors 3 and 7 (IRF3 and IRF7) and the activating transcription factor 2/cellular Jun protein complex (ATF2/c-Jun, also named AP-1) are activated and translocated from the cytoplasm to the nucleus, where they bind to their respective IFN-β enhancer elements, thereby inducing gene expression (23). Several studies have shown that one of the mechanisms used by different viruses to antagonize the innate immune response is the inhibition of the induction of IFN-β transcription (11, 22). Among picornaviruses, it has been reported that poliovirus causes the degradation of several proteins, including the p65/RelA subunit of NF-
B and the RNA helicase MDA-5, resulting in reduced IFN-β transcription (2, 38). Furthermore, for Cardiovirus, the only other genus of the Picornaviridae family that contains an L protein at the beginning of its open reading frame, and also for poliovirus, the induction of nucleocytoplasmic traffic disorder is associated with an inhibitory effect on host translation and IFN responses (4, 12, 30, 49).
Our group has shown that during FMDV infection downregulation of IFN-β transcription is associated with Lpro- dependent degradation of p65/RelA (13, 14). Interestingly, our studies showed that Lpro translocates to the nucleus of infected cells, and there is a correlation between the translocation of Lpro and the decrease in the amount of nuclear p65/RelA. However, it still remains unclear how FMDV Lpro induces p65/RelA degradation since highly conserved Lpro cleavage sites have not been found in the protein primary sequence, nor have defined p65/RelA degradation products been detected during FMDV infection (14).
Bioinformatics analysis of the protein sequence of FMDV Lpro reveals that there is a putative SAP (for SAF-A/B, Acinus, and PIAS) domain between amino acids 47 and 83 (following the numbering from the Lb form of Lpro). SAP domains are usually present in eukaryotic proteins that bind DNA and are involved in multiple steps of DNA metabolism, including replication, transcription, repair, etc. (1). Embedded within the Lpro putative SAP domain, the IQKL amino acid sequence is related to the LXXLL signature motif that is found in most members of the protein inhibitor of activated STAT (PIAS) protein family (46). We mutated conserved Lpro residues within the putative SAP domain and found that a double mutation abolished the retention of Lpro in the nuclei of FMDV-infected cells. Interestingly, this mutant virus was unable to induce degradation of nuclear p65/RelA. In contrast to infection with wild-type (WT) virus, infection with the SAP double mutant virus did not prevent the induction of transcription of NF-
B-dependent mRNAs. Since processing of the translation initiation factor eIF-4G was not significantly affected by the Lpro SAP mutation, our results suggest that, in addition to the proteinase activity, subcellular localization is another important determinant for Lpro inhibition of the early innate immune response.
|
|
|---|
Cells. Bovine kidney (LF-BK) (48) and porcine kidney (IBRS-2) cell lines were obtained from the Foreign Animal Disease Diagnostic Laboratory at the Plum Island Animal Disease Center. Secondary porcine kidney (PK) cells and primary bovine embryonic kidney cells (EBK) were provided by the Animal, Plant, and Health Inspection Service, National Veterinary Service Laboratory, Ames, IA. These cells were maintained in minimal essential medium (MEM; Gibco-BRL/Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum and supplemented with 1% antibiotics and nonessential amino acids. BHK-21 cells (baby hamster kidney cells strain 21, clone 13, ATCC CL10) obtained from the American Type Culture Collection (Rockville, MD) were used to propagate virus stocks and to measure virus titers. BHK-21 cells were maintained in MEM containing 10% calf serum and 10% tryptose phosphate broth supplemented with 1% antibiotics and nonessential amino acids. Cell cultures were incubated at 37°C in 5% CO2.
Viruses. FMDV A12-WT was generated from the full-length serotype A12 infectious clone, pRMC35 (42), and A12-LLV2 (leaderless virus) was derived from the infectious clone lacking the Lb coding region, pRM-LLV2 (39). The A12#47, A12#48, and A12#49 mutant viruses were derivatives of A12-WT constructed by site-directed mutagenesis as described below. Theiler's murine encephalomyelitis virus (TMEV) and a chimeric TMEV containing the Lb coding region of FMDV A12 (TMEV-Lb) were previously described (41). Mutant TMEV-LbC23A was derived from TMEV-Lb and was constructed as described below. Viruses were propagated in BHK-21 cells and were concentrated by polyethylene glycol precipitation, titrated on BHK-21 cells, and stored at –70°C.
Construction of mutant viruses. Mutant FMDV and TMEV-Lb viruses were constructed by introducing specific nucleotide changes in the cDNA of the respective infectious clones utilizing a QuikChange mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's directions. For FMDV mutants, plasmid pRMC35 and oligonucleotide pairs that annealed to nt 147 to 188, considering the AUG start codon of Lb as nt 1, were used as follows: I55A_FW (5'-CTCACACTAG CAGCCGCCAAACAGCTGGAGGAACTCACAGGG) and I55A_RW (5'-CCCTGTGAGTTCCTCCAGCTGTTTGGCGGCTGCTAGTGTGAG) for A12#47, L58A_FW (5'-CTCACACTAGCAGCCATCAAACAGGCGGAGGAACTCACAGGG) and L58A_RW (5'-CCCTGTGAGTTCCTCCGCCTGTTTGATGGCTGCTAGTGTGAG) for A12#48, and I55A,L58A_FW (5'-CTCACACTAGCAGCCGCCAAACAGGCGGAGGAACTCACAGGG) and I55A,L58A_RW (5'-CCCTGTGAGTTCCTCCGCCTGTTTGGCGGCTGCTAGTGTGAG) for A12#49. For the TMEV-LbC23A mutant, plasmid pDAFSCC1-Lb (41) and the oligonucleotide pair that anneals between nt 47 and 90 of FMDV-Lb, LbC23A_FW (5'- GGCCCAACAACCACGACAACGCTTGGTTGAACACCATCCTCCAG) and LbC23A_RW (5'-CTGGAGGATGGTGTTCAACCAAGCGTTGTCGTGGTTGTTGGGCC), were used.
FMDV cell infections. Cultured cell monolayers were infected with FMDV or TMEV at the indicated multiplicity of infection (MOI) for 1 h at 37°C. After adsorption, cells were rinsed and incubated with MEM at 37°C. For kinetics of growth or indirect immunofluorescence analyses of FMDV-infected cells, unabsorbed virus was removed by washing the cells with a solution containing 150 mM NaCl in 20 mM morpholineethanesulfonic acid (MES; pH 6.0), before adding MEM and proceeding with the incubation. When indicated, 200 nM leptomycin B (LMB; Sigma Aldrich, St. Louis, MO) was added throughout the infection.
Analysis of mRNA.
A quantitative real-time reverse transcription-PCR (RT-PCR) assay was used to evaluate the mRNA levels of porcine IFN-β, IRF7, Mx1, RANTES, and TNF-
, as previously described (14, 37). Primers and probes sequences are listed in Table 1.
|
View this table: [in a new window] |
TABLE 1. Oligonucleotide primer and probe sequences for real-time RT-PCR
|
B-p65/RelA, were detected with rabbit polyclonal antibodies (Ab) anti-p220 (15) and Ab-1 RB-1638 (NeoMarkers; Lab Vision, Freemont, CA), respectively. FMDV VP1 and tubulin-
were detected with monoclonal Ab (MAb) 6HC4 (3) and Ab-2 MS-581 (clone DM1A; NeoMarkers; Lab Vision), respectively.
(ii) Analysis of IFN protein.
A porcine IFN-
(pIFN
) double-capture enzyme-linked immunosorbent assay (ELISA) previously developed in our laboratory was used to quantitate IFN-
protein in the supernatants of infected cells (36). pIFN
MAb K9 and F17 were purchased from R&D Systems (Minneapolis, MN). MAb K9 (1 µg/ml) was used for antigen capture, and biotinylated MAb F17 (0.35 µg/ml) in conjunction with horseradish-peroxidase-conjugated streptavidin (KPL, Gaithersburg, MD) were used for detection. pIFN
concentrations were determined by extrapolation on a standard curve prepared with recombinant pIFN
(PBL Biomedical Laboratories, Piscataway, NJ).
(iii) Radioimmunoprecipitation of FMDV-infected cell lysates. [35S]methionine-labeled FMDV proteins from LF-BK-infected cells (250,000 cpm/sample) were immunoprecipitated with bovine convalescent-phase serum. The samples were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 15% gel and visualized by autoradiography.
Indirect immunofluorescence analyses (IFA).
Subconfluent cell monolayers prepared in 12-mm glass coverslips were infected with FMDV or TMEV at an MOI of 10 or treated with 25 µg of poly[IC] and Lipofectamine 2000 (Invitrogen)/ml for the indicated time. The cells were fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 (Sigma) in phosphate-buffered saline (PBS), blocked with blocking buffer (PBS, 2% bovine serum albumin, 5% normal goat serum, 10 mM glycine), and then incubated overnight at 4°C with the respective primary Abs. FMDV VP1 was detected with mouse MAb 6HC4 (3), Lpro was detected with a rabbit polyclonal Ab elicited against bacterially expressed recombinant protein (39), TMEV VP1 was detected with MAb DAmAb2 (28), and NF-
B-p65/RelA was detected with rabbit polyclonal Ab-1 RB-1638 (NeoMarkers; Lab Vision). Alexa Fluor 488 and Alexa Fluor 594 (Molecular Probes, Invitrogen)-conjugated secondary Abs were used for detection. Nuclei were visualized by DAPI (4',6'-diamidino-2-phenylindole) staining included in ProLong Gold Antifade mounting medium (Invitrogen). Cells were examined in an Olympus BX40 fluorescence microscope, and the images were taken with a DP-70 digital camera using DP-BSW v2.2 software (Olympus America, Central Valley, PA).
|
|
|---|
-helix-turn-
-helix structure found in SAP domains (1). Despite the presence of a two-amino-acid insertion between the two
-helices in Lpro, the data support the presence of a SAP domain within Lpro.
![]() View larger version (73K): [in a new window] |
FIG. 1. Alignment of FMDV Lpro partial amino acid sequence. Lpro protein sequence was aligned to all available sequences utilizing SMART software. Depicted are sequences in single letters between amino acids 47 and 88, and a schematic diagram displays the approximate location of predicted -helices (green ovals). Asterisks mark the location of amino acids targeted by mutagenesis. Summary of color coding including consensus sequence: + (positive sign in blue), positive charged amino acids (H, K, and R); b (lowercase letter "b" highlighted in yellow), amino acids with a large or bulky side chain (E, F, H, I, K, L, M, Q, R, W, and Y); c (lowercase letter "c" in pink font), charged amino acids (D, E, H, K, and R); l (lowercase letter "l" highlighted in yellow), aliphatic amino acids (I, L, and V); p (lowercase letter "p" in blue font), polar amino acids (C, D, E, H, K, N, Q, R, S, and T); s (lowercase letter "s" in green font), amino acids with a small side chain (A, C, D, G, N, P, S, T, and V); and gray highlighted, amino acids with 60% of the homology in the alignment.
|
50-fold lower than that of the WT virus (9). Interestingly, A12#49 (the double SAP mutant) grew to a final titer of
5-fold lower than WT virus, whereas A12#47 and A12#48 (single SAP mutants) grew to titers similar to that of the WT virus. Regarding plaque size, A12#47 and A12#48 resembled A12-WT virus, and A12#49 was more related to the small-plaque phenotype of A12-LLV2. These results indicated that disruption of the predicted signature motif of the SAP domain requires at least mutations at two sites and affects the growth characteristics of FMDV, resulting in a partially attenuated phenotype.
![]() View larger version (45K): [in a new window] |
FIG. 2. Kinetics of growth and plaque morphology. (A) Growth curves. BHK-21 or EBK cells were infected with the indicated viruses and, after 1 h, unabsorbed virus was removed by washing with 150 mM NaCl-20 mM MES (pH 6.0), followed by the addition of complete medium. Samples were taken at 1, 3, 6, and 24 hpi, and virus titers were determined by plaque assay on BHK-21 cells. (Reported values display one out of three representative experiments with similar results.) (B) BHK-21 cells were infected with similar amounts of viruses and treated as described in panel A, but medium with a gum tragacanth overlay was added and the plaques were stained at 40 hpi.
|
![]() View larger version (47K): [in a new window] |
FIG. 3. IFA of Lpro during FMDV infection. LF-BK cells were infected at an MOI of 10 with FMDV A12-WT (panels 1, 4, 7, and 10), A12-LLV2 (panels 2, 5, 8, and 11), or double SAP mutant A12#49 (panels 3, 6, 9, and 12) and were fixed at different times postinfection. Viral protein Lpro was detected using a rabbit polyclonal Ab and an Alexa Fluor 488-conjugated secondary Ab. Viral protein VP1 was detected using mouse MAb 6HC4 and an Alexa Fluor 594-conjugated secondary Ab.
|
![]() View larger version (50K): [in a new window] |
FIG. 4. IFA of p65/RelA during FMDV infection. LF-BK cells were infected at an MOI of 10 with WT (panels 1 to 3), A12-LLV2 (panels 4 to 6), and the double SAP mutant A12#49 (panels 7 to 9). As a control, cells were mock infected (panels 10 and 11) or treated with synthetic dsRNA poly[IC] (25 µg/ml) and Lipofectamine (panels 12 and 13). At 6 hpi, cells were fixed and stained. p65/RelA was detected using a rabbit polyclonal Ab (Abcam RB-1638) and an Alexa Fluor 488-conjugated secondary Ab. Viral protein VP1 was detected using mouse MAb 6HC4 and an Alexa Fluor 594-conjugated secondary Ab. Nuclei were stained with DAPI (panels 11 and 13).
|
![]() View larger version (57K): [in a new window] |
FIG. 5. Addition of LMB does not block the nuclear export of FMDV Lpro. LF-BK cells were infected at an MOI of 10 with A12-WT (panels 1, 3, 5, and 7) and the double SAP mutant A12#49 (panels 2, 4, 6, and 8). Where indicated, 200 nM LMB was added to the culture medium. At 6 hpi, cells were fixed and stained. For panels 1 to 4, viral protein Lpro was detected using a rabbit polyclonal Ab and an Alexa Fluor 488-conjugated secondary Ab. Viral protein VP1 was detected using mouse MAb 6HC4 and an Alexa Fluor 594-conjugated secondary Ab. For panels 5 to 8, p65/RelA was detected using rabbit polyclonal Ab Abcam RB-1638 and an Alexa Fluor 488-conjugated secondary Ab.
|
Mutation of Lpro SAP domain prevents Lpro inhibition of IFN expression.
We earlier reported that Lpro antagonizes the innate immune response by blocking the expression of IFN (9, 10, 13, 14). To test whether the SAP double mutant had a similar effect, we analyzed the expression of IFN-β, the proinflammatory cytokine TNF-
, the chemokine RANTES, and the ISGs Mx1 and IRF7 in virus-infected cells. We used secondary PK cells in this assay, rather than secondary EBK or LF-BK cells, because we have previously optimized standard procedures of real-time PCR in PK cells (13, 14) and FMDV SAP mutants behave consistently in these cell types (Fig. 2 to 4 and data not shown). By 4 hpi, there was no significant difference in the induction of any of the analyzed genes after infection with A12-WT, A12-LLV2, or A12#49 (Fig. 6A). For IFN-β we observed at most a twofold difference for A12#49 or A12-LLV2 relative to A12-WT. However, by 8 hpi, there was an increase in IFN-β expression of
10-fold for A12#49 and 14-fold for A12-LLV2 compared to A12-WT. A similar pattern was observed for all of the analyzed genes, although the differences were slightly lower, varying from 3- to 10-fold higher for the mutants compared to WT. ELISA quantitation of secreted IFN-
protein in the supernatants of infected PK cells followed similar kinetics (Fig. 6B). By 24 hpi, we detected 6- to 12-fold-higher amounts of IFN-
protein for A12-LLV2 and A12#49, respectively, compared to A12-WT.
![]() View larger version (23K): [in a new window] |
FIG. 6. Analysis of IFN expression. (A) The expression of IFNβ, TNF- , RANTES, Mx1, and IRF7 mRNAs was measured by real-time RT-PCR in secondary PK cells infected with A12-WT, A12-LLV2, or A12#49 FMDV at an MOI of 2 for the indicated times. Porcine GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control. The results are expressed as the fold increase in gene expression for virus-infected with respect to mock-infected cells. (Reported values display the findings for one out of three representative experiments with similar results.) (B) pIFN expression in the supernatants of PK-infected cells determined by ELISA. The values are presented as the mean ± the standard deviation of three independent determinations.
|
B-dependent transcriptional activity and IFN protein expression. Cleavage of translation initiation factor eIF-4G is not affected by mutation of the Lpro SAP domain. Lpro is responsible for cleaving the translation initiation factor eIF-4G and shutting off host cell translation, a hallmark of picornavirus infection (44). We examined the kinetics of eIF-4G cleavage in LF-BK-infected cells by Western blot analysis. Figure 7A shows that, as expected, eIF-4G (p220) was completely processed in A12-WT-infected cells by 4 hpi. Interestingly, only a minor delay, 1 to 2 h, on eIF-4G processing was detected for double SAP mutant (A12#49). Comparable amounts of viral VP1 suggested that the stage of infection was similar for A12-WT and A12#49. Although complete eIF-4G cleavage was achieved for A12#49 by 5 to 6 hpi, low-molecular-weight cleavage products persisted throughout the course of infection. No eIF-4G processing was observed in mock-infected or A12-LLV2-infected cells. By 4 hpi the p65/RelA signal was significantly reduced in the cytoplasm of cells infected with A12-WT. In contrast, the p65/RelA signal did not decrease in extracts of A12-LLV2- or double SAP mutant A12#49-infected cells.
![]() View larger version (37K): [in a new window] |
FIG. 7. Processing of cellular proteins during infection with WT and mutant FMDV. (A) LF-BK cells were infected with WT (A12-WT), leaderless (A12-LLV2), and SAP mutant (A12#49) at MOIs of 10 for 6 h. At the indicated times, cytoplasmic extracts were prepared and analyzed by Western blotting using rabbit polyclonal Ab anti-eIF-4G (p220), rabbit polyclonal Ab anti-p65/RelA (RB-1638), mouse MAb 6HC4 (VP1), and mouse MAb anti-tubulin- (Ab-2 MS-581). CP, p220 cleavage products. (B) Radioimmunoprecipitation of FMDV-infected cell lysates at different times postinfection. [35S]methionine-labeled cell lysates from FMDV-infected LF-BK cells were immunoprecipitated with serum from a convalescent bovine. Samples were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and developed by autoradiography.
|
These results indicated that disruption of the Lpro SAP domain selectively prevented p65/RelA processing without affecting the ability of Lpro to cleave eIF-4G.
Lpro catalytic activity is required for p65/RelA processing. In our previous studies, using a recombinant Theiler's virus that expresses Lpro in the absence of any other FMDV protein (TMEV-Lb), we demonstrated that the presence of Lpro is necessary and sufficient for p65/RelA degradation (14). Using the same recombinant virus, we examined whether the catalytic activity of Lpro was a requirement for p65/RelA disappearance. For this purpose, we mutated the catalytic cysteine residue of Lpro (C23) to alanine, creating TMEV-LbC23A. Mutation of Lpro C23 did not affect the pattern of localization previously observed for WT Lpro (Fig. 8, panels 4 and 6 compared to panels 1 and 3). Interestingly, this mutation abolished the ability of FMDV Lpro to cause p65/RelA degradation (Fig. 8, panels 10, 11, and 12 compared to panels 7, 8, and 9), indicating that the protease activity of Lpro is essential for this function.
![]() View larger version (73K): [in a new window] |
FIG. 8. FMDV Lpro catalytic activity is required for p65/RelA degradation. IBRS-2 cells were infected with TMEV-Lb-containing WT or mutant C23A Lpro at an MOI of 10. At 24 hpi, p65/RelA and viral proteins were visualized by IFA. p65/RelA was detected with rabbit polyclonal Ab (RB-1638) and Alexa Fluor 488-conjugated secondary Ab. Lpro was visualized a rabbit polyclonal Ab and Alexa Fluor 488-conjugated secondary Ab. TMEV VP1 was detected with MAb DAmAb2 (28) and Alexa Fluor 594-conjugated secondary Ab.
|
|
|
|---|
B, and this degradation is associated with Lpro nuclear localization (14). A block in the upregulation of IFN-β transcription also results in lower levels of IFN protein (13). The availability of multiple FMDV protein sequences (7), the high-resolution crystal structure of Lpro (21), and powerful software tools (29) have allowed us to predict that a conserved SAP domain is situated between amino acids 47 and 83 of Lb. In the present study we demonstrated that this domain is important for Lpro function. Double mutation of the SAP domain resulted in an attenuated virus phenotype yielding lower titers and a smaller plaque size. Although the phenotype was not as clear-cut as in the case of the Lpro deletion in leaderless virus, it was indicative of a role of this domain in FMDV virulence. Early translocation of mutant Lpro from the cytoplasm to the nucleus of infected cells was only slightly delayed. However, by 6 hpi, mutant Lpro, in contrast to WT Lpro, was absent from the nuclei of infected cells. Failure in nuclear retention has been reported for another SAP-containing protein, PIAS3L, when this domain was mutated (16). PIAS3L requires an intact SAP box, in conjunction with a RING and a PINIT domain, for proper nuclear localization and retention (16). Perhaps FMDV Lpro depends on an intact SAP domain for docking in the nucleus of infected cells, allowing for interactions with host proteins that might be involved in regulating an antiviral response.
One of the most interesting observations in the present study was the absence of NF-
B degradation upon infection with an FMDV double SAP mutant even though these mutations did not affect the catalytic activity of Lpro. With the exception of leaderless virus, no other viable FMDV Lpro mutant has been previously reported. In vitro studies using mutant recombinant protein or plasmid transient transfection have been very informative, demonstrating that residue C23 is required for the protease enzymatic activity and is utilized by Lpro for self-cleavage from the viral polyprotein and cleavage of the translation initiation factor eIF-4G (15, 34, 40, 43). Recently, Mayer et al. (34), using rabbit reticulocyte lysates, have shown that Lpro residue L115 is also a determinant of self-cleavage and eIF-4G cleavage specificity. Utilizing a recombinant cardiovirus expressing Lpro in the absence of any other FMDV protein, we also demonstrated that the catalytic activity of Lpro is required for NF-
B degradation; mutation of the catalytic residue C23 prevented degradation. Unfortunately, the mechanism used by Lpro to cause NF-
B degradation is still unclear.
As mentioned above, Lpro SAP mutations did not affect Lpro enzymatic activity; self-processing and eIF-4G processing proceeded almost normally. We did observe that degradation of the eIF-4G cleavage products was delayed in cells infected with the double mutant. Mutation of the SAP domain may partially affect the interaction between Lpro and eIF-4G. Quantitative kinetics studies should be performed to verify this hypothesis. It has been reported that FMDV 3C can also cleave eIF-4G at later times after FMDV infection (47); thus, it is possible that the Lpro SAP mutant interferes with the 3C/eIF-4G interaction. Our results, however, suggest that 3C from double mutant SAP virus behaves normally since processing of the viral polyprotein proceeded similarly for the mutant and WT viruses.
The levels of several transcripts, including cytokines, chemokines, and ISGs, were significantly higher after infection with FMDV Lpro SAP mutant #49 compared to WT infection, indicating that disruption of the SAP domain prevented Lpro inhibition of NF-
B-dependent transcription. SAP domains are involved in protein-protein interactions. This motif is required for the repressive activity of PIASy on STAT1-mediated gene activation (31), and it has been proposed that several members of the PIAS protein family negatively regulate NF-
B and STAT signaling, affecting the expression of more than 60 genes (45). Furthermore, the specific role of PIAS proteins in the regulation of NF-
B activity has been examined in vivo utilizing PIAS1-null mice (32). These studies demonstrated that in the absence of PIAS only a subset of NF-
B-regulated genes is affected (ca. 48%), suggesting that there might be alternative mechanisms, independent of PIAS1, for NF-
B regulation.
More interestingly, Jang et al. (24) have provided evidence that the N-terminal region of PIAS3, which contains a SAP domain, is necessary for binding to the p65/RelA subunit of NF-
B, thereby blocking the transcriptional activation. Furthermore, an LXXLL signature motif of PIAS3 is involved in this physical interaction. Although not identical, this motif resembles the IQKL sequence present in FMDV Lpro. Our results suggest that this putative interaction may be involved in docking Lpro in the nucleus of infected cells where Lpro-dependent p65/RelA degradation takes place during FMDV infection. We are currently testing this hypothesis.
SAP domains are also found in several proteins displaying DNA-binding activity, and the contact with defined A/T rich sequences found in matrix attachment regions (MARs) of chromatin is mediated by the predicted
-helices delimited by the SAP box (25). Protein interactions with MARs regions determine the chromatin architecture in zones of interactions with the nuclear matrix. Interestingly, several viral proteins have been shown to localize to these regions, leading to the proposal that viral protein interaction with MARs regions may have a role in blocking host antiviral activities (17). The presence of a SAP domain may allow FMDV Lpro to localize to similar nuclear regions globally affecting the function of transcription factors situated in close proximity during viral infection.
Our results provide new insights into the mechanism used by FMDV to escape the immune response. Structure-function analysis of Lpro has demonstrated that, in addition to the proteinase activity, an intact protein motif, SAP, is required for FMDV virulence. A more detailed understanding of the interactions between FMDV Lpro and/or other viral proteins and the host at the molecular level should help in the development of specific antiviral strategies that could limit virus spread.
This study was supported in part by the Plum Island Animal Disease Research Participation Program administered by the Oak Ridge Institute for Science and Education through an interagency agreement between the U.S. Department of Energy and the U.S. Department of Agriculture (appointment of F.D.-S.S. and C.C.A.D.) and by CRIS Project no. 1940-32000-052-00D, ARS, USDA (T.D.L.S., J.Z., and M.J.G.).
Published ahead of print on 3 December 2008. ![]()
|
|
|---|
B during foot-and-mouth disease virus infection. J. Virol. 81:12803-12815.
B mediated transcription by interacting with the p65/RelA subunit. J. Biol. Chem. 279:24873-24880.
B signaling by PIAS1. Mol. Cell. Biol. 25:1113-1123.
B/p65 in human endothelial cells. J. Immunol. 168:4781-4787.
B during poliovirus infection. J. Biol. Chem. 280:24153-24158.
B. J. Virol. 76:9664-9672.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»