This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johannsdottir, H. K.
Right arrow Articles by Helenius, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johannsdottir, H. K.
Right arrow Articles by Helenius, A.

 Previous Article  |  Next Article 

Journal of Virology, January 2009, p. 440-453, Vol. 83, No. 1
0022-538X/09/$08.00+0     doi:10.1128/JVI.01864-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Host Cell Factors and Functions Involved in Vesicular Stomatitis Virus Entry{triangledown}

Hrefna Kristin Johannsdottir,1 Roberta Mancini,1 Jurgen Kartenbeck,2 Lea Amato,1 and Ari Helenius1*

Institute of Biochemistry, ETH Zurich, Schafmattstrasse 18, CH-8093 Zurich, Switzerland,1 Division of Cell Biology, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany2

Received 4 September 2008/ Accepted 19 October 2008


arrow
ABSTRACT
 
Vesicular stomatitis virus (VSV) is an animal virus that based on electron microscopy and its dependence on acidic cellular compartments for infection is thought to enter its host cells in a clathrin-dependent manner. The exact cellular mechanism, however, is largely unknown. In this study, we characterized the entry kinetics of VSV and elucidated viral requirements for host cell factors during infection in HeLa cells. We found that endocytosis of VSV was a fast process with a half time of 2.5 to 3 min and that acid activation occurred within 1 to 2 min after internalization in early endosomes. The majority of viral particles were endocytosed in a clathrin-based, dynamin-2-dependent manner. Although associated with some of the surface-bound viruses, the classical adaptor protein complex AP-2 was not required for infection. Time-lapse microscopy revealed that the virus either entered preformed clathrin-coated pits or induced de novo formation of pits. Dynamin-2 was recruited to plasma membrane-confined virus particles. Thus, VSV can induce productive internalization by exploiting a specific combination of the clathrin-associated proteins and cellular functions.


arrow
INTRODUCTION
 
The majority of animal viruses depend on receptor-mediated endocytosis for productive entry into their host cells. Based mainly on electron microscopy (EM), it has been shown that many of these viruses make use of clathrin-mediated endocytosis (CME) followed by penetration into the cytosol from endocytic vacuoles. However, it is also becoming increasingly clear that viruses can use a variety of clathrin-independent endocytic pathways, sometimes in parallel with CME (13, 71, 82). Some of these pathways result in delivery to acidic endocytic vacuoles (reviewed in reference 45), while others transport the virus to the endoplasmic reticulum (30, 43). Rather than using constitutive endocytic mechanisms, some viruses are able to activate cellular signaling pathways and thus trigger their own internalization (13, 20, 63, 71).

In this study, we have focused on the entry of Vesicular stomatitis virus (VSV), a well-characterized, acid-activated, enveloped RNA virus that belongs to the family of Rhabdoviridae. It infects insects and mammals, but it is best known for causing epidemics in livestock (70). Due to its ease of handling, high titers, and broad cell tropism, the virus and its membrane glycoprotein G (VSVG), are often used as models to study endocytosis (14, 35, 36, 82) and secretory traffic (18, 27, 49). For the same reasons, VSVG is often used for pseudotyping of retroviral vectors for gene delivery (3, 28, 96). In addition, recombinant forms of the virus have been shown to be effective in animal models to target cancer cells and as vaccine vectors to stimulate immunity against diseases, such as AIDS and influenza (reviewed in reference 37).

The evidence that VSV is internalized by clathrin-coated pits (CCPs) and clathrin-coated vesicles (CCVs) is based on thin-section EM, on the Eps15 dependence of infection, and on a partial inhibition of infection after small interfering RNA (siRNA) silencing of the clathrin heavy chain (40, 41, 62, 88). The virus is delivered to endosomes in a Rab5-dependent manner (80). The pH threshold for the conformational change of the G-protein that triggers fusion of the viral envelope with endosomal membranes is pH 6.2 (5, 94). While it has been long assumed that the viral envelope fuses with the limiting membranes of endosomes, Le Blanc et al. have recently proposed that fusion takes place between the viral envelope and internal vesicles present in multivesicular bodies and late endosomes (35). Release of the nucleocapsid into the cytosol would, in this case, occur later through back-fusion of the internal vesicles with the limiting membrane of the multivesicular body, a reaction that involves cellular fusion proteins. A recent siRNA screen of the human kinome (the full complement of human protein kinase) in HeLa cells has shown that the productive entry process involves a large cohort of kinases from different families (62). Many of the kinases that inhibited VSV infection also inhibit the internalization of transferrin (Tfn), an endogenous CME substrate. The cell surface receptors for VSV have not been identified, but it is generally thought that binding via the G-protein is rather unspecific and involves negative charges on the plasma membrane (4, 6-8).

In the current study, we examined the entry of VSV into tissue culture cells using a variety of perturbation techniques, live-cell microscopy of single particles, and EM. Our results confirmed a central role for CME and showed that the virus could enter preformed CCPs, although the majority of the particles induced the formation of new clathrin coats. After dynamin-dependent endocytosis, internalization and penetration occurred within a few minutes.


arrow
MATERIALS AND METHODS
 
Cells and viruses. Human cervix carcinoma HeLa ATCC cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 1% glutamine (Gibco Life Technologies). Baby hamster kidney (BHK-21) cells were maintained in Glasgow medium supplemented with 10% FCS, 10% tryptose phosphate broth, and 1% glutamine (Gibco Life Technologies). African green monkey kidney epithelial cells (Vero) stably expressing clathrin light chain (CLC)-enhanced green fluorescent protein (EGFP) (provided by T. Heger, Institute of Biochemistry, ETH Zurich) were maintained in minimal essential medium (MEM) supplemented with 10% FCS, 1% glutamine, 1% nonessential amino acids, and 1 mg/ml G418 (Gibco Life Technologies) at 37°C and 5% CO2.

Wild-type VSV (wtVSV) (Indiana serotype) was provided by H. Hengartner (Institute of Experimental Immunology, University of Zurich). Stocks were prepared as previously described (62, 94). Recombinant VSV (rVSV) was provided by L. Pelkmans (Institute of Molecular Systems Biology, ETH Zurich) and was prepared as previously described (62, 77). Briefly, stocks were prepared by infecting slightly subconfluent BHK-21 cells for 24 h at a multiplicity of infection (MOI) of 0.1 in 10 ml of serum-free MEM supplemented with 10 mM HEPES (pH 6.5). Cells were incubated at 37°C and 5% CO2 for 1 h on a rocker before adding 20 ml of MEM containing 30 mM HEPES (pH 7.3), 10% tryptose phosphate broth, and 1% FCS for the rest of the incubation time. Supernatant was harvested when 90% of cells were rounded up. Cell debris was removed by centrifugation at 4,500 rpm for 15 min at 4°C. The stock was buffered with 10 mM HEPES at pH 7.4 and stored at –80°C.

Purification and fluorescent labeling of wtVSV. wtVSV Indiana was purified for covalent labeling with fluorophores. This was done by pelleting the virus at 25,000 rpm for 2.5 h at 4°C in a Beckman ultracentrifuge using a SW41 rotor. The pellet was eluted overnight on ice at 4°C in TN buffer (50 mM Tris [pH 7.4], 100 mM NaCl). Subsequently, the eluted pellet was purified on a sucrose step gradient (10 to 20% and 25 to 50% [wt/vol] sucrose gradient with an 0.5-ml 50% [wt/vol] sucrose cushion) at 30,000 rpm for 1 h at 4°C. The banded virus was repelleted at 25,000 rpm for 1 h and eluted in TN buffer as described above. The purified virus was dialyzed in 0.1 M NaHCO3 (pH 8.3) overnight at 4°C. The protein concentration was measured, and N-hydroxysuccinimide-activated fluorescent dye (Alexa Fluor 488 [AF488], Alexa Fluor 594 [AF594], or Alexa Fluor 647 [AF647]) was added in a 1:4 molar ratio while vortexing. The labeled virus was then rotated head-over-tail at room temperature for 2 h and subsequently banded on a sucrose step gradient as described above. Proper labeling was verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the infectivity was monitored with plaque assays. The label was exclusively associated with VSVG, the labeled virus remained monodisperse, and the infectivity was reduced about half, from 1 x 107 PFU/mg viral protein to 5 x 104 PFU/mg. Labeled virus was aliquoted and stored at –80°C.

Radioactive labeling of wtVSV. [35S]methionine-labeled VSV was prepared as previously described (41). Briefly, BHK-21 cells were infected with wtVSV at an MOI of 20 in 10 ml Earle's MEM (pH 6.3) without bicarbonate [supplemented with 10 mM Tris, 10 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 10 mM morpholinepropanesulfonic acid (MOPS), 10 mM NaH2PO4, 0.2% bovine serum albumin (BSA)] at 37°C on a rocker for 1 h. Inoculum was replaced with 5 ml DMEM (without methionine, cystine, and L-glutamine) containing 20 mM HEPES (pH 7.3) and incubated for 1.5 h at 37°C before adding [35S]methionine (1 mCi) to each 175-cm2 flask and incubating for an additional 7.5 h. Subsequently, the radioactively labeled virus was purified as described for wtVSV above. Proper labeling with [35S]methionine was verified by SDS-PAGE, the infectivity was monitored with plaque assays, and activity counting of the radioactively labeled virus was done using a multipurpose scintillation counter (LS 650; Beckman Coulter).

siRNA-mediated knockdown. For the depletion of the {alpha} subunit of adaptor protein 2 (AP-2), two previously published siRNAs were used, AP2-1 (GAGCAUGUGCACGCUGGCCAGCU) (26) and AP2-2 (AAGAGCAUGUGCACGCUGGCCA) (53). In addition, a so-called proven performance siRNA (Qiagen), AP2-3 (ACGTGTGACTTCGTCCAGTTA) directed against AP-2µ subunit, was used. Previously published oligonucleotides were synthesized by Dharmacon. AllStars negative-control siRNA (Qiagen) was used as control siRNA. Transfections for siRNA silencing were performed using HiPerFect transfection reagent (Qiagen) according to the manufacturer's fast forward protocol. Briefly, HeLa cells were seeded 1 h prior to transfection. AllStars negative-control siRNA (5 nM/100 nM), AP2-1 (5 nM), AP2-2 (100 nM), and AP2-3 (5 nM) were, together with (5 µl) HiPerFect transfection reagent, diluted in Opti-MEM (Gibco Life Technologies) and added to the cells. About 48 h posttransfection, cells were retransfected and incubated for an additional 40 h before being counted and seeded for experiment, which was started 8 to 10 h after plating. Knockdown was verified by Western blotting using mouse anti-adaptin-{alpha} (1:100), mouse anti-adaptin-µ (1:100), and {alpha}-actin (1:1,000) for normalization. All antibodies were purchased from BD Biosciences.

Infection and internalization analysis. For infection assays, rVSV at an MOI of 1 was added to HeLa cells. Virus stocks were diluted in RPMI medium (supplemented with 30 mM HEPES [pH 6.8] and 1% BSA) (Gibco Life Technologies). Before virus was added, the cells were washed once with RPMI medium. Infection was performed on a rocker at 37°C for 1 h before the inoculum was replaced by MEM supplemented with 10% FCS and 1% Glutamax for an additional 3 h. For analysis of Tfn uptake, samples were pulsed with 20 µg/ml labeled (AF594 or AF647) Tfn (Invitrogen) for 15 min and chased for 10 min. Subsequently, the samples were washed with phosphate-buffered saline (PBS) and stripped of any bound, uninternalized Tfn by acid wash (0.1 M glycine, 0.1 M NaCl [pH 3.0]). Samples were fixed with 4% formaldehyde in PBS for 20 min at room temperature. Infection was either quantified by a FACSCalibur flow cytometer using CellQuest 3.1 software (Becton Dickinson Immunocytometry Systems) or scored by eye by using a confocal microscope. Detection of infection with rVSV was based on GFP expression. For fluorescence-activated cell sorting (FACS) analysis, at least 10,000 cells were analyzed for each sample. At least two independent experiments, repeated three times for each sample, were performed. Samples subjected to microscopic analysis were permeabilized (1% [wt/vol] BSA, 0.05% [wt/vol] saponin in PBS) and stained with primary antibodies mouse anti-adaptin-{alpha} (AP-2-{alpha}) antibody (1:100) (BD Biosciences) or mouse anti-adaptin-µ (AP-2-µ) antibody (1:100) (BD Biosciences) followed by secondary antibodies (AF488-, AF647-, or AF594-labeled goat anti-mouse immunoglobulin G (Invitrogen) for 45 min at room temperature or at 4°C overnight. Samples were mounted using ImmuMount (Thermo Shandon). Microscopy was performed using a Zeiss 510Meta laser-scanning microscope (Carl Zeiss AG) with a 63x oil immersion objective with a numerical aperture of 1.4. Images were acquired using LSM 510 software package (Carl Zeiss MicroImaging, Inc.) and processed using Image J (National Institutes of Health) and Adobe Illustrator (Adobe Systems).

Endocytosis. Endocytosis was assayed as previously described (41). Briefly, ~50,000 cpm of [35S]methionine-labeled virus was diluted in RPMI medium and added to HeLa cells plated on 35-mm dishes at an MOI of less than 1 PFU/cell. Virus binding was performed at 4°C for 1 h before the temperature was shifted rapidly to 37°C for internalization. After different incubation times, the cells were again placed on ice and treated with 1 mg/ml proteinase K (Roche) at 4°C, a protease that cleaves VSVG and efficiently removes surface-bound, uninternalized virus (41). As a background control, the proteinase K treatment was performed without shifting the cells to 37°C. The protease-treated cells were pelleted, washed in PBS containing 0.2% BSA, 1 mM phenylmethylsulfonyl fluoride, and a protease inhibitor cocktail (Sigma), and resuspended in 0.3 ml medium and 2 ml Ready Safe scintillation cocktail (Beckman Coulter). Radioactivity was measured using a multipurpose scintillation counter (LS 650; Beckman Coulter), counting the radioactivity in each sample for 5 min per sample.

VSVG degradation. VSVG degradation was assayed by immunoblotting. VSV was diluted in RPMI medium supplemented with 1% BSA and 1 mM cycloheximide and buffered to pH 6.6 using HEPES, and VSV was allowed to bind to confluent HeLa cells at 4°C for 1 h. Unbound virus was removed by exchanging the medium, and the temperature was shifted to 37°C for internalization. At the time of analysis, samples were shifted again to 4°C and treated with 1 mg/ml proteinase K (Roche) as described above. After the cells were washed, the y were pelleted and resuspended in SDS-Laemmli sample buffer prior to SDS-PAGE and Western blotting. VSVG was detected using the rabbit polyclonal antibody 8685, raised against purified G-protein, in our lab.

EM. For thin-section electron microscopy, VSV diluted in RPMI medium (supplemented with 30 mM HEPES [pH 6.6] and 1% BSA) was either bound to BHK-21 cells plated on 12-mm coverslips on ice for 1 h and subsequently fixed or, alternatively, shifted to 37°C for 10 min before fixation. In the presence of 20 mM NH4Cl, cells were infected at 37°C for 1 h. Cells were fixed with 2.5% glutaraldehyde (supplemented with 0.05 M sodium cacodylate [pH 7.2], 50 mM KCl, 1.25 mM MgCl2, and 1.25 mM CaCl2) for 30 min at room temperature followed by 1.5 h in 2% OsO4. Dehydration, embedding, and thin sectioning were performed as previously described (30).

Live-cell microscopy analysis. HeLa cells for live-cell microscopy were transfected with CLC-mRFP or CLC-EGFP or dynamin-2-wt-EGFP using AMAXA according to the manufacturer's protocol 12 h prior to the start of the experiment. Cells transfected with AP-2{alpha}-wt-EGFP were allowed to express the construct for 24 to 48 h before the start of the experiment. The prolonged expression time is required for efficient incorporation of the GFP-labeled {alpha} subunit into the endogenous adaptor protein complex (16). Constructs used were CLC-EGFP (pEGFP-C1) (provided by J. H. Keen, Kimmel Cancer Center, PA) or monomeric red fluorescent protein (mRFP) (pmRFP-C3) (provided by A. Vonderheit, Institute of Biochemistry, ETH Zurich), dynamin-2-wt-EGFP (pEGFP-N1) (provided by M. McNiven, Mayo Clinic, Rochester, MN), and AP-2{alpha}-wt-EGFP (pEGFP-N1) (provided by L. Greene, NIH, Bethesda, MD). For coating of coverslips with extracellular matrix (ECM), cells of the same type as used for the subsequent experiment were seeded on 18-mm coverslips (Greiner) 2 days before imaging was performed and grown to confluence. On the day of imaging, the cells were removed from the coverslip using 20 mM EDTA to preserve the ECM produced by the cells. Coverslips were washed in cold PBS and mounted in custom-built stainless steel chambers (Workshop Biochemistry). Labeled virus, diluted in cold RPMI medium (supplemented with 30 mM HEPES [pH 6.6] and 1% BSA), was added to the coated coverslip and incubated for 30 min on ice for binding to the ECM. Transfected cells intended for the imaging were then detached using 20 mM EDTA, and after the cells were washed three time with PBS, they were suspended in 300 µl RPMI medium (supplemented with 30 mM HEPES [pH 6.6] and 1% BSA), added to the coverslip, and allowed to attach for 30 min on ice. Subsequently, the samples were subjected to live-cell imaging using a custom-modified Olympus IX71 inverted microscope with a heating chamber (37°C) and an objective-type total internal reflection fluorescence microscopy (TIRFM) setup (TILL Photonics). Image acquisition was done using a TILL Image QE charge-coupled-device camera and TILLVISION software (TILL Photonics). The total internal reflection angle was manually adjusted for every experiment. Images were processed by using Image J (National Institutes of Health) and Adobe Illustrator (Adobe Systems).

Pharmacological inhibitors. Cells were preincubated for 15 to 30 min with the drugs at 37°C in DMEM supplemented with 10% FCS and containing NH4Cl (20 mM) (Baker), dynasore (20, 80, or 120 µM) (ASINEX), brefeldin A (1 µM) (Sigma-Aldrich), nocodazole (1 µM) (Sigma-Aldrich), or wortmannin (0.1, 1, or 10 µM) (Sigma-Aldrich). Due to the high cell toxicity of chlorpromazine (Sigma-Aldrich), cells were preincubated with 17, 70, 140, or 280 µM of the drug for 10 min before the virus was added, and the drug-containing inoculum was left on the cells for 30 min before replacement with complete medium. Preincubation with progesterone (80 µM) (Sigma-Aldrich) and nystatin (11 µM) (Sigma-Aldrich) was performed overnight in the absence of serum, and the virus was not incubated with the drugs. Otherwise, drugs were present throughout the experiment, and the treatment did not result in loss of cell viability.


arrow
RESULTS
 
Kinetics of internalization and acid activation. To analyze the kinetics of VSV uptake in HeLa cells, we monitored the internalization of [35S]methionine-labeled virus. To synchronize entry, the labeled virus was first allowed to bind to confluent cell monolayers at 4°C for 1 h at an MOI of <1. After the cells were washed to remove unbound virus, 2 to 10% of the added virus remained cell associated. The temperature was rapidly raised to 37°C, and dishes were placed on ice after different periods of time for up to 45 min. Cell-associated radioactivity was measured after treatment with proteinase K at 4°C to remove remaining surface-bound VSV (41). Control samples with virus bound to the surface without shifting the cells to 37°C showed that the proteinase K treatment removed 92% ± 7% of surface-bound virus.

In samples incubated at 37°C, up to 30% of cell-associated radioactivity became resistant to proteinase K treatment. As shown in Fig. 1A, internalization of VSV was surprisingly rapid; the full cohort of viruses that was internalized was already proteinase K resistant 5 min after warming, and half of it was resistant within 2.5 to 3 min. The internalization of VSV thus occurred rapidly and synchronously. Why only one-third of the virus was internalized is not clear, but the inefficient internalization was consistent with previous observations in MDCK and BHK-21 cells (41, 50).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 1. Entry kinetics of VSV in HeLa cells. (A) Internalization of prebound VSV. [35S]methionine-labeled VSV was bound to cells at 4°C. Unbound virus was removed, and the cells were shifted to a 37°C water bath for the indicated times. In these experiments, about 3,500 cpm was found to be cell associated and over 20% of the cell-associated virus became proteinase K resistant upon warming. After removal of remaining surface-associated viruses by proteinase K treatment, internalized virus was quantified using a scintillation counter. Error bars indicate the standard deviations for the means from three experiments. (B) Kinetics of acid activation of VSV and degradation of VSVG. VSV was bound to cells at 4°C. Unbound virus was removed, and samples were shifted to a 37°C water bath in the absence (NH4Cl add-in [diamonds]) or presence (NH4Cl wash out [circles]) of NH4Cl for the indicated times. Subsequently, NH4Cl was either added to the samples (NH4Cl add-in [diamonds]) or removed for 2 min and then readded (NH4Cl wash out [circles]) at the indicated time points. Infection was scored by FACS 4 h after warming and represented as a percentage of infected cells in the absence of NH4Cl. Error bars indicate standard deviations from three experiments. (C) VSVG degradation. VSV was bound to cells at 4°C. Unbound virus was removed, and samples were shifted to 37°C water bath in the presence of 1 mM cycloheximide for indicated times. Subsequently, the amount of internalized, undegraded VSVG was quantified by Western blot analysis (triangles in panel B). Error bars indicate standard errors of the means from three experiments.

To determine the time course of the acid-induced activation of membrane fusion following internalization, we developed a FACS-based infection assay using a recombinant virus, rVSV. rVSV is identical to wild-type virus in regard to infection but was modified so that it expresses GFP in the infected cell (29, 32, 62, 77). To define the time of acid exposure, we took advantage of the fact that lipophilic weak bases, such as ammonium chloride (NH4Cl), inhibit endosomal acidification and thus prevent the pH-induced activation of the VSVG (41). The elevation of endosomal pH is almost instantaneous upon addition of the base to the extracellular medium (54). The virus is internalized normally in the presence of 20 mM NH4Cl, but if the medium pH is carefully buffered to 7.2 or higher, penetration and infection are efficiently blocked (31) (Table 1). As before, virus was bound to cells at 4°C for 1 h. Unbound virus was removed, and samples were rapidly shifted to 37°C. NH4Cl was added at different times, and the infection index was determined 4 h later using FACS analysis after fixation. The percentage of cells infected in uninhibited controls ranged between 20 and 70 depending on the experiment. It is important to note that by using an MOI of less than 1, we could score the average time of acid conversion; if more than one virus was added, the kinetics of the fastest viruses were scored.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Pharmacological inhibitors used and their effects on VSV infection

The results showed that all viruses passed the acid-requiring step within 8 to 10 min after warming with few additional viruses being activated at later time points (Fig. 1B, NH4Cl add-in). Half of the viruses had passed the acid-requiring step at 2 to 3 min after warming or almost immediately after internalization. Given the rapidity of the process, the critical acid-induced event most likely occurred in early endosomes (24, 46, 73, 76).

To determine whether later organelles in the endocytic pathway also could support productive penetration, we allowed the virus to enter for different periods in the presence of NH4Cl. The NH4Cl-containing medium was then exchanged with inhibitor-free medium for 2 min, followed by readdition of NH4Cl. Infection was assayed 4 h postwarming. This protocol took advantage of the almost instantaneous drop in endosomal pH after NH4Cl wash out and the rapid pH increase after readdition (54).

The results confirmed that viruses reached a compartment capable of supporting productive entry as early as 2 min after warming (Fig. 1B, NH4Cl wash out). Peak values of infection were observed 6 to 10 min after warming and infectivity dropped to half within 30 min. At 90 min after warming, infection was no longer detected. This confirmed that the acid-activated step in VSV penetration occurred at highest efficiency in early endocytic compartments and demonstrated that movement into late endosomes or lysosomes reduced and eventually prevented productive penetration.

A role for early endosomes in VSV entry was consistent with the sensitivity of infection to various drugs and perturbations. For example, nocodazole, a microtubule-depolymerizing drug that inhibits trafficking from early to late endosomes (1, 42), caused only a small reduction (15%) in VSV infectivity (Table 1). In addition, a dominant-negative form of the early endosomal small GTPase Rab5 and its siRNA-mediated knockdown inhibited VSV infection, whereas equivalent perturbations of the late endosomal Rab7 function did not have a comparable effect (80) (H. Johannsdottir, T. Heger, and A. Helenius, unpublished data). The irreversible phosphatidylinositol-3-phosphate kinase inhibitor wortmannin caused a moderate, dose-dependent reduction of infection (Table 1). This kinase is essential for the generation of phosphatidylinositol-3-phosphate, a phospholipid with important regulatory functions in early endosomes (68, 84, 86, 87). The importance of early endosomal compartments for VSV infection could also explain the effect of brefeldin A (Table 1), which caused up to 40% drop in viral infection. Brefeldin A, a fungal metabolite, inhibits nucleotide exchange of several ADP-ribosylation factors and blocks the functions of coatomer (COPI) at early endosomes as well as in the secretory pathway (55-58, 64). Impaired COPI function also leads to inhibition of Semliki Forest virus (SFV) infection as well as impaired Tfn recycling and lysosomal targeting of epidermal growth factor (EGF) receptor (14, 95).

Next, we determined the time course of virus arrival in degradative compartments by measuring the degradation of G-protein. Purified wild-type VSV was bound to cells for 1 h at 4°C. After the cells were washed and shifted to 37°C for different times, viruses that had failed to enter cells were removed by proteinase K treatment in the cold. Cell lysates were analyzed by SDS-PAGE and immunoblotting using antibodies against the G-protein. As shown in Fig. 1B (triangles) and quantified in Fig. 1C, about one-third of cell-associated VSVG was internalized, and its degradation started between 30 and 60 min after warming and was complete by 120 min.

Taken together, the kinetic data and the results of perturbation analysis were consistent with a model in which the incoming VSV passes rapidly from the cell surface to early endosomes where the low pH induces a conformational change in VSVG and a membrane fusion reaction. The viral G-protein continues to late endosomes and lysosomes where it is degraded. Late endosomes and lysosomes do not support productive penetration of viruses. Only a third of cell-associated viruses enter, but the process of entry is remarkably rapid.

VSV in CCPs and endosomes. We also analyzed VSV entry into HeLa and BHK-21 cells using EM. The BHK-21 cells were preferred in these studies because virus binding to HeLa cells was inefficient; only a small number of cell-associated particles were seen. BHK-21 cells not only bound more viruses but were about 100 times more sensitive to VSV infection with respect to the number of particles needed. The kinetics of VSV entry were, however, similar in both cell types.

After viral particles were allowed to bind to cells at 4°C for 1 h and the samples were fixed and embedded, surface-bound VSV particles were often seen associated with microvilli (Fig. 2F and G) or located at the base of microvilli (Fig. 2A and E). Many were localized in surface invaginations. Of these, approximately 60% were in coated pits (Fig. 2A, B, C, and D), with the rest in indentations of similar size and shape but devoid of a visible electron-dense coat (Fig. 2E, F, and G). The orientation of virus particles in respect to the plasma membrane varied; some were parallel to the membrane, while others were perpendicular to it. Depending on degree of pit invagination and the number and orientation of associated VSV particles, the size of the CCPs ranged from 200 to 500 nm. If the CCPs seen were to pinch off as CCVs, one can estimate that their diameter would correspond to 100 to 250 nm. This exceeds the diameter of an average CCV, which is around 100 nm (15, 25).


Figure 2
View larger version (75K):
[in this window]
[in a new window]

 
FIG. 2. Electron microscopy of VSV associated with the plasma membranes of BHK-21 cells. Virus was bound to cells at 4°C for 1 h. The cells were fixed and analyzed in thin sections. Some of the membrane-bound viruses were associated with electron-dense, cytoplasmic coats (A, B, C, D, and H), others were in uncoated indentations (E, F, and G). Many were close to or associated with microvilli (A, E, F, and G). Upon warming, viruses started to be internalized (H). In some cases, multiple viral particles were seen within a single coated pit (open arrowheads in panels C and H) or coated vesicle (closed arrowhead in panel H). Bars, 100 nm.

The visualization of internalized virus particles was more problematic due to the rapid penetration that made the viruses invisible in thin sections. To maximize the number of internalized viruses that had not penetrated, we allowed viruses at an MOI of 5,000 to bind at 4°C for 1 h. The temperature was then raised slowly by placing the cells for 10 min in a 37°C incubator without removing unbound virus. When this protocol was used, intracellular viruses were visible in coated vesicles (Fig. 3B, open arrowhead), in partially coated vesicles (Fig. 3C), and in small membrane-bounded structures with irregular shapes, devoid of a visible coat or internal vesicles (Fig. 3A and B, closed arrowhead). The latter had diameters of 200 to 280 nm, which suggests that they were either newly formed endocytic vesicles or early endosomes. We did not see viruses in the process of fusing with the limiting membranes of endocytic vacuoles. Since no internal vesicles were present in these early compartments, fusion with them could be excluded. Only when NH4Cl was added to prevent acidification could we observe accumulation of VSV in classical endosomal vacuoles with diameters of 450 to 600 nm. These often contained several viruses as well as intravacuolar vesicles (Fig. 3D and E). The accumulation of multiple viral particles within endosomes during fusion block may be partly due to the high MOI used for these experiments and would not be so prominent using an MOI of 1 or lower.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 3. Electron microscopy of VSV in endocytic vesicles. Virus was bound to BHK-21 cells at 4°C for 1 h, and the cells were shifted to a 37°C incubator to allow internalization. Viruses were seen either in coated or partly coated endocytic vesicles (B [open arrowhead] and C) or in relatively small, tight fitting endosomal vesicles (A and B [closed arrowhead]), indicating their presence in early endosomal compartments. (D and E) Warming was performed in the presence of 20 mM NH4Cl to allow internalization but not acid-activated fusion. Accumulation of viruses was seen in larger endosomal structures, some containing internal vesicles. Bars, 100 nm.

The EM results were consistent with previous studies in MDCK, BHK-21, and L cells (11, 12, 41). They were also consistent with the effects of siRNA silencing of clathrin heavy chains (40, 62, 88), which have shown at least a partial role for clathrin-mediated endocytosis in VSV entry. We found that the CME inhibitor chlorpromazine greatly reduced VSVG expression in a dose-dependent manner (Table 1). In contrast, treatment with progesterone and nystatin, which inhibit synthesis and sequester cholesterol from the plasma membrane but have only minor effects on CME (2, 78, 81), reduced infection only about 30% (Table 1). We interpret these results as showing that VSV enters and infects HeLa cells primarily by CME, although the possibility of some viruses entering via parallel, non-clathrin-mediated pathways cannot be excluded.

Dynamin-2 is necessary for VSV infection, while AP-2 is dispensable. Dynamin-2 is a key factor in several endocytic pathways, including the CME and caveolar/lipid raft-mediated uptake pathways (10, 33, 45, 91). In contrast, it is dispensable for macropinocytosis of vaccinia virus (VV) (47), for the so-called the GPI-anchored protein-enriched endosomal compartment (GEEC pathway) (72), and for a non-clathrin/non-caveolar pathway recently described for the entry of lymphocytic choriomeningitis virus (LCMV) (66). Therefore, the effect of dynamin-2 inhibition serves as a rather reliable initial criterion for classifying endocytic pathways.

To test whether dynamin is involved in VSV infection, we applied dynasore, a specific inhibitor of the GTPase activity of dynamin that blocks, e.g., endocytosis of Tfn (38). As a positive control, we used VV, which we have shown to exploit a dynamin-2-independent macropinocytic pathway (47). We preincubated HeLa cells with dynasore for 15 min and subsequently added rVSV or VV to the cells for 4 h before fixation and scoring of infection by FACS. No cell toxicity was observed. The inhibitor caused almost a 10-fold, dose-dependent drop in VSV infectivity, indicating that the majority of the viral particles depend on dynamin-2 for infectious entry (Fig. 4 and Table 1). As expected, VV infection was not affected (Fig. 4). We conclude that VSV infection of HeLa cells is dynamin-2 dependent.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 4. VSV infection is dynamin-2 dependent. HeLa cells were infected with VSV and vaccinia virus (VV) in the presence of the indicated concentrations of dynasore. Infection was detected by FACS and normalized to infection of untreated cells. Error bars indicate standard deviations of three experiments.

Clathrin-based endocytic pathways involve a variety of adaptor proteins. AP-2, originally thought to be essential for all types of clathrin-mediated endocytosis, is important for the internalization of Tfn but not for the endocytosis of EGF receptor or low-density lipoprotein (LDL) receptor (9, 53). We analyzed the possible involvement of AP-2 in VSV infection by siRNA-mediated knockdown of AP-2 in HeLa cells using previously published oligonucleotides (here called AP2-1 and AP2-2) against the {alpha} subunit of the multimeric adaptor protein complex (26, 53) and a so-called proven performance oligonucleotide against the µ subunit (here called AP2-3). To acquire maximal knockdown, a double-transfection protocol was deployed with a 48-h interval between the two transfections.

Western blot analysis using actin as a loading control and a monoclonal antibody against the {alpha} subunit showed that expression was reduced to 11% with AP2-1, to 8% with AP2-2, and to 30% with AP2-3 (Fig. 5A (top panel) compared to levels of the AP-2{alpha} subunit in samples transfected with AllStars negative-control siRNA. Western blot analysis of AP-2µ levels showed that in cells treated with AP2-1 siRNA directed against the {alpha} subunit, the level of µ subunit expression was 84% of that detected in control cells, while for the other two oligonucleotides, AP2-2 (against {alpha} subunit) and AP2-3 (against µ subunit), the AP-2µ level was only 10% of what was seen for the control cells (Fig. 5A, bottom panel). This result was in accordance with previously published observations that knockdown of one subunit of AP-2 results in downregulation of other subunits of the complex (53).


Figure 5
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 5. VSV infection is not dependent on AP-2. HeLa cells were transfected with siRNAs against AP-2{alpha} (AP2-1 and AP2-2) or AP-2µ (AP2-3). (A) Quantification of AP-2{alpha} (top panel) and AP-2µ (bottom panel) protein levels in siRNA-treated cells by Western blotting. Results are presented as percentages of AP-2 levels in cells treated with AP2-1, -2, or -3 siRNAs normalized to AP-2 levels in control cells treated with AllStars negative-control siRNA and the level of actin, which was used as a loading control. (B) Cells treated with AP2-1 to AP2-3 were infected with rVSV, the infection was scored by FACS, and the resulting values were normalized to the infection levels of cells treated with AllStars negative-control siRNA. Error bars represent standard deviations from three experiments. (C) Cells treated with AP2-1, -2, and -3 siRNAs or AllStars negative-control siRNA were infected with rVSV for 4 h. AF594-labeled Tfn was added to the samples for 15 min, 25 min prior to fixation. AP-2{alpha} and AP-2µ levels were detected using a mouse anti-AP-2{alpha} and AP-2µ antibody, respectively, and an AF647-labeled secondary antibody. Infection was detected by GFP expression upon rVSV replication. Bars, 10 µm.

The cells were then infected with rVSV at an MOI of 0.5 for 4 h. For the fluorescence analysis, AF594-labeled Tfn was added to the cells for 15 min. Subsequently, the samples were incubated for an additional 10 min without Tfn in the medium before the noninternalized Tfn was removed by an acid wash. When infection was assayed by FACS analysis, cells with AP-2{alpha} or AP-2µ knockdown showed a slight increase in VSV infection for all three siRNAs (Fig. 5B). Fluorescence microscopy showed that cells that were incapable of internalizing Tfn were infected with VSV (Fig. 5C, open arrowheads). Therefore, AP-2 was clearly not essential for VSV infection.

Dynamics of VSV interaction with clathrin. To monitor the interaction of cell surface-associated VSV with clathrin using live video microscopy, we labeled purified wild-type VSV with fluorescent dyes (AF488, AF594, or AF647). The cells used were either HeLa cells transiently transfected with mRFP- or EGFP-tagged clathrin light chain alpha (CLC-mRFP or CLC-EGFP), or Vero cells stably expressing CLC-EGFP. In initial experiments, we suspended the labeled virus in medium optimized for binding and internalization and added virus to cells on a coverslip in a live-cell imaging ring. Time-lapse videos were recorded at 37°C using TIRFM to visualize only those viral particles that interacted with the plasma membrane facing the coverslip.

When the fluorescent virus was added, only a few of the particles were seen to enter the space between the cell and coverslip. The video recordings showed that some of the particles bound to the cell and moved along the plasma membrane laterally until trapped in fixed, preexisting clusters of clathrin-mRFP (Fig. 6A, B, and C). We also observed cases in which clathrin gradually accumulated underneath immobile surface-bound viruses (see below).


Figure 6
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 6. VSV can be targeted into preformed CCPs. AF488-labeled VSV was added to HeLa cells expressing CLC-mRFP, and live-cell imaging was performed by TIRFM. (A) Time series, (B) kymographs, and (C) intensity graphs show how the labeled VSV appears in the TIRF field from the surrounding medium and colocalizes with a stable CCP.

However, the low number of viruses entering the space under the cells limited the usefulness of this approach. Most likely, the problem was due to the relatively large size of VSV particles and the close proximity of the plasma membrane to the coverslip. To circumvent the problem, we coated coverslips with ECM by growing cells to confluence and then removing them using EDTA. Fluorescent viruses were then bound to the ECM-coated coverslips. When cells expressing fluorescently labeled CLC (CLC-mRFP or CLC-EGFP) were added, they rapidly spread out on the coverslip due to the ECM coat and covered the virus particles. This allowed us to use TIRFM to efficiently record the interaction between the virus and CLC-XFP at the plasma membrane facing the coverslip. A large number of viruses and their interaction with clathrin could be analyzed. However, the disadvantage was that the majority of the virus particles were immobilized and unable to undergo endocytosis.

To quantify colocalization of virus particles and clathrin, the Image J program was used. Out of 88 virus particles localized underneath spreading cells, 54 (61%) were associated with CLC-XFP at some time point during 200- or 400-s recordings. Of these viruses, 15 (28%) were already associated with CLC-XFP when the recording started, 25 (46%) induced accumulation of clathrin, and 17 (31%) were associated with clathrin but lost their colocalization either because they moved out of the clathrin-containing region or the clathrin coat dissociated. In some cases, clathrin appeared under the virus and disappeared in cycles of coat assembly and disassembly. Although the majority of observed VSV particles remained fixed in place, a minority (six in total) became mobile and disappeared from the TIRF field together with the CLC-XFP, suggesting that they were internalized in clathrin-coated vesicles. Whether the viruses that failed to colocalize with clathrin were associated with alternative structures could not be determined; some of them may simply have failed to contact the plasma membrane.

In Fig. 7, examples of these phenomena in the form of selected digital images (A), kymographs (B), and intensity graphs in time series (C) are shown. In Fig. 7A, an AF647-labeled virus (pseudocolored red) is stationary at an initial location and accumulates CLC-EGFP on the cytoplasmic leaflet of the plasma membrane (location 1, both virus and clathrin are indicated by a white arrowhead). The virus then moves away from the CCP but within the plane of the plasma membrane, is confined again, and induces a second wave of CLC-EGFP assembly (location 2, both virus and clathrin are indicated by a black arrowhead). The same events are shown by kymographs in Fig. 7B. White arrowheads indicate the appearance and disappearance of both virus and clathrin at location 1, and black arrowheads indicate the appearance and disappearance of virus and clathrin at location 2 (Fig. 7A and B). Between confinement at locations 1 and 2, the virus is moving in the plane of the plasma membrane without any visible clathrin association (indicated by a horizontal bar in the VSV-AF647 kymograph). When mobile, the virus was always devoid of clathrin association.


Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 7. VSV can induce the formation of CCPs. AF647-labeled VSV (pseudocolored red) and HeLa cells expressing CLC-EGFP were subjected to live-cell imaging by TIRFM. (A) Time series show a confined viral particle (white arrowhead in VSV-AF647) and the recruitment of clathrin underneath it (white arrowhead in CLC-EGFP with VSV [w/VSV] at 52 seconds). The virus then detaches and relocates (black arrowhead in VSV-AF647 at 131 s), and shortly thereafter, the pit collapses (CLC-EGFP w/VSV at 152 to163 seconds). Upon reconfinement of the virus (black arrowhead in VSV-AF647 at 131 s), a new clathrin-coated pit appears under the viral particle (black arrowhead in CLC-EGFP w/VSV at 391 s). The bottom row shows time series of CCP without virus (w/o VSV) association (gray arrowhead in CLC-EGFP w/o VSV at 95 s). (B) Kymographs of the same events as in panel A. White arrowheads indicate appearance and disappearance of virus and CLC signal at the initial location of confinement, and black arrowheads indicate the parallel events at the second location. The bar between the white arrowhead (indicating disappearance of the virus from the first location) and the black arrowhead (indicating its appearance at the second one) depicts the time frame of viral movement within the plane of the plasma membrane. (C) Intensity graphs show the change in intensity over time for the virus particle (red squares), virus-associated clathrin (green diamonds), and the virus-independent CCP (gray triangles).

The mean recruitment time of CLC at a forming CCP, from its initial appearance until the fluorescence intensity had reached a stable plateau, was 112 s ± 45 s in the presence of a virus particle. In contrast, without any associated virus, the mean rate of CCP formation (Fig. 7A, gray arrowhead) was only 53 s ± 17 s (example in Fig. 7A and B [bottom panels] and intensity graph in Fig. 7C [grey triangles]), a rate consistent with previously published data for dynamic CCPs (17) as well as for recruitment of clathrin to small cargo, such as LDL and Tfn (15). The longer recruitment time may relate to a larger size of the CCP and a higher number of clathrin triskelions required as previously suggested for other large cargo (15). Alternatively, the prolonged association with clathrin could reflect the fact that the virus is immobilized and the CCP cannot pinch off.

Dynamics of VSV association with dynamin-2 and AP-2. When HeLa cells expressing dynamin-2-EGFP were plated on top of immobilized, AF594-labeled virus, the majority (80%) of viral particles (n = 59) associated with dynamin-2, and of those, 36% were seen to recruit the GTPase during the recordings. Again, viruses were sometimes seen to induce more than one cycle of association (Fig. 8A, B, and C). The time series in Fig. 8A shows a confined AF594-labeled VSV (VSV-AF594) particle (white arrowhead) recruiting dynamin-2 to the plasma membrane (black arrowhead at 68 seconds). Dynamin-2 dissociates from the plasma membrane (black arrowhead at 114 s) but is recruited a second time (black arrowheads at 162 to 199 s). The average recruitment time of the GTPase was 55 s ± 17 s (n = 15), hence shorter than the recruitment time of CLC. This was expected considering the temporary role of dynamin-2 (at a rather late step) in vesicle formation. The average recruitment time of randomly selected dynamin-2 spots at the plasma membrane not associated with VSV was 25 s ± 9 s (n = 10), i.e., about half as long as in the presence of the virus (Fig. 8A, gray arrowhead; 8B, bottom panels; and 8C, intensity graph). Again, the difference could be due to the immobilized state of the viral particles on the coverslip or simply due to the large size of vesicles forming around the virus. Unfortunately, we were limited to two fluorophores, which prevented us from monitoring VSV, clathrin, and dynamin-2 at the same time.


Figure 8
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 8. Dynamin is recruited to plasma membrane-bound VSV. AF594-labeled VSV and dynamin-2-EGFP-expressing HeLa cells were subjected to live-cell imaging by TIRFM. (A) Time series show a confined viral particle (white arrowhead in VSV-AF594) and the recruitment of dynamin underneath it (black arrowhead in dynamin-2-EGFP with VSV [w/VSV] at 68 seconds). Over time, dynamin signal becomes weaker (dynamin-2-EGFP w/VSV at 114 s) but then gains again in strength (black arrowhead in dynamin-2-EGFP w/VSV at 162 s). The bottom row shows time series of plasma membrane recruitment of dynamin independent of VSV (gray arrowhead in dynamin-2-EGFP without VSV [w/o VSV] at 114 s). (B) Kymographs of the same events as described above for panel A. (C) Intensity graphs show the change in intensity over time for the virus particle (red squares), its associated dynamin (green diamonds) and the virus-independent plasma membrane recruitment of dynamin (gray triangles).

We also visualized the association of AP-2{alpha}-EGFP with VSV using TIRFM. Although AP-2 has no functional role in infection (see above), we could see it associate with 38% of cell-associated, immobilized viruses (n = 344). Most of these viruses were associated with the adaptor protein complex already from the start of the recordings with only 12% of them recruiting AP-2. In these cases, recruitment occurred within 136 s ± 66 s, which was longer than for VSV-induced recruitment of both CLC and dynamin-2. In many cases, AP-2 recruitment (Fig. 9A, open arrowheads) to a confined virus particle (Fig. 9A, closed arrowheads) was characterized by a gradual increase in intensity over a long period of time (Fig. 9A, B, and C). Since AP-2 is not needed for infection, the observed association with the VSV may reflect trapping of AP-2 in nonproductive clathrin-coated structures. Given the rapid internalization of VSV (Fig. 1A and B), the association with AP-2 was too slow to be involved in endocytosis.


Figure 9
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 9. AP-2 colocalizes with VSV at the plasma membrane but is probably not recruited by the virus. AF594-labeled VSV and AP-2{alpha}-EGFP-expressing HeLa cells were subjected to live-cell imaging by TIRFM. (A) Time series of plasma membrane-bound virus (white arrowheads in VSV-AF594) and its colocalization with AP-2{alpha} (black arrowheads in AP-2{alpha}-EGFP with VSV [w/VSV] from 63 seconds). The lowest row shows the recruitment of AP-2{alpha} to the plasma membrane independent of VSV (gray arrowhead in AP-2{alpha}-EGFP without VSV [w/o VSV] at 63 s). (B) Kymographs of the same events as shown in the time series. (C) Intensity graphs show the change in intensity over time for the virus particle (red squares), the colocalizing AP2{alpha} (green diamonds), and the virus-independent AP-2{alpha} (gray triangles) at the plasma membrane.


arrow
DISCUSSION
 
In this study, we have reinvestigated the initial interactions of VSV with host cells (mainly HeLa cells) and characterized entry in regard to kinetics and cellular factors required. We found that VSV was endocytosed rapidly but relatively inefficiently and that the acid-induced activation occurred almost immediately after internalization. The majority of viral particles relied on CME for endocytosis and infection. The process was dependent of dynamin-2, which was recruited to the CCPs. Although the classical adaptor protein complex AP-2 associated with some of the membrane-bound VSV particles, it was functionally dispensable. The virus had two ways of associating with CCPs; it could move laterally along the membrane and become trapped in preformed clathrin-coated membrane domains, or it could remain immobile and induce the association of clathrin at its location of confinement. That clathrin recruitment phase lasted longer than previously reported for small cargo, such as Tfn or LDL, was probably due to the larger size of the coated pit required to engulf the particle. Dynamin-2 and in some cases AP-2 were also recruited to immobile virus particles. Although the majority of the virus entered via CCPs, we could not exclude the possibility that virus particles could use alternative pathways with low efficiency.

VSV binding to the cell surface was quite inefficient and sensitive to external factors, such as pH and cell type (41, 50). Internalization was also relatively inefficient, with only one-third of surface-bound virus particles entering the cell. However, the endocytic event occurred rapidly, with the majority of the entering viral particles internalized within 6 to 7 min, and with a half time of 2.5 to 3 min. Hence, VSV internalization was a faster process than that observed for other viruses, such as SFV, influenza A virus, and LCMV entry (23, 39, 66). The kinetics resembled that of Tfn uptake, which has a half time of 2.5 min (65, 92).

The acid activation occurred immediately after internalization, with the first viral particles already passing the NH4Cl-sensitive step 2 min after warming. That the viruses actually fused with the limiting membranes of endocytic vacuoles was supported by EM observations; recognizable virus particles were rarely found in endosomal compartments unless the pH was elevated using NH4Cl. Fusion and penetration had most likely already taken place, and the bullet-shaped capsids disassembled. When particles were seen, they were mainly in coated, partially coated, or small, relatively tight fitting, smooth vesicles without internal membranes. Only upon internalization in the presence of NH4Cl were we able to see accumulation in endocytic compartments due to impaired viral fusion and penetration into the cytosol.

The most efficient time point for acid activation was around 3 min after warming, which was sooner than previously seen, e.g., for SFV and LCMV (22, 66, 93), but consistent with VSV fusion in human embryonic kidney (HEK) 293FT cells (74) as well as with VSV-induced fusion of liposomes in vitro (5). If the time window between internalization and acid activation was artificially extended beyond 10 min by adding NH4Cl during entry, the fraction of viruses able to infect cells was reduced, and if acid activation was delayed for more than 1 h, the internalized virus lost almost all its infectivity. This indicated that until about 10 min postinternalization, the majority of internalized viruses were still fusion competent and present in fusion-supportive compartments. Subsequently, most of the viruses moved into endocytic compartments, where acid-activated fusion and penetration into the cytosol were no longer possible. Eventually, these viral particles most likely ended up in lysosomes where VSVG was degraded, starting 30 to 60 min postinfection.

Le Blanc et al. have proposed that the acid-activated fusion of VSV and its penetration into the cytosol occur in two steps (35); the viral envelope first fuses with an internal vesicle within multivesicular endosomes at a pH above 5.5. Once the multivesicular endosome has matured into a late endosome, the viral nucleocapsid is released into the cytosol by back-fusion of the internal vesicle with the limiting membrane through the action of cellular fusion machinery. Our results indicated that the acid-induced step occurred as early as 2 to 3 min after internalization in early endosomes. Fusion with internal vesicles is unlikely, as the vesicles arise in later stages of endocytosis. That fusion occurred early was consistent with the pH dependence of G-protein activation, which occurs already at pH 6.2 (5, 94). Fusion in early endosomes is also in line with the Rab5 dependence and Rab7 independence of VSV infection (80), which we have confirmed (data not shown).

By monitoring the interaction of the virus with the endocytic machinery by TIRFM, we observed two different mechanisms used by the virus to interact with clathrin coats. The first was illustrated by virus particles that came into the TIRF field from the surrounding medium, bound to the plasma membrane, and moved laterally until being confined within a preexisting clathrin-coated membrane domain. In other cases, a clathrin coat emerged underneath immobile virus particles. Both mechanisms have been observed for other cargo as well (15, 71, 75, 79). For some ligands, the targeting is restricted to one of the two mechanisms, while in other cases, both can be observed. Ehrlich et al. reported that small cargo with high surface mobility, such as Tfn and LDL, were mainly sorted to preformed pits on the plasma membrane (15). Similar results were shown for activated G-protein-coupled receptors (75, 79), where agonist activation resulted in the accumulation of arrestin-3 in preformed pits.

Cargo-induced formation of clathrin-coated pits has been reported only for larger cargo, such as viruses. Ehrlich et al. reported that after a lag phase of 280 to 1,500 seconds, clathrin appeared underneath surface-bound reovirus particles (15). The authors postulated that clathrin recruitment was not cargo induced but caused by coat stabilization by the virus after random clathrin assembly. This was based on calculations showing that the likelihood of a CCP formation underneath the virus was the same as in a random spot on the plasma membrane. In another study, influenza virus was shown to be able to exploit both mechanisms, although de novo formation was by far the more frequently seen event (71). The authors proposed that clathrin recruitment was induced by virus because pit formation at the sites of virus confinement was more frequent than in surrounding areas on the plasma membrane. The results of our study indicate that VSV can use both preexisting coated pits and induce or stabilize new ones. Whether clathrin recruitment to VSV is a result of virus-induced signaling or a consequence of a stabilized randomly formed pit remains to be determined.

At any time, approximately 40% of viral particles that were associated with the plasma membrane did not colocalize with clathrin. Only 20% failed to associate with dynamin-2, which was consistent with the efficient reduction of VSV infection in the presence of dynasore. On the other hand, over 60% of the viruses failed to colocalize with AP-2 during our recordings. In addition, the percentage of recruitment events was much higher for clathrin than for AP-2 (46% versus 12%, respectively), and the recruitment time to a viral particle was longer for AP-2 than for clathrin (136 s ± 66 s versus 112 s ± 45 s, respectively).

The time required for the formation of a clathrin-coated vesicle with an outer diameter of 90 to 100 nm is about 32 s (15). The formation of larger coated structures takes proportionally longer time. Clathrin recruitment has been shown to range from 25 to 50 s for small (5-nm) cargo, such as Tfn, and up to 400 s for larger cargo, such as reovirus (15). Since VSV is relatively large (~80 by180 nm), the prolonged time needed for vesicle formation around a virus particle was therefore expected. Ehrlich et al. reported that AP-2 was recruited even faster to cargo than clathrin was (15). That we did not see this may be explained by the observation that AP-2 was not required for VSV infection.

The adaptor protein complex AP-2 has been considered one of the core components of the clathrin-based endocytic machinery (reviewed in references 10, 69, and 90). It was therefore unexpected that cells depleted of AP-2 supported VSV infection as well as control cells did. However, considering recent results from studies describing clathrin-based but AP-2-independent entry pathways, it seems plausible that VSV exploits such a mechanism for host cell entry. In the last several years, an increasing number of so-called alternative adaptors has been identified that, like the canonical adaptor AP-2, can simultaneously bind to plasma membrane phospholipids, clathrin, and cargo receptors and based on that been classified as alternative adaptors (reviewed in references 52, 60, 61, 69, 85, 89, and 90). Some of them interact with cargo together with AP-2 (19, 21, 34), while others seem to be able to support endocytosis in the absence of AP-2 (51). Classical clathrin-dependent cargo, such as Tfn, LDL, and EGF, have been shown to differ in their AP-2 requirements for the classical adaptor protein complex (9, 26, 53). While Tfn internalization strictly depends on AP-2, LDL and EGF endocytosis both occur in the absence of the canonical adaptor. However, continued uptake of EGF could be based on a shift to its clathrin-independent pathway (59, 83). Therefore, any potential impact of AP-2 depletion on EGF could have been compensated, whereas LDL internalization is strictly dependent on CME and maintained by the alternative adaptor Dab2 in the absence of AP-2 (44).

Dynamin-2 recruitment to the virus was faster than recruitment of clathrin, and in the absence of virus, the recruitment time was even shorter (25 s). This confirmed previous reports for dynamin (15, 48). The relatively long recruitment time of VSV-associated dynamin-2 (55 s) may reflect the size of the vesicle that needs to be formed around the virus, as in the case of clathrin. This is in agreement with Rappoport and Simon, who suggested a linear relation between the amount of clathrin and its associated dynamin in CCPs (67). The longer residence time of dynamin could also be explained by the virus being immobilized and thus not endocytosable.

In summary, our results suggested that VSV particles were rapidly internalized and underwent acid-activated fusion soon after entry in early endosomes. Although some virus particles entered via preformed clathrin-coated pits, others triggered their internalization by inducing the formation of a clathrin-coated pit. It is apparent that VSV belongs to the viruses that can induce the formation of a clathrin coat, and that in doing so, it is not merely a passive passenger but exploits a specific combination of the clathrin-associated proteins and functions.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the Swiss National Research Foundation and ETH Zurich.

We thank T. Heger, Institute of Biochemistry, ETH Zurich, for critical reading of the manuscript and experimental support. Wild-type VSV was kindly provided by H. Hengartner, Institute of Experimental Immunology, University of Zurich. Recombinant VSV was kindly provided by L. Pelkmans, Institute of Molecular Systems Biology, ETH Zurich. Vaccinia virus was kindly provided by J. Mercer, Institute of Biochemistry, ETH Zurich. We thank J. H. Keen (Kimmel Cancer Center, Philadelphia, PA), A. Vonderheit (Institute of Biochemistry, ETH Zurich), M. McNiven (Mayo Clinic, Rochester, MN), and L. Greene (NIH, Bethesda, MD) for providing constructs. We also thank the Electron Microscopy Center of the ETH Zurich (EMEZ) for assistance with EM work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Biochemistry, ETH Zurich, Schafmattstrasse 18, CH-8093 Zurich, Switzerland. Phone: 41 44 632 68 17. Fax: 41 44 632 12 69. E-mail: ari.helenius{at}bc.biol.ethz.ch Back

{triangledown} Published ahead of print on 29 October 2008. Back


arrow
REFERENCES
 
    1
  1. Bayer, N., D. Schober, E. Prchla, R. F. Murphy, D. Blaas, and R. Fuchs. 1998. Effect of bafilomycin A1 and nocodazole on endocytic transport in HeLa cells: implications for viral uncoating and infection. J. Virol. 72:9645-9655.[Abstract/Free Full Text]
  2. 2
  3. Brindley, M. A., and W. Maury. 2008. Equine infectious anemia virus entry occurs through clathrin-mediated endocytosis. J. Virol. 82:1628-1637.[Abstract/Free Full Text]
  4. 3
  5. Burns, J. C., T. Friedmann, W. Driever, M. Burrascano, and J. K. Yee. 1993. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. USA 90:8033-8037.[Abstract/Free Full Text]
  6. 4
  7. Carneiro, F. A., M. L. Bianconi, G. Weissmuller, F. Stauffer, and A. T. Da Poian. 2002. Membrane recognition by vesicular stomatitis virus involves enthalpy-driven protein-lipid interactions. J. Virol. 76:3756-3764.[Abstract/Free Full Text]
  8. 5
  9. Carneiro, F. A., A. S. Ferradosa, and A. T. Da Poian. 2001. Low pH-induced conformational changes in vesicular stomatitis virus glycoprotein involve dramatic structure reorganization. J. Biol. Chem. 276:62-67.[Abstract/Free Full Text]
  10. 6
  11. Carneiro, F. A., P. A. Lapido-Loureiro, S. M. Cordo, F. Stauffer, G. Weissmuller, M. L. Bianconi, M. A. Juliano, L. Juliano, P. M. Bisch, and A. T. Da Poian. 2006. Probing the interaction between vesicular stomatitis virus and phosphatidylserine. Eur. Biophys. J. 35:145-154.[CrossRef][Medline]
  12. 7
  13. Coil, D. A., and A. D. Miller. 2005. Enhancement of enveloped virus entry by phosphatidylserine. J. Virol. 79:11496-11500.[Abstract/Free Full Text]
  14. 8
  15. Coil, D. A., and A. D. Miller. 2004. Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. J. Virol. 78:10920-10926.[Abstract/Free Full Text]
  16. 9
  17. Conner, S. D., and S. L. Schmid. 2003. Differential requirements for AP-2 in clathrin-mediated endocytosis. J. Cell Biol. 162:773-779.[Abstract/Free Full Text]
  18. 10
  19. Conner, S. D., and S. L. Schmid. 2003. Regulated portals of entry into the cell. Nature 422:37-44.[CrossRef][Medline]
  20. 11
  21. Dahlberg, J. E. 1974. Quantitative electron microscopic analysis of the penetration of VSV into L cells. Virology 58:250-262.[CrossRef][Medline]
  22. 12
  23. Dales, S. 1973. Early events in cell-animal virus interactions. Bacteriol. Rev. 37:103-135.[Free Full Text]
  24. 13
  25. Damm, E. M., L. Pelkmans, J. Kartenbeck, A. Mezzacasa, T. Kurzchalia, and A. Helenius. 2005. Clathrin- and caveolin-1-independent endocytosis: entry of simian virus 40 into cells devoid of caveolae. J. Cell Biol. 168:477-488.[Abstract/Free Full Text]
  26. 14
  27. Daro, E., D. Sheff, M. Gomez, T. Kreis, and I. Mellman. 1997. Inhibition of endosome function in CHO cells bearing a temperature-sensitive defect in the coatomer (COPI) component epsilon-COP. J. Cell Biol. 139:1747-1759.[Abstract/Free Full Text]
  28. 15
  29. Ehrlich, M., W. Boll, A. Van Oijen, R. Hariharan, K. Chandran, M. L. Nibert, and T. Kirchhausen. 2004. Endocytosis by random initiation and stabilization of clathrin-coated pits. Cell 118:591-605.[CrossRef][Medline]
  30. 16
  31. Flett, A., S. Semerdjieva, A. P. Jackson, and E. Smythe. 2005. Regulation of the clathrin-coated vesicle cycle by reversible phosphorylation. Biochem. Soc. Symp. 2005:65-70.
  32. 17
  33. Gaidarov, I., F. Santini, R. A. Warren, and J. H. Keen. 1999. Spatial control of coated-pit dynamics in living cells. Nat. Cell Biol. 1:1-7.[CrossRef][Medline]
  34. 18
  35. Goldenberg, N. M., S. Grinstein, and M. Silverman. 2007. Golgi-bound Rab34 is a novel member of the secretory pathway. Mol. Biol. Cell 18:4762-4771.[Abstract/Free Full Text]
  36. 19
  37. Goodman, O. B., Jr., J. G. Krupnick, F. Santini, V. V. Gurevich, R. B. Penn, A. W. Gagnon, J. H. Keen, and J. L. Benovic. 1996. Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 383:447-450.[CrossRef][Medline]
  38. 20
  39. Goosney, D. L., and G. R. Nemerow. 2003. Adenovirus infection: taking the back roads to viral entry. Curr. Biol. 13:R99-R100.[CrossRef][Medline]
  40. 21
  41. He, G., S. Gupta, M. Yi, P. Michaely, H. H. Hobbs, and J. C. Cohen. 2002. ARH is a modular adaptor protein that interacts with the LDL receptor, clathrin, and AP-2. J. Biol. Chem. 277:44044-44049.[Abstract/Free Full Text]
  42. 22
  43. Helenius, A., J. Kartenbeck, K. Simons, and E. Fries. 1980. On the entry of Semliki Forest virus into BHK-21 cells. J. Cell Biol. 84:404-420.[Abstract/Free Full Text]
  44. 23
  45. Helenius, A., M. Marsh, and J. White. 1980. The entry of viruses into animal cells. Trends Biochem. Sci. 5:104-106.[CrossRef]
  46. 24
  47. Helenius, A., and M. Marsh. 1982. Endocytosis of enveloped animal viruses. CIBA Found. Symp. 1982:59-76.
  48. 25
  49. Heuser, J. 1980. Three-dimensional visualization of coated vesicle formation in fibroblasts. J. Cell Biol. 84:560-583.[Abstract/Free Full Text]
  50. 26
  51. Hinrichsen, L., J. Harborth, L. Andrees, K. Weber, and E. J. Ungewickell. 2003. Effect of clathrin heavy chain- and alpha-adaptin-specific small inhibitory RNAs on endocytic accessory proteins and receptor trafficking in HeLa cells. J. Biol. Chem. 278:45160-45170.[Abstract/Free Full Text]
  52. 27
  53. Hirschberg, K., R. D. Phair, and J. Lippincott-Schwartz. 2000. Kinetic analysis of intracellular trafficking in single living cells with vesicular stomatitis virus protein G-green fluorescent protein hybrids. Methods Enzymol. 327:69-89.[Medline]
  54. 28
  55. Hu, W. S., and V. K. Pathak. 2000. Design of retroviral vectors and helper cells for gene therapy. Pharmacol. Rev. 52:493-511.[Abstract/Free Full Text]
  56. 29
  57. Johnson, J. E., M. J. Schnell, L. Buonocore, and J. K. Rose. 1997. Specific targeting to CD4+ cells of recombinant vesicular stomatitis viruses encoding human immunodeficiency virus envelope proteins. J. Virol. 71:5060-5068.[Abstract]
  58. 30
  59. Kartenbeck, J., H. Stukenbrok, and A. Helenius. 1989. Endocytosis of simian virus 40 into the endoplasmic reticulum. J. Cell Biol. 109:2721-2729.[Abstract/Free Full Text]
  60. 31
  61. Kielian, M. C., S. Keranen, L. Kaariainen, and A. Helenius. 1984. Membrane fusion mutants of Semliki Forest virus. J. Cell Biol. 98:139-145.[Abstract/Free Full Text]
  62. 32
  63. Kretzschmar, E., L. Buonocore, M. J. Schnell, and J. K. Rose. 1997. High-efficiency incorporation of functional influenza virus glycoproteins into recombinant vesicular stomatitis viruses. J. Virol. 71:5982-5989.[Abstract]
  64. 33
  65. Lajoie, P., and I. R. Nabi. 2007. Regulation of raft-dependent endocytosis. J. Cell. Mol. Med. 11:644-653.[CrossRef][Medline]
  66. 34
  67. Laporte, S. A., R. H. Oakley, J. Zhang, J. A. Holt, S. S. Ferguson, M. G. Caron, and L. S. Barak. 1999. The beta2-adrenergic receptor/betaarrestin complex recruits the clathrin adaptor AP-2 during endocytosis. Proc. Natl. Acad. Sci. USA 96:3712-3717.[Abstract/Free Full Text]
  68. 35
  69. Le Blanc, I., P. P. Luyet, V. Pons, C. Ferguson, N. Emans, A. Petiot, N. Mayran, N. Demaurex, J. Faure, R. Sadoul, R. G. Parton, and J. Gruenberg. 2005. Endosome-to-cytosol transport of viral nucleocapsids. Nat. Cell Biol. 7:653-664.[CrossRef][Medline]
  70. 36
  71. Lehmann, M. J., N. M. Sherer, C. B. Marks, M. Pypaert, and W. Mothes. 2005. Actin- and myosin-driven movement of viruses along filopodia precedes their entry into cells. J. Cell Biol. 170:317-325.[Abstract/Free Full Text]
  72. 37
  73. Lichty, B. D., A. T. Power, D. F. Stojdl, and J. C. Bell. 2004. Vesicular stomatitis virus: re-inventing the bullet. Trends Mol. Med. 10:210-216.[CrossRef][Medline]
  74. 38
  75. Macia, E., M. Ehrlich, R. Massol, E. Boucrot, C. Brunner, and T. Kirchhausen. 2006. Dynasore, a cell-permeable inhibitor of dynamin. Dev. Cell 10:839-850.[CrossRef][Medline]
  76. 39
  77. Marsh, M., M. C. Kielian, and A. Helenius. 1985. Semliki Forest virus entry and the endocytic pathway. Trans. Biochem. Soc. 12:981-983.
  78. 40
  79. Martin-Acebes, M. A., M. Gonzalez-Magaldi, K. Sandvig, F. Sobrino, and R. Armas-Portela. 2007. Productive entry of type C foot-and-mouth disease virus into susceptible cultured cells requires clathrin and is dependent on the presence of plasma membrane cholesterol. Virology 369:105-118.[CrossRef][Medline]
  80. 41
  81. Matlin, K. S., H. Reggio, A. Helenius, and K. Simons. 1982. The pathway of vesicular stomatitis virus entry leading to infection. J. Mol. Biol. 156:609-631.[CrossRef][Medline]
  82. 42
  83. Matteoni, R., and T. Kreis. 1987. Translocation and clustering of endosomes and lysosomes depends on microtubules. J. Cell Biol. 105:1253-1256.[Abstract/Free Full Text]
  84. 43
  85. Maul, G. G., G. Rovera, A. Vorbrodt, and J. Abramczuk. 1978. Membrane fusion as a mechanism of simian virus 40 entry into different cellular compartments. J. Virol. 28:936-944.[Abstract/Free Full Text]
  86. 44
  87. Maurer, M. E., and J. A. Cooper. 2006. The adaptor protein Dab2 sorts LDL receptors into coated pits independently of AP-2 and ARH. J. Cell Sci. 119:4235-4246.[Abstract/Free Full Text]
  88. 45
  89. Mayor, S., and R. E. Pagano. 2007. Pathways of clathrin-independent endocytosis. Nat. Rev. Mol. Cell Biol. 8:603-612.[CrossRef][Medline]
  90. 46
  91. Mellman, I., R. Fuchs, and A. Helenius. 1986. Acidification of endocytic and exocytic pathways. Annu. Rev. Biochem. 55:663-700.[CrossRef][Medline]
  92. 47
  93. Mercer, J., and A. Helenius. 2008. Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells. Science 320:531-535.[Abstract/Free Full Text]
  94. 48
  95. Merrifield, C. J., M. E. Feldman, L. Wan, and W. Almers. 2002. Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat. Cell Biol. 4:691-698.[CrossRef][Medline]
  96. 49
  97. Mezzacasa, A., and A. Helenius. 2002. The transitional ER defines a boundary for quality control in the secretion of tsO45 VSV glycoprotein. Traffic 3:833-849.[CrossRef][Medline]
  98. 50
  99. Miller, D. K., and J. Lenard. 1980. Inhibition of vesicular stomatitis virus infection by spike glycoprotein. Evidence for an intracellular, G protein-requiring step. J. Cell Biol. 84:430-437.[Abstract/Free Full Text]
  100. 51
  101. Mishra, S. K., P. A. Keyel, M. J. Hawryluk, N. R. Agostinelli, S. C. Watkins, and L. M. Traub. 2002. Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor. EMBO J. 21:4915-4926.[CrossRef][Medline]
  102. 52
  103. Morris, S. M., and J. A. Cooper. 2001. Disabled-2 colocalizes with the LDLR in clathrin-coated pits and interacts with AP-2. Traffic 2:111-123.[CrossRef][Medline]
  104. 53
  105. Motley, A., N. A. Bright, M. N. Seaman, and M. S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162:909-918.[Abstract/Free Full Text]
  106. 54
  107. Ohkuma, S., and B. Poole. 1978. Fluorescence probe measurement of the intralysosomal pH in living cells and the perturbation of pH by various agents. Proc. Natl. Acad. Sci. USA 75:3327-3331.[Abstract/Free Full Text]
  108. 55
  109. Orci, L., B. S. Glick, and J. E. Rothman. 1986. A new type of coated vesicular carrier that appears not to contain clathrin: its possible role in protein transport within the Golgi stack. Cell 46:171-184.[CrossRef][Medline]
  110. 56
  111. Orci, L., D. J. Palmer, M. Ravazzola, A. Perrelet, M. Amherdt, and J. E. Rothman. 1993. Budding from Golgi membranes requires the coatomer complex of non-clathrin coat proteins. Nature 362:648-652.
  112. 57
  113. Orci, L., A. Perrelet, M. Ravazzola, F. T. Wieland, R. Schekman, and J. E. Rothman. 1993. "BFA bodies": a subcompartment of the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 90:11089-11093.[Abstract/Free Full Text]
  114. 58
  115. Orci, L., M. Tagaya, M. Amherdt, A. Perrelet, J. G. Donaldson, J. Lippincott-Schwartz, R. D. Klausner, and J. E. Rothman. 1991. Brefeldin A, a drug that blocks secretion, blocks the formation of non-clathrin coated buds on Golgi cisternae. Cell 64:1183-1195.[CrossRef][Medline]
  116. 59
  117. Orth, J. D., E. W. Krueger, S. G. Weller, and M. A. McNiven. 2006. A novel endocytic mechanism of epidermal growth factor receptor sequestration and internalization. Cancer Res. 66:3603-3610.[Abstract/Free Full Text]
  118. 60
  119. Owen, D. J. 2004. Linking endocytic cargo to clathrin: structural and functional insights into coated vesicle formation. Biochem. Soc. Trans. 32:1-14.[CrossRef][Medline]
  120. 61
  121. Owen, D. J., B. M. Collins, and P. R. Evans. 2004. Adaptors for clathrin coats: structure and function. Annu. Rev. Cell Dev. Biol. 20:153-191.[CrossRef][Medline]
  122. 62
  123. Pelkmans, L., E. Fava, H. Grabner, M. Hannus, B. Habermann, E. Krausz, and M. Zerial. 2005. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature 436:78-86.[CrossRef][Medline]
  124. 63
  125. Pelkmans, L., D. Puntener, and A. Helenius. 2002. Local actin polymerization and dynamin recruitment in SV40-induced internalization of caveolae. Science 296:535-539.[Abstract/Free Full Text]
  126. 64
  127. Pepperkok, R., J. Scheel, H. Horstmann, H. P. Hauri, G. Griffiths, and T. E. Kreis. 1993. Beta-COP is essential for biosynthetic membrane transport from the endoplasmic reticulum to the Golgi complex in vivo. Cell 74:71-82.[CrossRef][Medline]
  128. 65
  129. Progida, C., L. Malerod, S. Stuffers, A. Brech, C. Bucci, and H. Stenmark. 2007. RILP is required for the proper morphology and function of late endosomes. J. Cell Sci. 120:3729-3737.[Abstract/Free Full Text]
  130. 66
  131. Quirin, K., B. Eschli, I. Scheu, L. Poort, J. Kartenbeck, and A. Helenius. 2008. Lymphocytic choriomeningitis virus uses a novel endocytic pathway for infectious entry via late endosomes. Virology 378:21-33.[CrossRef][Medline]
  132. 67
  133. Rappoport, J. Z., and S. M. Simon. 2003. Real-time analysis of clathrin-mediated endocytosis during cell migration. J. Cell Sci. 116:847-855.[Abstract/Free Full Text]
  134. 68
  135. Robinson, F. L., and J. E. Dixon. 2006. Myotubularin phosphatases: policing 3-phosphoinositides. Trends Cell Biol. 16:403-412.[CrossRef][Medline]
  136. 69
  137. Robinson, M. S. 2004. Adaptable adaptors for coated vesicles. Trends Cell Biol. 14:167-174.[CrossRef][Medline]
  138. 70
  139. Rodriguez, L. L. 2002. Emergence and re-emergence of vesicular stomatitis in the United States. Virus Res. 85:211-219.[CrossRef][Medline]
  140. 71
  141. Rust, M. J., M. Lakadamyali, F. Zhang, and X. Zhuang. 2004. Assembly of endocytic machinery around individual influenza viruses during viral entry. Nat. Struct. Mol. Biol. 11:567-573.[CrossRef][Medline]
  142. 72
  143. Sabharanjak, S., P. Sharma, R. G. Parton, and S. Mayor. 2002. GPI-anchored proteins are delivered to recycling endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic pathway. Dev. Cell 2:411-423.[CrossRef][Medline]
  144. 73
  145. Sachse, M., G. Ramm, G. Strous, and J. Klumperman. 2002. Endosomes: multipurpose designs for integrating housekeeping and specialized tasks. Histochem. Cell Biol. 117:91-104.[CrossRef][Medline]
  146. 74
  147. Saeed, M. F., A. A. Kolokoltsov, and R. A. Davey. 2006. Novel, rapid assay for measuring entry of diverse enveloped viruses, including HIV and rabies. J. Virol. Methods 135:143-150.[CrossRef][Medline]
  148. 75
  149. Santini, F., I. Gaidarov, and J. H. Keen. 2002. G protein-coupled receptor/arrestin3 modulation of the endocytic machinery. J. Cell Biol. 156:665-676.[Abstract/Free Full Text]
  150. 76
  151. Schmid, S. L., R. Fuchs, P. Male, and I. Mellman. 1988. Two distinct subpopulations of endosomes involved in membrane recycling and transport to lysosomes. Cell 52:73-83.[CrossRef][Medline]
  152. 77
  153. Schnell, M. J., L. Buonocore, M. A. Whitt, and J. K. Rose. 1996. The minimal conserved transcription stop-start signal promotes stable expression of a foreign gene in vesicular stomatitis virus. J. Virol. 70:2318-2323.[Abstract]
  154. 78
  155. Schnitzer, J. E., P. Oh, E. Pinney, and J. Allard. 1994. Filipin-sensitive caveolae-mediated transport in endothelium: reduced transcytosis, scavenger endocytosis, and capillary permeability of select macromolecules. J. Cell Biol. 127:1217-1232.[Abstract/Free Full Text]
  156. 79
  157. Scott, M. G., A. Benmerah, O. Muntaner, and S. Marullo. 2002. Recruitment of activated G protein-coupled receptors to pre-existing clathrin-coated pits in living cells. J. Biol. Chem. 277:3552-3559.[Abstract/Free Full Text]
  158. 80
  159. Sieczkarski, S. B., and G. R. Whittaker. 2003. Differential requirements of Rab5 and Rab7 for endocytosis of influenza and other enveloped viruses. Traffic 4:333-343.[Medline]
  160. 81
  161. Sieczkarski, S. B., and G. R. Whittaker. 2002. Dissecting virus entry via endocytosis. J. Gen. Virol. 83:1535-1545.[Abstract/Free Full Text]
  162. 82
  163. Sieczkarski, S. B., and G. R. Whittaker. 2002. Influenza virus can enter and infect cells in the absence of clathrin-mediated endocytosis. J. Virol. 76:10455-10464.[Abstract/Free Full Text]
  164. 83
  165. Sigismund, S., T. Woelk, C. Puri, E. Maspero, C. Tacchetti, P. Transidico, P. P. Di Fiore, and S. Polo. 2005. Clathrin-independent endocytosis of ubiquitinated cargos. Proc. Natl. Acad. Sci. USA 102:2760-2765.[Abstract/Free Full Text]
  166. 84
  167. Simonsen, A., A. E. Wurmser, S. D. Emr, and H. Stenmark. 2001. The role of phosphoinositides in membrane transport. Curr. Opin. Cell Biol. 13:485-492.[CrossRef][Medline]
  168. 85
  169. Sorkin, A. 2004. Cargo recognition during clathrin-mediated endocytosis: a team effort. Curr. Opin. Cell Biol. 16:392-399.[CrossRef][Medline]
  170. 86
  171. Stenmark, H. 2001. Trafficking of lipids. Semin. Cell Dev. Biol. 12:135-137.[CrossRef][Medline]
  172. 87
  173. Stenmark, H., and D. J. Gillooly. 2001. Intracellular trafficking and turnover of phosphatidylinositol 3-phosphate. Semin. Cell Dev. Biol. 12:193-199.[CrossRef][Medline]
  174. 88
  175. Sun, X., V. K. Yau, B. J. Briggs, and G. R. Whittaker. 2005. Role of clathrin-mediated endocytosis during vesicular stomatitis virus entry into host cells. Virology 338:53-60.[CrossRef][Medline]
  176. 89
  177. Traub, L. M. 2003. Sorting it out: AP-2 and alternate clathrin adaptors in endocytic cargo selection. J. Cell Biol. 163:203-208.[Abstract/Free Full Text]
  178. 90
  179. Traub, L. M., and G. L. Lukacs. 2007. Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs. J. Cell Sci. 120:543-553.[Abstract/Free Full Text]
  180. 91
  181. Ungewickell, E. J., and L. Hinrichsen. 2007. Endocytosis: clathrin-mediated membrane budding. Curr. Opin. Cell Biol. 19:417-425.[CrossRef][Medline]
  182. 92
  183. van der Sluijs, P., M. Hull, P. Webster, P. Male, B. Goud, and I. Mellman. 1992. The small GTP-binding protein rab4 controls an early sorting event on the endocytic pathway. Cell 70:729-740.[CrossRef][Medline]
  184. 93
  185. Vonderheit, A. 2004. Visualization of the endocytosis pathway of Semliki Forest virus. Ph.D. thesis. Swiss Federal Institute of Technology Zürich, Zürich, Switzerland.
  186. 94
  187. White, J., K. Matlin, and A. Helenius. 1981. Cell fusion by Semliki Forest, influenza, and vesicular stomatitis viruses. J. Cell Biol. 89:674-679.[Abstract/Free Full Text]
  188. 95
  189. Whitney, J. A., M. Gomez, D. Sheff, T. E. Kreis, and I. Mellman. 1995. Cytoplasmic coat proteins involved in endosome function. Cell 83:703-713.[CrossRef][Medline]
  190. 96
  191. Yee, J. K., T. Friedmann, and J. C. Burns. 1994. Generation of high-titer pseudotyped retroviral vectors with very broad host range. Methods Cell Biol. 43:99-112.[CrossRef][Medline]


Journal of Virology, January 2009, p. 440-453, Vol. 83, No. 1
0022-538X/09/$08.00+0     doi:10.1128/JVI.01864-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Mire, C. E., Dube, D., Delos, S. E., White, J. M., Whitt, M. A. (2009). Glycoprotein-Dependent Acidification of Vesicular Stomatitis Virus Enhances Release of Matrix Protein. J. Virol. 83: 12139-12150 [Abstract] [Full Text]  
  • Agosto, L. M., Yu, J. J., Liszewski, M. K., Baytop, C., Korokhov, N., Humeau, L. M., O'Doherty, U. (2009). The CXCR4-Tropic Human Immunodeficiency Virus Envelope Promotes More-Efficient Gene Delivery to Resting CD4+ T Cells than the Vesicular Stomatitis Virus Glycoprotein G Envelope. J. Virol. 83: 8153-8162 [Abstract] [Full Text]  
  • Gregory, S. M., West, J. A., Dillon, P. J., Hilscher, C., Dittmer, D. P., Damania, B. (2009). Toll-like receptor signaling controls reactivation of KSHV from latency. Proc. Natl. Acad. Sci. USA 106: 11725-11730 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Johannsdottir, H. K.
Right arrow Articles by Helenius, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Johannsdottir, H. K.
Right arrow Articles by Helenius, A.