Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bisson, S. A. Articles by Ganem, D. Search for Related Content PubMed PubMed Citation Articles by Bisson, S. A. Articles by Ganem, D.

 Previous Article  |  Next Article 

Journal of Virology, May 2009, p. 5056-5066, Vol. 83, No. 10
0022-538X/09/$08.00+0     doi:10.1128/JVI.02516-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

A Kaposi's Sarcoma-Associated Herpesvirus Protein That Forms Inhibitory Complexes with Type I Interferon Receptor Subunits, Jak and STAT Proteins, and Blocks Interferon-Mediated Signal Transduction

Sabine A. Bisson, Anne-Laure Page, and Don Ganem^*

Howard Hughes Medical Institute and GW Hooper Foundation, Departments of Microbiology and Medicine, University of California, San Francisco, California 94143

Received 7 December 2008/ Accepted 6 March 2009

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Type I interferons (IFNs) are important mediators of innate antiviral defense and function by activating a signaling pathway through their cognate type I receptor (IFNAR). Here we report that lytic replication of Kaposi's sarcoma-associated herpesvirus (KSHV) efficiently blocks type I IFN signaling and that an important effector of this blockade is the viral protein RIF, the product of open reading frame 10. RIF blocks IFN signaling by formation of inhibitory complexes that contain IFNAR subunits, the Janus kinases Jak1 and Tyk2, and the STAT2 transcription factor. Activation of both Tyk2 and Jak1 is inhibited, and abnormal recruitment of STAT2 to IFNAR1 occurs despite the decrement in Tyk2 activity. As a result of these actions, phosphorylation of both STAT2 and STAT1 is impaired, with subsequent failure of ISGF3 accumulation in the nucleus. The presence in the viral genome of potent inhibitors of type I IFN signaling, along with several viral genes that block IFN induction, highlights the importance of the IFN pathway in the control of this human tumor virus infection.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The earliest host defenses mobilized against viral infection are those of the innate immune system. These include a variety of cellular elements and humoral factors; chief among the latter are the type 1 interferons (IFNs), IFN- and IFN-β. Expression of these cytokines is rapidly induced in infected cells, from which they are efficiently exported into the surrounding microenvironment. There, they engage a single heterodimeric receptor, IFNAR, and trigger activation of a signaling pathway that generates a plethora of proteins with broad-spectrum antiviral activities. The importance of this pathway in antiviral defense is attested to by the fact that mice bearing genetic lesions in IFNAR subunits (or one or more of their downstream effectors) are more susceptible to a variety of experimental viral infections, including picornaviruses, influenza viruses, rotaviruses, alphaviruses, bunyaviruses, herpesviruses, and retroviruses (2, 3, 14, 18, 31, 39, 42, 43).

The IFN signaling pathway is elicited by interaction of type I IFN with its receptor, a heterodimer composed of two subunits, IFNAR1 and IFNAR2. In the ground state, IFNAR1 is associated with the Janus kinase Tyk2 and IFNAR2 with the Janus kinase Jak1. IFN binding is thought to bring the IFNAR subunits together, thereby facilitating cross-tyrosine phosphorylation and activation of the two Janus kinases. Activated Tyk2 can then phosphorylate tyrosine 466 (Y466) and other sites on IFNAR1, an event that is important for subsequent signaling. The IFNAR2 cytosolic domains are preassociated with the STAT (signal transducer and activator of transcription) proteins, STAT1 and STAT2. Following receptor engagement by IFN, STAT2 is transferred to IFNAR1 by interaction of phosphorylated Y466 with the STAT2 SH2 domain. Subsequent to this, both STAT proteins are phosphorylated at specific tyrosine residues, which allows the two proteins to form a STAT1/2 heterodimer based on SH2/phosphotyrosine interactions. This heterodimer can then associate with IRF9 (p48) to form the active heterotrimeric transcription factor called ISGF3. Translocation of ISGF3 into the nucleus allows it to access specific sequences (IFN-stimulated response elements [ISREs]) in the promoters of IFN-stimulated genes (ISGs), leading to their upregulation. Many ISGs encode known antiviral activities, while others modulate host immune functions (reviewed in references 4, 22, and 28). In addition, products of IFN-ß signaling can also facilitate amplification of subsequent type I IFN (23) production (17, 30, 40).

Kaposi's sarcoma-associated herpesvirus (KSHV) is a gamma(2) herpesvirus that causes Kaposi's sarcoma, the leading neoplasm of untreated AIDS patients, and two rare lymphoproliferative syndromes, primary effusion lymphoma and multicentric Castleman's disease. Like all herpesviruses, KSHV has two alternative genetic programs, latency and lytic replication. Latency is a cryptic state in which viral gene expression is drastically attenuated and no virions are produced. Lytic infection, by contrast, involves the ordered expression of nearly all viral genes, resulting in viral DNA amplification and release of infectious progeny. Recent work has identified a number of lytic-cycle viral proteins that appear to block the transcriptional induction of IFN-ß (reviewed in reference 33). Most of these are viral homologs of the IRF family of transcription factors, which play key roles in IFN induction by both Toll-like receptors and cytoplasmic pathogen sensors like RIG-I (see reference 34 for a review). At least three of the KSHV IRF homologs appear to function as dominant negative versions of cellular IRFs, thereby antagonizing the induction of the IFN-ß promoter. An unrelated KSHV lytic protein, encoded by orf45, can block nuclear translocation of IRF7 and thereby impair an amplification loop in type I IFN production (49). Thus, considerable attention has been devoted to understanding how KSHV subverts IFN synthesis by the host. Much less, however, is known of the state of type I IFN signaling in infected cells.

In this study, we show that cells lytically infected with KSHV display profound defects in IFN-mediated STAT activation. By screening individual viral gene products for their ability to block the IFN-dependent expression of ISRE-luciferase chimeras, we identified a novel inhibitor of IFN signaling that is unrelated genetically to inhibitors of this pathway encoded by other viruses. This inhibitor also has an unusual mechanism of action by forming inhibitory complexes at the IFN receptor, blocking Tyk2 and Jak1 activation and subsequent phosphorylation and activation of STAT1 and STAT2.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell culture. 293T human embryonic kidney cells, HeLa cells, and human foreskin fibroblasts (HFF) were obtained from ATCC and maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Invitrogen). Cells were transfected according to the manufacturer's directions with Fugene6 transfection reagent (Roche). Cells were stimulated with 1,000 U/ml of universal type I IFN- (R&D Systems) for the times indicated in the legends for Fig. 2, 4, 6, 7, and 8.

View larger version (21K): [in this window] [in a new window]

FIG. 2. A functional screen identifies the product of orf10 as a potent and specific inhibitor of cellular IFN signaling. (A) 293T cells were transiently transfected with an IFN-responsive ISRE-luciferase reporter construct together with empty vector or expression plasmids carrying individual KSHV ORFs. Forty-eight hours posttransfection, the cells were stimulated with 1,000 U IFN- for 8 h, and IFN-induced luciferase activity was analyzed in accordance with the manufacturer's directions. (B) 293T cells were transiently transfected in triplicate with ISRE, NF-B, or KSHV Pan-luciferase reporter constructs together with either empty vector (pLPCX) or an orf10 expression construct (pLPCX-ORF10), and a thymidine kinase-Renilla-luciferase normalizing plasmid. After 48 h, the cells were either left unstimulated or stimulated with IFN- or tumor necrosis factor alpha (TNF-) for 8 h to activate ISRE- or NF-B-luciferase transcription. For activation of the Pan promoter, the cells were cotransfected with KSHV RTA. Cells were lysed and analyzed by dual luciferase assays according to the manufacturer's instructions. Results from triplicate experiments are displayed as induction over that for the uninduced control; error bars represent standard deviations of the means.

View larger version (23K): [in this window] [in a new window]

FIG. 4. RIF inhibits signaling downstream of the type I IFN receptor. (A) 293T cells were transiently cotransfected with the CD8 cell surface marker and either empty vector (pcDNA3.1) or a pcDNA3.1-FLAG-RIF expression construct. Thirty-six hours posttransfection, CD8-positive cells were isolated by MACS as described in Materials and Methods. The cells were allowed to recover overnight before stimulation with 1,000 U IFN- for 20 min. RIPA lysates were prepared and analyzed by Western blotting for total and phospho-Stat1, -Stat2, -Tyk2, and -Jak1 as well as FLAG-RIF and actin (bottom two panels). (B) Nuclear extracts were prepared from 293T cells or MACS-enriched 293T cells transiently transfected with empty vector (pcDNA3.1) or a FLAG-RIF expression construct after stimulation with 1,000 U IFN- for 15 min. Equal amounts of nuclear extracts were resolved by SDS-PAGE for Western blotting and analyzed for the presence of nuclear STAT1 and STAT2. (C) RNA was isolated from enriched populations of 293T cells transiently coexpressing CD8 and either vector alone (pcDNA3.1) or pcDNA3.1-FLAG-RIF that had been either left unstimulated or treated with 1,000 U IFN- overnight prior to MACS sorting. The RNA was analyzed by Northern blotting using a probe against ISG15 (top) and by quantitative RT-PCR using ISG15-specific ABI probes (bottom). The results shown are means of four independent reactions normalized to internal GAPDH and are represented as induction over that for uninduced control samples.

View larger version (20K): [in this window] [in a new window]

FIG. 6. RIF is constitutively bound to the type I IFN receptor. (A) 293T cells were cotransfected with epitope-tagged versions of IFNAR1 and IFNAR2 subunits together with vector alone (pcDNA3.1) or a pcDNA3.1-VSV-G-RIF expression construct. Forty-eight hours posttransfection, the cells were either left unstimulated or treated with 1,000 U IFN- for 20 min, followed by lysis in RIPA buffer. IFNAR1-FLAG and IFNAR2-HA were immunoprecipitated from equal amounts of cell extracts, and the immune complexes were resolved by SDS-PAGE for Western blotting analysis. RIF associated with the individual IFN receptor subunits was visualized using RIF-specific polyclonal antiserum (bottom panels). Expression and efficient immunoprecipitation of the receptor subunits were visualized using antibodies specific to the FLAG or HA epitope tags and are shown in the top panels. (B) HeLa cells were plated in chamber slides for immunofluorescence analysis and transiently transfected with empty vector (pcDNA3.1) or a pcDNA3.1-VSV-G-RIF expression vector together with an IFNAR1-FLAG expression construct. Forty-eight hours following transfection, the cells were prepared for immunofluorescence as described in Materials and Methods; the ectopically expressed proteins were visualized using anti-FLAG monoclonal antibody to detect IFNAR1 together with RIF-specific polyclonal antiserum, followed by incubation with anti-mouse rhodamine and anti-rabbit fluorescein isothiocyanate (FITC) secondary antibodies. Immunofluorescence images were taken at 80x magnification using a DeltaVision restoration microscope. Scale bar, 15 µm. , anti.

View larger version (24K): [in this window] [in a new window]

FIG. 7. RIF does not obstruct binding of Jak and STAT proteins to the IFN receptor. (A) 293T cells were cotransfected with an IFNAR2-HA expression construct together with STAT1, STAT2, or Tyk2 (negative control) and a 10-fold excess of either empty vector (pcDNA3.1) or a pcDNA3.1-FLAG-RIF expression vector. Forty-eight hours posttransfection the cells were either left unstimulated or stimulated with 1,000 U IFN- for 20 min, and cell-free RIPA lysates were prepared. RIF or the IFNAR2 subunit was precipitated using anti-FLAG- or anti-HA-agarose gel, respectively. Coimmunoprecipitation of STAT1, STAT2, and Tyk2 with the receptor in the presence and absence of RIF was assessed by Western blotting using antibodies specific to the individual proteins. Expression and immunoprecipitation (IP) of IFNAR2 and RIF were assessed using HA- and RIF-specific antibodies (bottom two panels). RIF coimmunoprecipitating with the IFNAR2-HA receptor chain is visible in a longer exposure. (B) 293T cells were transfected with IFNAR1-FLAG and Tyk2 or IFNAR2-HA and Jak1-VSV-G expression constructs together with increasing amounts of VSV-G-RIF or FLAG-RIF, respectively. The individual receptor subunits were immunoprecipitated from RIPA lysates by means of their respective epitope tags, and coimmunoprecipitation of the receptor-associated kinases was assessed by Western blotting. The endopeptidase Ubp43 was included as a positive control (bottom panels). GST, glutathione S-transferase.

View larger version (25K): [in this window] [in a new window]

FIG. 8. RIF promotes binding of STAT2 to the IFNAR1 subunit. 293T cells were transiently cotransfected with IFNAR1-FLAG and STAT2 expression constructs, together with increasing amounts of a pcDNA3.1-VSV-G-RIF expression vector. Forty-eight hours posttransfection, untreated cells and cells stimulated with 1,000 U IFN- for 5 min were lysed in RIPA lysis buffer. IFNAR1-FLAG was immunoprecipitated from equal amounts of protein lysate, and the presence of STAT2 in the immune complexes and total extract was detected by Western blotting using a STAT2-specific antibody.

Virus infection. HFF were infected with KSHV in the presence of 3.2 µg/µl Polybrene such that approximately 100% latency-associated nuclear antigen-positive cells were obtained. Forty-eight hours postinfection, the cells were induced into the lytic replication cycle by superinfection with 10⁴ PFU adenovirus expressing RTA (Ad-RTA) in the presence of 1 µg/ml poly-L-lysine. The cells were lysed and analyzed by Western blotting 48 h after lytic induction.

Plasmids. Expression plasmids for N-terminally epitope-tagged RIF were constructed in pcDNA3.1Puro, a derivative of pcDNA3.1 (Invitrogen) in which the neomycin resistance gene has been replaced with the puromycin resistance gene (41). FLAG- and vesicular stomatitis virus glycoprotein (VSV-G)-tagged RIF constructs were generated by inserting a PCR-amplified orf10 gene with an epitope tag coding sequence into the BamHI and EcoRI (FLAG-RIF) or HindIII and XhoI (VSV-G-RIF) sites of pcDNA3.1Puro using the following primer pairs: 5'BamHI-FLAG-RIF (TTACCGGATCCGCCACCATGGATTACAAGGATGACGATTACCGGATCCGCCACCATGGATTACAAGGATGACGACGATAAGGGCGGAGGGCAGACAGAGGCAACGTTCATC) and 3'EcoRI-RIF (ATTACGAATTCTCACGATTGCATGGGTTCCTC) and 5'HindIII-VSV-G-RIF (CCCAAGCTTGGGCCACCATGTACACTGATATCGAAATGAACCGCCTGCCCAAGCTTGGGCCACCATGTACACTGATATCGAAATGAA CCGCCTGGGTAAGGGCGGAGGGCAGACAGAGGCAACGTTC) and 3'EcoRI-RIF (CCGGAATTCCGGTCACGACCGGAATTCCGGTCACGATTGCATGGGTTCCTCG). STAT1 (catalog number MGC-3494 from ATCC) was N-terminally tagged by PCR using hemagglutinin (HA)-containing oligonucleotides (5'BamHI-HA-STAT1, AGATAGGATCCACCATGTACCCATACGATGTTCCAGATTACGCTCTTTCTCAGTGGTAGAACTTCAG, and 3'EcoRI-STAT1, AATCGGAATTCTTACACTTCAGACACAGAAATCA) and cloned into the BamHI and EcoRI sites of pcDNA3.1Puro. STAT2 (catalog number 10469088 from ATCC) was PCR amplified (5'KpnI-STAT2, AGATAGGTACCATGCTTGCGCCAGTGGGAAATGCTGC; 3'EcoRI-STAT2, AATCGGAATTCCCTAGAAGTCAGAAAATCGGAATTCCCTAGAAGTCAGAAGGCATC) and cloned into the KpnI and EcoRI sites of pcDNA3.1Puro. The Tyk2 (catalog no. 10659146 from ATCC) coding sequence was PCR amplified (5'EcoRI-Tyk2 AATACGAATTCACCATGCCTCTGCGCCACTGGG and 3'NotI-Tyk2 TCA GCACACGCTGAACACTGAAGGG) and cloned into the EcoRI and NotI sites of pcDNA3.1Puro. Sandra Pellegrini produced the pRC-CMV-VSV-G-Jak1 expression construct, Serge Fuchs produced the pcDNA3.1-IFNAR1-FLAG expression construct, and John Krolewski produced the pcDNA3.1Zeo-IFNAR2-HA vector, all of which were provided to us via Dong-Er Zhang. pEBG-mUbp43 was a generous gift from Dong-Er Zhang. ISRE- and NF-B-firefly luciferase reporter constructs were obtained from BD Biosciences (Clontech), the pRL-TK-renilla luciferase normalizing plasmid was from Promega. pGL3-Nut1-luciferase (19) and pcDNA3.1-RTA (27) were described previously. The KSHV RIF expression library construct used in the screen is described by Coscoy and Ganem and Glaunsinger and Ganem (6, 12).

Riboprobes for Northern blotting were obtained by cloning PCR-amplified fragments of 500 bp of the RIF gene (5' ORF10, GACGGGAGAAAGACTTTGCA; 3' RIF, CCGGCGTTGGCACCAGTGC) and the ISG15 gene (5' ISG15, GACGGGAGAAAGACTT TGCA; 3' ISG15, TTAGCTCCGCCCGCCAGG) into pCR4-TOPO (Invitrogen).

MACS. 293T cells were plated in T-150 flasks and transfected with 9 µg of pcDNA3.1Puro or pcDNA3.1-FLAG-RIF together with 1 µg of a CD8 expression plasmid (pSamen-CD8), a generous gift from Lewis Lanier. Approximately 30 h after transfection, the cells were briefly trypsinized and washed twice in degassed magnetic-bead-assisted cell sorting (MACS) buffer (phosphate-buffered saline [PBS], 0.5% bovine serum albumin [BSA], and 2 mM EDTA). Pelleted cells were resuspended in 80 µl MACS buffer and 80 µl CD8 Microbeads per flask (catalog number 130-045-201; Miltenyi Biotech) and incubated on ice for 20 min. The cells were then washed three times in MACS buffer, resuspended in 500 µl MACS buffer, and loaded on an equilibrated LS column on a MACS separator (Miltenyi Biotech). The column was washed three times with 3 ml MACS buffer each, and the cells were flushed from the column with 5 ml of MACS buffer away from the magnet. Recovery of CD8-positive cells was approximately 15 to 20% of total cells. The cells were spun down, resuspended either directly in RNA Bee for RNA preparation or in cell culture medium for plating in 100-mm tissue culture dishes, and allowed to recover overnight before further analysis.

RNA preparation and Northern blotting, rapid amplification of cDNA ends (RACE), and TaqMan reverse transcription-PCR (RT-PCR). RNA was prepared using RNA Bee (Tel-test, Inc., Friendswood, TX) according to the manufacturer's directions. Polyadenylated RNA was purified using the Oligotex mRNA kit (Qiagen). One hundred nanograms of purified RNA was separated on a 1% agarose-formaldehyde gel and transferred to nylon membranes using Turbo Blot kits (Schleicher & Schuell) according to the manufacturer's instructions. The transferred membranes were rinsed in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and auto-cross-linked twice (UV Stratalinker 2400; Stratagene). The blots were prehybridized in Ultrahyb (Ambion), followed by hybridization with ³²P-labeled probes. Riboprobes were generated using Maxiscript kits (Ambion).

5' and 3' RACE was performed on poly(A)-purified RNA using the FirstChoice RNA ligase-mediated RACE kit (Ambion) according to the manufacturer's recommendations, and the resulting clones were analyzed by direct sequencing.

For quantitative RT-PCR, 293T cells were stimulated for 16 h with 1,000 U IFN- and enriched for CD8/RIF-positive cell populations by MACS and RNA was isolated using RNA Bee reagent. First-strand cDNA was generated by reverse transcription using random primers and Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's recommendations. The resulting cDNA was analyzed by quantitative PCR using 6-carboxytetramethylrhodamine probes specific for ISG15 and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (Applied Biosystems) and TaqMan universal PCR master mix (Applied Biosystems) on a 7300 real-time PCR system (Applied Biosystems). Results shown are normalized to GAPDH.

Cell extracts, immunoprecipitation, and nuclear fractionation. 293T cells were plated in six-well dishes and transiently transfected with a total of 2 µg of DNA using Fugene6 transfection reagent (Roche). Forty-eight hours posttransfection, the cells were washed with PBS and lysed in 350 µl radioimmunoprecipitation assay (RIPA) lysis buffer (PBS, 0.5% Na deoxycholate, 0.1% NP-40, 1% Triton X-100) containing complete protease inhibitor (Roche) and 100 µM sodium orthovanadate. The cell lysates were rocked at 4°C to allow for complete lysis to occur and cleared by high-speed centrifugation for 10 min at 4°C. The lysates were quantitated by Bradford protein assay (Bio-Rad), and immunoprecipitations were performed from 500 µg total protein lysates using 20 µl of a 50% slurry of anti-FLAG M1 affinity gel (Sigma) in RIPA buffer. Immunoprecipitations were carried out for 2 h at 4°C, and the immune complexes were washed five times with lysis buffer, resuspended in 25 µl 2x sodium dodecyl sulfate (SDS) loading buffer, boiled, and resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) for Western analysis.

Nuclear extracts from MACS-enriched cell populations were prepared by hypotonic lysis (10 mM HEPES, pH 7.8; 10 mM KCl; 3 mM MgCl₂; 1 mM EDTA; 0.05% NP-40), followed by extraction of nuclear proteins under high-salt conditions (10 mM HEPES, pH 7.8; 400 mM NaCl; 0.1 mM EDTA; 25% glycerol); 1 mM dithiothreitol and protease inhibitors (Roche) were added to both buffers prior to use. Protein concentrations were determined by bicinchoninic acid protein assay (Bio-Rad), and equal amounts of nuclear extract were resolved by SDS-PAGE and analyzed for the presence of nuclear STAT1 and STAT2 on a Western blot.

Immunoblotting. Protein samples were separated by 10% SDS-PAGE and transferred to polyvinylidene membranes (Millipore). Membranes were blocked in 5% nonfat dry milk in TBS-T (10 mM Tris, pH 8; 150 mM NaCl; 0.05% Tween 20). Primary antibodies were used at the following dilutions: phospho-specific antibodies to STAT1, Tyk2, and Jak1 (Cell Signaling) and STAT2 (R&D Systems), 1:500; anti-STAT1 and anti-STAT2 antibodies (Santa Cruz), 1:1,000; Jak1 (Santa Cruz) and Tyk2 (Upstate) antibodies, 1:500; FLAG M2 (Sigma), 1:1,000 (Western blotting) or 1:500 (immunofluorescence assay); HA 12CA5 antibody, 1:5,000. Rabbit antiserum against RIF was generated with a keyhole limpet hemocyanin-conjugated synthetic peptide corresponding to amino acids 403 to 416 of the full-length RIF protein (CHVAIRADRHEEPM) and used at a 1:1,000 dilution for Western blotting or at a 1:500 dilution in the immunofluorescence assay.

Immunofluorescence. HeLa cells were plated in Lab-Tek chamber slides (Nalge Nunc International) and transfected with IFNAR1-FLAG and IFNAR2-HA together with either vector alone (pcDNA3.1Puro) or pcDNA3.1-/VSV-G-RIF. Forty-eight hours posttransfection, the cells were fixed with 4% paraformaldehyde for 15 min, blocked in PBS-3% BSA for 30 min, and permeablized for 2 min using PBS-3% BSA-0.5% Triton X-100. The cells were incubated with anti-FLAG M2 monoclonal antibody together with anti-RIF polyclonal antibody (both at 1:500 dilution) in PBS-3% BSA for 1 h, washed three times with PBS, and incubated with anti-mouse rhodamine and anti-rabbit fluorescein isothiocyanate (Santa Cruz Biotechnology) secondary antibodies for 1 h in the dark. The slides were washed in PBS and mounted in Vectashield mounting medium (Vector Laboratories Inc., Burlingame, CA) Cells were viewed at 80x magnification using a DeltaVision restoration microscope, and images were processed using Adobe Photoshop software; a single section through the middle of the cell is shown (see Fig. 6).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
KSHV infection abrogates the cellular type I IFN response. In cell culture, the default pathway of KSHV infection is latency; lytic infection can be triggered in such cells by ectopic expression of the viral transcription factor RTA, which induces the switch from latent to lytic gene expression. Accordingly, to study IFN signaling during lytic replication, we infected HFF with KSHV and then superinfected with an Ad-RTA; following lytic induction, we exposed cells to type I IFN and examined the state of STAT phosphorylation by immunoblotting with antibodies specific for total or phosphorylated STAT proteins.

Figure 1 shows that phosphorylation of STAT1 was potently suppressed in cells sustaining a lytic viral infection following exposure to type I IFN, even though total STAT1 protein accumulation appeared to be enhanced (Fig. 1A). STAT2 phosphorylation was similarly inhibited in such cells, while total STAT2 protein levels were unaffected (Fig. 1A, third and fourth panels). Control cells infected with Ad-RTA alone behaved similarly to uninfected cells and showed strong activation of STAT proteins in response to stimulation with IFN (Fig. 1A). Suppression of STAT phosphorylation was observed at 24 h and 48 h postreactivation (Fig. 1B). Equal protein loading over the individual lanes was verified by actin Western blotting (Fig. 1, bottom panels). These data indicate that KSHV induces a profound block to the activation of the type I IFN response during its lytic infection cycle.

View larger version (17K): [in this window] [in a new window]

FIG. 1. Lytic KSHV infection inhibits IFN signaling in HFF. (A) HFF were latently infected with KSHV for 48 h to achieve close to 100% latency-associated nuclear antigen-positive cells. Latent HFF were reactivated by superinfection with Ad-RTA for a further 48 h. The cells were left unstimulated or stimulated with 1,000 U IFN- for 20 min and lysed in RIPA lysis buffer, and equal amounts of total extract were resolved by SDS-PAGE and analyzed for phospho-701Y and total STAT1 proteins, as well as cellular actin as a loading control. The blot was reprobed with antibodies to phospho-690Y and total STAT2 (middle panels). Uninfected cells and cells infected with Ad-RTA alone were included as controls. (B) IFN--induced phosphorylation of STAT1 in KSHV-infected HFF was assessed 24 h and 48 h after lytic reactivation with Ad-RTA.

A functional screen of a KSHV expression library identifies ORF10/RIF as a potent and specific suppressor of IFN signaling. In order to identify KSHV lytic gene products potentially responsible for inhibiting IFN signaling, we devised a functional screen to systematically assay a panel of 80 KSHV open reading frames (ORFs) for the ability of their products to suppress IFN-induced upregulation of an ISRE-luciferase reporter construct. This screen yielded two candidates that reproducibly and specifically blocked induction of the reporter by IFN. One of these factors, encoded by ORF 10 (orf10) is the subject of the present report; the other viral factor, encoded by ORF 45, will be characterized separately.

Figure 2A shows a representative example of the results of the screen, here displaying 10 of the 80 viral genes ultimately screened. A profound inhibition of IFN signaling by expression of orf10 is evident (the mild inhibition by expression of orf7 shown in Fig. 2A was not reproducible on multiple replicate assays). Notably, orf10 expression did not impair tumor necrosis factor alpha-triggered NF-B activation or RTA-dependent activation of the KSHV Pan promoter (Fig. 2B), indicating that its inhibitory activity was specific to IFN-mediated signaling. Based on this activity, and in keeping with standard nomenclature practices for KSHV, we propose the designation RIF (regulator of IFN function) for the orf10-encoded gene product.

RIF is encoded by a delayed-early, bicistronic message. RIF represents a previously uncharacterized viral gene product. Since the gene had not previously been observed to be transcribed in latency, we thought it likely that RIF has a lytic function. Consistent with this, Northern blotting revealed its mRNA to be strongly tetradecanoyl phorbol acetate (TPA) inducible in BCBL-1 cells, which carry latent KSHV genomes and can be induced into the lytic cycle by treatment with phorbol esters (37). The kinetics of this induction (Fig. 3A) strongly suggest that RIF is a delayed-early lytic gene product; this agrees with previously published microarray studies of KSHV transcription during lytic reactivation (35).

View larger version (47K): [in this window] [in a new window]

FIG. 3. orf10 is an early transcript carried on a 2.6-kb unspliced, bicistronic transcript. (A) BCBL-1 cells constitutively carrying the viral episome were induced for the indicated times with TPA to induce lytic viral gene expression, and poly(A)-purified RNA was subjected to Northern analysis using an orf10 riboprobe. Poly(A)-enriched RNA from uninfected BJAB cells was included as a negative control (left lane). (B) 5' and 3' RACE was performed on RNA isolated from BCBL-1 cells after 24 h of lytic induction with TPA. The 5' and 3' boundaries of orf10 were confirmed by RT-PCR using oligonucleotides annealing to the indicated transcriptional start site of orf10, as well as up- and downstream of the putative poly(A) signal. The sequence of the orf10 transcript expressed in BCBL-1 cells was confirmed by direct sequencing of the RT-PCR product. A putative AP-1 binding site and TATAA box in the 5' untranslated region of the transcript are indicated.

We note that the genes used in the screen for the IFN signaling blockade were cloned based on the ORFs predicted by the genomic DNA of KSHV. As such, they do not include changes that might have been introduced by RNA splicing or editing during viral replication. It therefore was imperative to determine the cDNA structure of authentic RIF mRNAs produced during lytic infection to ensure that the ORF used in the screen was indeed expressed as such during KSHV infection. The predominant RIF gene transcript detected in Fig. 3A is approximately 2.6 kb in length, much larger than orf10 itself. Detailed characterization of the transcript by RT-PCR, 5' and 3' RACE, and molecular cloning and sequencing of the resulting cDNAs revealed that orf10 is transcribed as an unspliced, bicistronic message together with orf11 (Fig. 3B). Figure 3B also shows the start site of RIF mRNA and the positions of a putative TATAA box and AP-1 recognition site; the presence of the latter suggests that orf10-orf11 transcription may be subject to regulation by the cellular mitogen-activated protein kinase pathway. Collectively, the data obtained from the molecular characterization of the endogenous locus corroborate that the orf10 construct used in the screen indeed corresponds to the gene product generated during a bona fide infection.

RIF suppresses signaling downstream of the type I IFN receptor. To determine if RIF is capable of inhibiting phosphorylation of signaling proteins acting downstream of the type I IFN receptor, as we had previously observed in a bona fide infection (Fig. 1), we investigated the phosphorylation state of these proteins following IFN exposure in the presence of RIF. Since continuous, high-level expression of RIF was not tolerated by cells, we were unable to obtain stable cell lines expressing the protein. Accordingly, we transiently cotransfected cells with expression vectors for RIF (tagged with a Flag epitope) and CD8 and then used a MACS method to selectively capture transfected cells on the basis of their surface CD8; 80 to 90% of these cells stained positive for RIF by indirect immunofluorescence (data not shown). These cells were then examined by immunoblotting for total as well as phosphorylated Jak and STAT proteins. Comparison of the IFN-induced phosphorylation state of endogenous Jak1, Tyk2, STAT1, and STAT2 in cells expressing RIF to that in vector control cells revealed a marked suppression of their phosphorylation in the presence of RIF (Fig. 4A). Controls demonstrating equal protein loading in each lane (as assessed by actin Western blotting) and efficient RIF expression are shown in the bottom two panels of Fig. 4A. Concordant with the inhibition in upstream signaling events in the presence of RIF, nuclear accumulation of STAT proteins was impaired as well in RIF-transfected cells (Fig. 4B). This correlated with a substantial decrease in the accumulation of the mRNA for the IFN-inducible ISG15 gene in the presence of RIF, as judged by both Northern blotting and quantitative real-time RT-PCR (Fig. 4C).

Jak1, STAT2, and a subpopulation of Tyk2 are constitutively associated with RIF. The data presented above suggest that the KSHV-encoded RIF protein impedes cellular IFN function by blocking signaling events downstream of the type I IFN receptor. To further characterize the biochemical networks in which RIF operates, we transiently coexpressed RIF together with the individual signaling proteins acting downstream of the type I IFN receptor and looked for interactions by coimmunoprecipitation. As shown in Fig. 5, RIF robustly associated with Jak1 as well as STAT2 and showed a weaker but reproducible association with Tyk2. STAT1 did not seem to complex with RIF, nor did the negative control, Myc-tagged MK2. The observed biochemical interactions were independent of and not enhanced by IFN stimulation (data not shown). These data suggest that RIF's ability to downregulate IFN-induced signaling responses might be due to its interaction with the STAT2 transcription factor, as well as the upstream kinases Jak1 and to a lesser extent Tyk2.

View larger version (19K): [in this window] [in a new window]

FIG. 5. RIF associates with mediators of type I IFN signaling. 293T cells were transiently cotransfected with expression constructs encoding Jak1, Tyk2, STAT1, or STAT2 together with either an empty vector (pcDNA3.1) or a pcDNA3.1-FLAG-RIF expression vector. Forty-eight hours posttransfection, cell-free RIPA lysates were prepared, from which FLAG-RIF was immunoprecipitated. The immune complexes were resolved by SDS-PAGE, and the corresponding Western blots were probed for coimmunoprecipitating proteins using antibodies specific for Jak1, Tyk2, STAT1, or STAT2. Myc-MK2 was included as a negative control. FLAG-RIF expression and efficient immunoprecipitation, as well as equal protein loading as assessed by actin Western blotting, are shown in the bottom two panels. hc, heavy chain of immunoglobulin.

RIF acts at the level of the type I IFN receptor. Activation of the receptor-associated kinases Jak1 and Tyk2 is prevented in the presence of RIF (Fig. 4A), indicating that RIF impedes IFN-induced signaling at an early, membrane-proximal stage. Therefore, we assessed whether RIF was able to associate with the type I IFN receptor itself. To this end, we transiently cotransfected constructs encoding epitope-tagged individual receptor subunits (IFNAR1 and IFNAR2) with the coding sequence for epitope-tagged RIF and then immunoprecipitated the corresponding IFNAR chain and examined the precipitate by blotting for RIF. As shown in Fig. 6A, RIF interacted with both the IFNAR1 and IFNAR2 subunits, even in the absence of IFN. Furthermore, in vivo colocalization of IFNAR1 and RIF is apparent in indirect immunofluorescence analysis as shown in Fig. 6B.

Close inspection of Fig. 6A also reveals that, in the presence of RIF, the levels of IFNAR1, but not IFNAR2, in the total cell extract are substantially increased over those of vector-transfected cells. Recall that, in the ground state, IFNAR1 is associated with Tyk2, and several recent reports have established that Tyk2 binding to IFNAR1 plays a dominant role in enhancing the stability of this receptor subunit at steady state by countering its endocytosis and trafficking to the lysosome for degradation (36). This activity is independent of Tyk2's kinase activity (11, 38, 47), and its structural basis is incompletely understood. Tyk2 does not appear to act by interfering with IFNAR1 ubiquitination, and it has been speculated that its binding may occlude other signals involved in endocytosis (21). Our finding that RIF augments the accumulation of IFNAR1 both in the absence and presence of IFN further sustains the conclusion that IFNAR1 stabilization is independent of Tyk2 kinase activity and is consistent with the view that the Tyk2 molecules bound by RIF (Fig. 5) are likely also bound to IFNAR1 and are functionally important for this activity.

RIF does not displace receptor-associated signaling proteins. STAT2 and to a lesser extent STAT1 are constitutively bound to the IFNAR2 subunit and are primed for activation by the receptor-resident Jak kinases. Given its strong interaction with STAT2, we reasoned that RIF might exert its inhibitory function (at least in part) by preventing STAT2 binding to the IFN receptor. However, the presence of excess RIF did not affect the amount of STAT1 or STAT2 bound to the IFNAR2 subunit, even though IFNAR2 was still found in association with RIF (Fig. 7A, lower two panels). The same results were obtained regardless of whether or not the cells had been stimulated with IFN (Fig. 7A). As expected, Tyk2 was not present in a complex with IFNAR2 (Fig. 7A).

The cellular protein Ubp43 has recently been demonstrated to compete with binding of Jak1 to the IFNAR2 subunit, thereby terminating IFN-induced signaling responses (29). Since RIF interacts with both IFNAR subunits, it is conceivable that RIF might act in a similar manner by displacing the receptor-associated kinase Tyk2 or Jak1 or both from the tails of their respective receptor subunits. However, expression of increasing amounts of RIF did not affect association of either Tyk2 or Jak1 with IFNAR1 or IFNAR2, respectively, as shown by the ability of the kinases to coimmunoprecipitate with the individual receptor subunits even in the presence of high levels of RIF (Fig. 7B). In fact, RIF expression appeared to recruit additional Tyk2 subunits to IFNAR1, a result that again affirms the interactions of RIF with IFNAR-associated Tyk2. Glutathione S-transferase-Ubp43 was included as a positive control and demonstrated efficient displacement of Jak1 from its IFN receptor subunit (Fig. 7B, bottom panel).

RIF retains STAT2 at the IFN receptor. Following IFN binding to the common type I receptor, the individual IFNAR subunits are brought together and STAT2 translocates from the IFNAR2 subunit to the IFNAR1 receptor chain, where it can subsequently be phosphorylated and activated by Jak1 (32, 46). Normally, this recruitment is dependent on IFN binding to the receptor. However, by cotransfecting IFNAR1 with increasing amounts of a tagged RIF construct, we found that endogenous STAT2 could be recruited to IFNAR1 in the presence of RIF; this occurs even in the absence of IFN (Fig. 8). Such complexes are not observed in the absence of RIF (Fig. 8), indicating that another activity of RIF (or of RIF-STAT2 complexes) is to promote aberrant association of STAT2 with IFNAR1.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The data presented here reveal that lytic KSHV infection produces a strong block to IFN signaling, associated with failure to phosphorylate the STATs and subsequent inability to induce ISG expression. Our screen for candidate inhibitors identified two new viral gene products that block IFN-dependent ISRE-luciferase reporter expression. RIF, the product of orf10, is the first of these proteins to be characterized in detail. RIF appears to be a pleiotropic regulator of the IFN signaling pathway, acting very proximally in the signaling cascade. It forms complexes with Jak1, Tyk2, STAT2, and both IFNAR subunits; such complexes appear to be inhibitory to the kinase activity of both Tyk2 and Jak1. While RIF does not affect the constitutive (basal) association of the STATs with IFNAR2, it is able to recruit STAT2 aberrantly to IFNAR1 in the absence of IFN. Although the inhibition of Jak1 and Tyk2 can suffice to explain the block to IFN signaling, the aberrant repositioning of STAT2 at the receptor may further diminish its ability to undergo phosphorylation by the residual Jak1 activity. Interestingly, RIF's inhibition of Tyk2 kinase activity does not extend to diminishing the ability of Tyk2 to stabilize IFNAR1 chains—indeed, if anything RIF expression appears to enhance IFNAR1 accumulation (Fig. 6A). Since RIF can bind to Tyk2 on this subunit and prevent induction of Tyk2 kinase activity as well as cause aberrant translocation of STAT2 to IFNAR1, it is tempting to speculate that the accretion of these large complexes on IFNAR1 may further impede access of the endocytotic machinery to relevant signals on the receptor chain.

How RIF complexes mediate their inhibitory action at IFNAR remains a matter for further investigation. One attractive model for this inhibition would be that RIF may promote recruitment of a phosphatase into the signaling complex. Japanese encephalitis virus NS5 protein antagonizes IFN signaling by means of recruitment of an unidentified phosphatase (24), and it has been suggested that hepatitis C virus interferes with STAT1 activation by upregulating protein phosphatase 2A (8). The SH2 domain-containing phosphatases, Shp1 and Shp2, have been implicated in the attenuation of IFN signaling by dephosphorylation and inactivation of Jak and STAT proteins (7, 48). Interestingly, we found that RIF associates with both Shp1 and Shp2 in coimmunoprecipitation experiments (data not shown), and it is conceivable that this interaction might contribute to RIF's ability to counteract signaling downstream of the type I IFN receptor. However, thus far, we have been unable to establish a definitive role for these phosphatases in RIF's inhibitory activity. Alternatively, RIF might impede Jak1 activation either by direct sequestration of the kinase or by disturbing the configuration of the receptor complex in such a way that does not permit Jak1 activation, which in turn would preclude Tyk2 activation. Other models, of course, remain possible.

Lastly, it is instructive to consider our findings in the context of other inhibitors of IFN signaling, both in KSHV and in other animal viruses.

Inhibitors of IFN signaling are well-known among the RNA viruses, attesting to the importance of this pathway in defense against such viruses (16). However, much less is known of how herpesviruses evade the IFN response and go on to establish persistent infections in their hosts. One report has indicated that treatment of cells with a KSHV-encoded homolog of interleukin-6 (IL-6) (known as vIL-6) can antagonize type I IFN in uninfected cultured cells, as judged by impaired formation of active ISGF3 transcription factor (5, 9). In addition, inhibition of IFN-induced ISRE reporter activation by vIRF2 has been reported (5, 9). Interestingly, our search did not identify vIL-6 as an inhibitor of IFN signaling, nor did directed reassay of the associated gene show suppression of ISRE-luciferase activation. vIRF2 similarly did not score strongly in our screen, although close inspection of the data revealed a weak suppression of ISRE-luciferase reporter activity in response to IFN (S. A. Bisson, unpublished results).

It seems clear that RIF is not the only locus in KSHV that can inhibit IFN-inducible gene expression, as a second, lytically expressed locus that was highly active in this regard also emerged from our screen. We also observed a block to IFN-induced signaling events in acutely infected HFF that were not directly stimulated to enter the lytic cycle (S. A. Bisson, unpublished). Although this might indicate the existence of latency functions that affect IFN signaling, none of the known latency genes suppressed IFN signaling in our assays. Moreover, Krishnan et al. (20) have shown that many lytic genes can be abortively expressed under these circumstances, indicating that this effect may not be attributable to classical latent gene expression. Be that as it may, with at least two KSHV proteins devoted to inhibition of IFN signaling and four proteins that can antagonize IFN induction or amplification, it is clear that KSHV evolution has selected very strongly for abrogation of IFN action, implying a key role for IFN in the control of this herpesvirus from early in its evolutionary history. This redundancy is an extreme example of a phenomenon that has been seen in other viral systems, many of which devote several viral genes to nullification of IFN induction or action (16, 44, 45).

KSHV RIF differs from most viral regulators of IFN signaling in its extremely proximal site of action, blocking both Jak kinases through inhibitory complexes on the type I IFN receptor. Only a few other regulators are known to block signaling at the Jak kinase level. The E6 protein of human papillomavirus 18 (HPV 18) (but not that of HPV 11) has been reported to bind to Tyk2 selectively and prevent its activation (23). Japanese encephalitis virus infection also selectively blocks Tyk2 phosphorylation (25), and West Nile virus infection impairs phosphorylation of both Tyk2 and Jak1 (15), but in both cases the mediators of this blockade are unknown. Most viral IFN signaling blockers operate at the level of STAT proteins by either targeting them for degradation (V protein of SV5 and other paramyxoviruses [13]), interfering with their phosphorylation (Sendai virus C protein [10]), impairing assembly with IRF9 (E7 protein of HPV 16 [1]), or impeding interaction of STAT1 with the transcriptional machinery (adenovirus E1A [26]). Thus, KSHV RIF is one of the more distinctive virally encoded modulators of IFN signaling yet encountered. Determination of RIF's direct and indirect interaction partners has potential to shed great light on finer aspects of the regulation of this important signaling pathway and should enrich our understanding of the mechanisms controlling herpesvirus replication and pathogenesis.

 
We are grateful to Jean Chen for help with the DeltaVision microscopy. We thank Sandra Pellegrini for the pRC-CMV-VSV-G-Jak1 expression construct, Serge Fuchs for the pcDNA3.1-IFNAR1-FLAG expression construct, and John Krolewski for the pcDNA3.1Zeo-IFNAR2-HA vector.

S.A.B. received financial support from the Howard Hughes Medical Institute. A.-L.P. was a recipient of the Bettencourt prize for young researchers and funding from the Howard Hughes Medical Institute.

 
* Corresponding author. Mailing address: Howard Hughes Medical Institute and GW Hooper Foundation, Departments of Microbiology and Medicine, University of California, San Francisco, CA 94143. Phone: (415) 476-2826. Fax: (415) 476-0939. E-mail: ganem{at}cgl.ucsf.edu

Published ahead of print on 11 March 2009.

These authors contributed equally to this work.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Barnard, P., and N. A. McMillan. 1999. The human papillomavirus E7 oncoprotein abrogates signaling mediated by interferon-alpha. Virology 259:305-313.[CrossRef][Medline]
2
2. Bouloy, M., C. Janzen, P. Vialat, H. Khun, J. Pavlovic, M. Huerre, and O. Haller. 2001. Genetic evidence for an interferon-antagonistic function of rift valley fever virus nonstructural protein NSs. J. Virol. 75:1371-1377.[Abstract/Free Full Text]
3
3. Bray, M. 2001. The role of the type I interferon response in the resistance of mice to filovirus infection. J. Gen. Virol. 82:1365-1373.[Abstract/Free Full Text]
4
4. Brierley, M. M., and E. N. Fish. 2002. Review: IFN-alpha/beta receptor interactions to biologic outcomes: understanding the circuitry. J. Interferon Cytokine Res. 22:835-845.[CrossRef][Medline]
5
5. Chatterjee, M., J. Osborne, G. Bestetti, Y. Chang, and P. S. Moore. 2002. Viral IL-6-induced cell proliferation and immune evasion of interferon activity. Science 298:1432-1435.[Abstract/Free Full Text]
6
6. Coscoy, L., and D. Ganem. 2000. Kaposi's sarcoma-associated herpesvirus encodes two proteins that block cell surface display of MHC class I chains by enhancing their endocytosis. Proc. Natl. Acad. Sci. USA 97:8051-8056.[Abstract/Free Full Text]
7
7. David, M., H. E. Chen, S. Goelz, A. C. Larner, and B. G. Neel. 1995. Differential regulation of the alpha/beta interferon-stimulated Jak/Stat pathway by the SH2 domain-containing tyrosine phosphatase SHPTP1. Mol. Cell. Biol. 15:7050-7058.[Abstract]
8
8. Duong, F. H., M. Filipowicz, M. Tripodi, N. La Monica, and M. H. Heim. 2004. Hepatitis C virus inhibits interferon signaling through up-regulation of protein phosphatase 2A. Gastroenterology 126:263-277.[CrossRef][Medline]
9
9. Fuld, S., C. Cunningham, K. Klucher, A. J. Davison, and D. J. Blackbourn. 2006. Inhibition of interferon signaling by the Kaposi's sarcoma-associated herpesvirus full-length viral interferon regulatory factor 2 protein. J. Virol. 80:3092-3097.[Abstract/Free Full Text]
10
10. Garcin, D., J. Curran, M. Itoh, and D. Kolakofsky. 2001. Longer and shorter forms of Sendai virus C proteins play different roles in modulating the cellular antiviral response. J. Virol. 75:6800-6807.[Abstract/Free Full Text]
11
11. Gauzzi, M. C., G. Barbieri, M. F. Richter, G. Uze, L. Ling, M. Fellous, and S. Pellegrini. 1997. The amino-terminal region of Tyk2 sustains the level of interferon alpha receptor 1, a component of the interferon alpha/beta receptor. Proc. Natl. Acad. Sci. USA 94:11839-11844.[Abstract/Free Full Text]
12
12. Glaunsinger, B., and D. Ganem. 2004. Lytic KSHV infection inhibits host gene expression by accelerating global mRNA turnover. Mol. Cell 13:713-723.[CrossRef][Medline]
13
13. Gotoh, B., T. Komatsu, K. Takeuchi, and J. Yokoo. 2001. Paramyxovirus accessory proteins as interferon antagonists. Microbiol. Immunol. 45:787-800.[Medline]
14
14. Grieder, F. B., and S. N. Vogel. 1999. Role of interferon and interferon regulatory factors in early protection against Venezuelan equine encephalitis virus infection. Virology 257:106-118.[CrossRef][Medline]
15
15. Guo, J. T., J. Hayashi, and C. Seeger. 2005. West Nile virus inhibits the signal transduction pathway of alpha interferon. J. Virol. 79:1343-1350.[Abstract/Free Full Text]
16
16. Haller, O., G. Kochs, and F. Weber. 2006. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344:119-130.[CrossRef][Medline]
17
17. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434:772-777.[CrossRef][Medline]
18
18. Hwang, S. Y., P. J. Hertzog, K. A. Holland, S. H. Sumarsono, M. J. Tymms, J. A. Hamilton, G. Whitty, I. Bertoncello, and I. Kola. 1995. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc. Natl. Acad. Sci. USA 92:11284-11288.[Abstract/Free Full Text]
19
19. Kirshner, J. R., D. M. Lukac, J. Chang, and D. Ganem. 2000. Kaposi's sarcoma-associated herpesvirus open reading frame 57 encodes a posttranscriptional regulator with multiple distinct activities. J. Virol. 74:3586-3597.[Abstract/Free Full Text]
20
20. Krishnan, H. H., P. P. Naranatt, M. S. Smith, L. Zeng, C. Bloomer, and B. Chandran. 2004. Concurrent expression of latent and a limited number of lytic genes with immune modulation and antiapoptotic function by Kaposi's sarcoma-associated herpesvirus early during infection of primary endothelial and fibroblast cells and subsequent decline of lytic gene expression. J. Virol. 78:3601-3620.[Abstract/Free Full Text]
21
21. Kumar, K. G., J. J. Krolewski, and S. Y. Fuchs. 2004. Phosphorylation and specific ubiquitin acceptor sites are required for ubiquitination and degradation of the IFNAR1 subunit of type I interferon receptor. J. Biol. Chem. 279:46614-46620.[Abstract/Free Full Text]
22
22. Kunzi, M. S., and P. M. Pitha. 2003. Interferon targeted genes in host defense. Autoimmunity 36:457-461.[CrossRef][Medline]
23
23. Li, S., S. Labrecque, M. C. Gauzzi, A. R. Cuddihy, A. H. Wong, S. Pellegrini, G. J. Matlashewski, and A. E. Koromilas. 1999. The human papilloma virus (HPV)-18 E6 oncoprotein physically associates with Tyk2 and impairs Jak-STAT activation by interferon-alpha. Oncogene 18:5727-5737.[CrossRef][Medline]
24
24. Lin, R. J., B. L. Chang, H. P. Yu, C. L. Liao, and Y. L. Lin. 2006. Blocking of interferon-induced Jak-Stat signaling by Japanese encephalitis virus NS5 through a protein tyrosine phosphatase-mediated mechanism. J. Virol. 80:5908-5918.[Abstract/Free Full Text]
25
25. Lin, R. J., C. L. Liao, E. Lin, and Y. L. Lin. 2004. Blocking of the alpha interferon-induced Jak-Stat signaling pathway by Japanese encephalitis virus infection. J. Virol. 78:9285-9294.[Abstract/Free Full Text]
26
26. Look, D. C., W. T. Roswit, A. G. Frick, Y. Gris-Alevy, D. M. Dickhaus, M. J. Walter, and M. J. Holtzman. 1998. Direct suppression of Stat1 function during adenoviral infection. Immunity 9:871-880.[CrossRef][Medline]
27
27. Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252:304-312.[CrossRef][Medline]
28
28. Maher, S. G., A. L. Romero-Weaver, A. J. Scarzello, and A. M. Gamero. 2007. Interferon: cellular executioner or white knight? Curr. Med. Chem. 14:1279-1289.[CrossRef][Medline]
29
29. Malakhova, O. A., K. I. Kim, J. K. Luo, W. Zou, K. G. Kumar, S. Y. Fuchs, K. Shuai, and D. E. Zhang. 2006. UBP43 is a novel regulator of interferon signaling independent of its ISG15 isopeptidase activity. EMBO J. 25:2358-2367.[CrossRef][Medline]
30
30. Marie, I., J. E. Durbin, and D. E. Levy. 1998. Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660-6669.[CrossRef][Medline]
31
31. Muller, U., U. Steinhoff, L. F. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, and M. Aguet. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918-1921.[Abstract/Free Full Text]
32
32. Nadeau, O. W., P. Domanski, A. Usacheva, S. Uddin, L. C. Platanias, P. Pitha, R. Raz, D. Levy, B. Majchrzak, E. Fish, and O. R. Colamonici. 1999. The proximal tyrosines of the cytoplasmic domain of the beta chain of the type I interferon receptor are essential for signal transducer and activator of transcription (Stat) 2 activation. Evidence that two Stat2 sites are required to reach a threshold of interferon alpha-induced Stat2 tyrosine phosphorylation that allows normal formation of interferon-stimulated gene factor 3. J. Biol. Chem. 274:4045-4052.[Abstract/Free Full Text]
33
33. Offermann, M. K. 2007. Kaposi sarcoma herpesvirus-encoded interferon regulator factors. Curr. Top. Microbiol. Immunol. 312:185-209.[Medline]
34
34. Ozato, K., P. Tailor, and T. Kubota. 2007. The interferon regulatory factor family in host defense: mechanism of action. J. Biol. Chem. 282:20065-20069.[Abstract/Free Full Text]
35
35. Paulose-Murphy, M., N. K. Ha, C. Xiang, Y. Chen, L. Gillim, R. Yarchoan, P. Meltzer, M. Bittner, J. Trent, and S. Zeichner. 2001. Transcription program of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus). J. Virol. 75:4843-4853.[Abstract/Free Full Text]
36
36. Ragimbeau, J., E. Dondi, A. Alcover, P. Eid, G. Uze, and S. Pellegrini. 2003. The tyrosine kinase Tyk2 controls IFNAR1 cell surface expression. EMBO J. 22:537-547.[CrossRef][Medline]
37
37. Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346.[CrossRef][Medline]
38
38. Richter, M. F., G. Dumenil, G. Uze, M. Fellous, and S. Pellegrini. 1998. Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J. Biol. Chem. 273:24723-24729.[Abstract/Free Full Text]
39
39. Ryman, K. D., W. B. Klimstra, K. B. Nguyen, C. A. Biron, and R. E. Johnston. 2000. Alpha/beta interferon protects adult mice from fatal Sindbis virus infection and is an important determinant of cell and tissue tropism. J. Virol. 74:3366-3378.[Abstract/Free Full Text]
40
40. Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi, and N. Tanaka. 1998. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7. FEBS Lett. 441:106-110.[CrossRef][Medline]
41
41. Sullivan, C. S., and D. Ganem. 2005. A virus-encoded inhibitor that blocks RNA interference in mammalian cells. J. Virol. 79:7371-7379.[Abstract/Free Full Text]
42
42. van den Broek, M. F., U. Muller, S. Huang, M. Aguet, and R. M. Zinkernagel. 1995. Antiviral defense in mice lacking both alpha/beta and gamma interferon receptors. J. Virol. 69:4792-4796.[Abstract]
43
43. van den Broek, M. F., U. Muller, S. Huang, R. M. Zinkernagel, and M. Aguet. 1995. Immune defence in mice lacking type I and/or type II interferon receptors. Immunol. Rev. 148:5-18.[CrossRef][Medline]
44
44. Weber, F., and O. Haller. 2007. Viral suppression of the interferon system. Biochimie 89:836-842.[CrossRef][Medline]
45
45. Weber, F., G. Kochs, and O. Haller. 2004. Inverse interference: how viruses fight the interferon system. Viral Immunol. 17:498-515.[CrossRef][Medline]
46
46. Yan, H., K. Krishnan, A. C. Greenlund, S. Gupta, J. T. Lim, R. D. Schreiber, C. W. Schindler, and J. J. Krolewski. 1996. Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15:1064-1074.[Medline]
47
47. Yeh, T. C., E. Dondi, G. Uze, and S. Pellegrini. 2000. A dual role for the kinase-like domain of the tyrosine kinase Tyk2 in interferon-alpha signaling. Proc. Natl. Acad. Sci. USA 97:8991-8996.[Abstract/Free Full Text]
48
48. You, M., D. H. Yu, and G. S. Feng. 1999. Shp-2 tyrosine phosphatase functions as a negative regulator of the interferon-stimulated Jak/STAT pathway. Mol. Cell. Biol. 19:2416-2424.[Abstract/Free Full Text]
49
49. Zhu, F. X., S. M. King, E. J. Smith, D. E. Levy, and Y. Yuan. 2002. A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. USA 99:5573-5578.[Abstract/Free Full Text]

---

Journal of Virology, May 2009, p. 5056-5066, Vol. 83, No. 10
0022-538X/09/$08.00+0     doi:10.1128/JVI.02516-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Mansouri, M., Viswanathan, K., Douglas, J. L., Hines, J., Gustin, J., Moses, A. V., Fruh, K. (2009). Molecular Mechanism of BST2/Tetherin Downregulation by K5/MIR2 of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 83: 9672-9681 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bisson, S. A. Articles by Ganem, D. Search for Related Content PubMed PubMed Citation Articles by Bisson, S. A. Articles by Ganem, D.