Previous Article | Next Article 
Journal of Virology, January 2009, p. 140-149, Vol. 83, No. 1
0022-538X/09/$08.00+0 doi:10.1128/JVI.01471-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
HLA-Associated Alterations in Replication Capacity of Chimeric NL4-3 Viruses Carrying gag-protease from Elite Controllers of Human Immunodeficiency Virus Type 1 
Toshiyuki Miura,1,2,3
Mark A. Brockman,1,2
Zabrina L. Brumme,1,2
Chanson J. Brumme,1
Florencia Pereyra,1,2
Alicja Trocha,1,3
Brian L. Block,1
Arne Schneidewind,1,2
Todd M. Allen,1,2
David Heckerman,4 and
Bruce D. Walker1,2,3*
Partners AIDS Research Center, Massachusetts General Hospital, 13th St., BLD149, Charlestown, Massachusetts 02129,1
Harvard University Center for AIDS Research, Boston, Massachusetts 02115,2
Howard Hughes Medical Institute, Chevy Chase, Maryland 20815,3
Microsoft Research, Redmond, Washington 980524
Received 14 July 2008/
Accepted 16 October 2008

ABSTRACT
Human immunodeficiency virus type 1 (HIV-1)-infected persons
who maintain plasma viral loads of <50 copies RNA/ml without
treatment have been termed elite controllers (EC). Factors contributing
to durable control of HIV in EC are unknown, but an HLA-dependent
mechanism is suggested by overrepresentation of "protective"
class I alleles, such as B*27, B*51, and B*57. Here we investigated
the relative replication capacity of viruses (VRC) obtained
from EC (
n = 54) compared to those from chronic progressors
(CP;
n = 41) by constructing chimeric viruses using patient-derived
gag-protease sequences amplified from plasma HIV RNA and inserted
into an NL4-3 backbone. The chimeric viruses generated from
EC displayed lower VRC than did viruses from CP (
P < 0.0001).
HLA-B*57 was associated with lower VRC (
P = 0.0002) than were
other alleles in both EC and CP groups. Chimeric viruses from
B*57
+ EC (
n = 18) demonstrated lower VRC than did viruses from
B*57
+ CP (
n = 8,
P = 0.0245). Differences in VRC between EC
and CP were also observed for viruses obtained from individuals
expressing no described "protective" alleles (
P = 0.0065). Intriguingly,
two common HLA alleles, A*02 and B*07, were associated with
higher VRC (
P = 0.0140 and 0.0097, respectively), and there
was no difference in VRC between EC and CP sharing these common
HLA alleles. These findings indicate that cytotoxic T-lymphocyte
(CTL) selection pressure on
gag-protease alters VRC, and HIV-specific
CTLs inducing escape mutations with fitness costs in this region
may be important for strict viremia control in EC of HIV.

INTRODUCTION
Human immunodeficiency virus type 1 (HIV-1)-infected individuals
who control viremia to below the limit of detection (<50
RNA copies/ml plasma) without antiviral therapy have been termed
elite controllers (EC) (
16). Unraveling the mechanisms associated
with this rare and remarkable phenotype, which has been documented
in some persons infected for 30 years and counting, should provide
important insights regarding our understanding of HIV pathogenesis
and could provide important insights for vaccine development.
Host genetics, host innate and adaptive immune responses, and viral sequence variation have all been suggested to influence the rate of disease progression in HIV-1 infection (reviewed in reference 16). Recently, we reported that viruses sequenced from plasma and peripheral blood mononuclear cells from EC do not share a common ancestor, do not contain shared amino acid changes that are specific to this phenotype, and do not typically harbor gross viral genetic defects (36). However, such studies do not address functional properties of the encoded proteins, such as viral replication capacity (VRC). Reductions in VRC have been observed following exposure to antiretroviral drug selection pressure (17, 25, 31, 34) and therefore may also occur in response to immune selection pressure. Focused studies of VRC in long-term nonprogressors/long-term survivors with detectable viremia have suggested that their viruses have reduced VRC compared to those of chronic progressors (CP) (7, 37, 39).
Due to the difficulties in isolating viruses from EC, investigating VRC in this rare group has been very challenging. Blankson et al. reported isolation of replication-competent viruses from 4 of 10 EC studied (8). On the other hand, the same group reported a case of a B*27/57 EC whose virus had reduced replication capacity compared to those of laboratory reference strains and the virus in the transmitting donor (4). However, to date, there have been no studies comparing VRC between EC and CP.
Factors that influence VRC are beginning to be defined. Several studies have concluded that the envelope protein is a major determinant for overall fitness of HIV-1 (6, 32, 40, 44). However, little is known about the influence on viral replication of the Gag protein, whose gene sequence is much more conserved than that of envelope. Not only is the Gag protein essential for viral replication, but it is known to be a preferred target for HIV-specific cytotoxic T lymphocytes (CTL) and is subject to mutations driven by CTL selection pressure (9, 21, 28, 35, 38, 45). Although it has been firmly established that in vivo polymorphisms in the conserved pol gene selected under antiretroviral drug therapy can markedly impair viral replication (25, 34), the consequences of immune-driven mutations for VRC remain incompletely understood.
Recent studies have indicated that escape mutations in Gag CTL epitopes restricted by HLA B*27 or B*57, each of which is a known protective HLA class I allele, result in a fitness cost (10, 15, 30, 33, 41, 42). Moreover, CTL targeting epitopes with escape mutations were associated with low plasma viral load (28, 35). Furthermore, relative viremia control was observed in the early phase of infection in persons who acquired viruses from donors with protective HLA alleles that target multiple epitopes within Gag (14, 22), suggesting fitness costs incurred as a result of CTL escape in the donor. These considerations motivated us to examine the influence of the gag gene on VRC.
In the present study, we generated gag-protease chimeric viruses on an HIV-1 NL4-3 virus backbone using PCR products amplified from plasma of 54 EC and 41 CP and compared VRC by using an infectible cell line with a green fluorescent protein (GFP) reporter to monitor viral replication in vitro. Since there are multiple protease cleavage sites within the Gag protein, the patient-derived protease gene was included in the chimeric constructs to preserve Gag processing by the autologous protease. We observed marked differences in VRC when comparing EC and CP and a differential impact on VRC by certain HLA class I alleles. This is the first study to compare VRC between EC and CP and also the first study to investigate associations between HLA alleles and in vitro VRC of HIV-1.

MATERIALS AND METHODS
Study subjects and plasma collection.
Fifty-four untreated EC (<50 copies/ml plasma) and 41 untreated
CP (median viral load, 79,900 [interquartile range, 33,600 to
225,000] copies/ml) were included in the present study. Three
of the EC subsequently blipped during clinical follow-up (on
average, 813, 183, and 498 RNA copies/ml, respectively) but
unless otherwise indicated are grouped with the EC in this analysis.
This cohort has been described in detail elsewhere (
38). Informed
consent was obtained from all participants. Plasma was obtained
by standard procedures and stored at –80°C until use.
Viral RNA isolation and nested RT-PCR amplification of gag-protease from plasma.
For the majority of EC, the first-round reverse transcription (RT)-PCR products from plasma containing the entire gag and protease genes were obtained in the context of a previous study (36), and additionally some EC were added to the current study by using exactly the same methods. The primers used to amplify the first-round products were as follows: forward, AAATCTCTAGCAGTGGCGCCCGAACAG (HXB2 nucleotides 623 to 649), and reverse, TAACCCTGCGGGATGTGGTATTCC (2849 to 2826). For CP, viral RNA was isolated from 0.5 ml of plasma following the same procedures as those used for EC for generation of first-round PCR products. Second-round PCR was performed using 100-mer primers that completely matched the pNL4-3 sequence using Takara EX Taq DNA polymerase, Hot Start version (catalog no. RR006; Takara Bio Inc., Shiga, Japan). One hundred microliters of reaction mixture was composed of 10 µl of 10x EX Taq buffer, 4 µl of deoxynucleoside triphosphate mix (2.5 mM each), 6 µl of 10 µM forward primer (GAC TCG GCT TGC TGA AGC GCG CAC GGC AAG AGG CGA GGG GCG GCG ACT GGT GAG TAC GCC AAA AAT TTT GAC TAG CGG AGG CTA GAA GGA GAG AGA TGG G, 695 to 794) and reverse primer (ATG CTT TTA TTT TTT CTT CTG TCA ATG GCC ATT GTT TAA CTT TTG GGC CAT CCA TTC CTG GCT TTA ATT TTA CTG GTA CAG TCT CAA TAG GAC TAA TGG G, 2646 to 2547), 0.5 µl of enzyme, and 2 µl of first-round PCR product and water. The forward primer overlapped the gag coding sequence by five bases (underlined), and the reverse primer ended just one base downstream of the protease gene. Thermal cycler conditions were as follows: 95°C for 2 min, followed by 40 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 2 min and then followed by 7 min of 72°C. PCR products were purified with the Purelink PCR purification kit (catalog no. K3100-002; Invitrogen, California) and eluted in 50 µl of DNase-RNase-free water.
Generation of chimeric viruses.
gag-protease-deleted pNL4-3 was developed by inserting the unique restriction enzyme site BstEII at the 5' end of the gag gene and then 45 bases downstream from the 3'end of the protease gene of pNL4-3 by site-directed mutagenesis using QuikChange II (Stratagene, La Jolla, CA). The gag-protease gene was then deleted by BstEII digestion (New England Biolabs, Ipswich, MA), resulting in self-ligation of the remaining plasmid. A large amount of vector was prepared using the Hispeed plasmid maxi kit (catalog no.12663; Qiagen, Maryland), eluted in 1 ml Tris-EDTA buffer, and stored at –20°C until use. This vector was then linearized by BstEII digestion at 60°C for 2 h and purified (Purelink PCR purification kit). Ten micrograms of linearized vector and 5 to 10 µg of purified PCR product were cotransfected into 2.5 x 106 cells of the tat-driven GFP reporter T-cell line (GXR cells, CEM origin [11]) in 800 µl of R10 Plus medium (RPMI medium with 10% fetal calf serum containing penicillin and streptomycin) by electroporation (exponential protocol, 300 V, 500 µF). Cells were incubated for 45 min at room temperature and transferred to T25 flasks in 10 ml of R10 Plus medium. GFP expression was monitored by flow cytometry (FACSCalibur; BD Biosciences, San Jose, CA) every 1 to 2 days after day 5. Supernatants were harvested after GFP expression reached 15% among the viable cells and were stored at –80°C as viral stocks for subsequent replication capacity experiments. Virus titration and VRC assays were performed as described previously (10, 36, 41) at a multiplicity of infection (MOI) of 0.002. Replication capacity assays were performed in duplicate, using gating strategies as previously described (10, 11, 36, 41, 42). The slope of the natural log of percent GFP-expressing cells was calculated between days 2 and 6. The natural log was used for the slope calculation, as appropriate for an exponential growth curve. The MOI of 0.002 was chosen based on initial experiments with this cell line and the chimeric viruses showing that, at this MOI, a robust and clear exponential curve could be plotted before reaching a plateau level of 30 to 40% at 7 to 8 days postinfection, which represents the saturation level in this system. In addition, for each viral stock, viral RNA was extracted from 30 µl of stock supernatant using the ChargeSwitch EasyPlex viral kit (catalog no. CS12281-04m; Invitrogen, California) following the manufacturer's instructions, followed by nested RT-PCR, as described above, to provide product for sequencing.
Sequencing and phylogenetic analysis.
Plasma and viral stock sequencing was performed as described previously (36). The origin of gag-protease genes from chimeric NL4-3 was confirmed by the maximum-likelihood method (DNAml, PHYLIP). Protein amino acid sequence trees were drawn by the maximum-likelihood method as well (Proml, PHYLIP).
Statistical analysis.
VRC was compared between the grouped pairs using the Mann-Whitney U test. The association between (i) VRC and the presence or absence of HLA alleles and (ii) VRC and the presence or absence of individual viral amino acid residues was analyzed by Mann-Whitney U test. To account for multiple tests, q values were computed, with cutoffs for significance as indicated elsewhere (43).
Nucleotide sequence accession numbers.
Viral sequences which had not been reported before were submitted to GenBank (accession numbers EU864042-114 and EU873002-005).

RESULTS
Generation and validation of gag-protease chimeric NL4-3 viruses.
Cotransfection of the amplified patient-derived
gag-protease genes with the linearized
gag-protease NL4-3 plasmid into a
GFP reporter cell line resulted in production of infectious
progeny viruses, with expression of GFP in at least 15% of the
cells within a median of 14 days (range, 7 to 28 days) in all
54 EC and 41 CP. The entire
gag region of the chimeric viruses
was then sequenced from the resultant chimeric viral stocks
and compared to the original source plasma (Fig.
1). A median
of 0.598% (interquartile range, 0.199 to 1.397%) difference
at the protein level was observed between plasma HIV RNA and
chimeric virus, and there was a significant difference between
EC and CP viruses (0.299% [0.150 to 1.199] versus 0.796% [0.399
to 1.796],
P = 0.003). However, the vast majority of the differences
were observed at a codon in which we detected mixtures in the
sequences, and as expected these were more frequent in persons
with higher plasma viral loads. If amino acid mixtures were
excluded from analysis, there was no difference between EC and
CP (0.0% [0.0 to 0.120] versus 0.0% [0.0 to 0.120],
P = 0.887).
These data indicated that although there may have been some
selection of chimeric viruses during recombination and/or culture,
which was particularly evident for CP, probably due to higher
intraindividual diversity than that for EC, Gag-Protease of
chimeric viruses represented the dominant form of plasma viruses
in both EC and CP, and selection during culture was unlikely
to affect the overall analysis. For subsequent analyses, sequences
derived directly from the chimeric viruses were used.
Comparison of VRCs of chimeric NL4-3 between EC and CP.
In order to quantitatively compare the in vitro VRCs of chimeric
viruses from EC and CP, we infected the GFP reporter cell line
with the chimeric viral stocks at an MOI of 0.002 and measured
VRC by performing flow cytometric quantitation of the percentage
of cells expressing GFP from days 2 to 6 after infection (Fig.
2A).
gag-protease chimeric viruses derived from EC displayed
significantly reduced replication capacity compared to those
derived from CP. All but two EC were infected with clade B viruses;
significant differences remained (
P < 0.0001) even after
removal of these two non-clade B viruses (Fig.
2B). Three of
the EC were subsequently determined to have had blips in viral
load at the time at which the
gag-protease gene was amplified
(viral loads of 812, 183, and 498 RNA copies/ml); removing these
from the analysis also did not affect the results (data not
shown). We observed a weak positive correlation between VRC
and plasma viral loads of CP (Pearson
r = 0.29,
P = 0.065, data
not shown), supporting the finding that chimeric viruses derived
from the subjects with lower plasma viral loads had reduced
in vitro replication capacity.
Association between specific HLA alleles and VRC of chimeric NL4-3 viruses.
Having shown that in vitro VRC varies significantly among viruses
obtained from HIV-infected persons, we next examined whether
the particular HLA alleles expressed affected this parameter.
In this analysis, we included 90 clade B virus-infected subjects
in whom HLA class I types were available and excluded the two
subjects with non-B-clade virus infection. Again, using the
slope of percent GFP infection between days 2 and 6 as a measure
of VRC, we found four class I HLA alleles significantly associated
with differences in VRC: B*57, Cw*18, A*02, and B*07 (all
P < 0.05 and
q < 0.2 [Table
1]). B*57 showed the strongest
negative impact on VRC (0.777 in B*57
+ versus 0.919 in B*57
–,
q < 0.0001), which supported previous reports of fitness
costs by B*57 CTL escape mutations in Gag (
10,
30,
33). Cw*18
also showed a weaker negative impact; however, this is likely
due to the strong linkage disequilibrium between B*5703 and
Cw*18, rather than a true negative impact of Cw*18 on VRC. In
contrast, A*02 and B*07 were associated with higher VRC (0.948
versus 0.816 for A*02 and 0.987 versus 0.831,
q = 0.175, respectively
[Table
1]). The fact that these alleles are both common in the
U.S. population (A*02 frequency, 28.3% for Caucasians and 18.7%
for African Americans; B*07 frequency, 11.3% for Caucasians
and 9.8% for African Americans) (
12) suggests the possibility
that these are not actively increasing VRC but rather that the
virus may have become most adapted to these populations, rendering
them neutral in comparison to a large group of less-frequent
HLA alleles, which may still be impacting viral load (
1,
20,
29).
Since homozygosity at HLA class I loci has been linked to more-rapid
HIV disease progression (
13), we also examined the impact of
homozygosity for HLA A, B, or C alleles on VRC. However, no
association with VRC of the chimeric viruses was observed (data
not shown). Also of interest, we did not see a negative impact
on
gag-protease function by HLA B*27 and B*51, despite these
alleles being enriched in EC (
38) (Table
1). However, these
results could be due to limited statistical power; analysis
of larger data sets will be necessary to further evaluate this.
Stratification of VRC by controller status and particular HLA alleles.
Given the above results showing that VRC is associated with EC status and with expression of particular HLA alleles, we next compared the relative VRC within the EC group in relation to specific HLA alleles and did the same for the CP group. As shown in Fig. 3A, chimeric viruses from EC expressing HLA-B*57 showed significantly lower VRC than did those from non-B*57 EC (0.707 versus 0.827, P = 0.0074). Likewise, chimeric viruses from B*57 CP displayed significantly reduced VRC compared to those from non-B*57 CP (0.850 versus 1.005, P = 0.0489). Notably, there was a significant difference in VRC between not only B*57 EC and B*57 CP (P = 0.0245) but also non-B*57 EC and non-B*57 CP (P = 0.0002), indicating that the reduced VRC of EC was not due just to biased distribution of B*57 in EC (Fig. 3A). The difference between B*57 EC and B*57 CP is consistent with a previous study in which accumulation of compensatory mutations led to recovery of fitness loss induced by escape mutations arising within CTL epitopes in B*57 progressors (10). There was still a significant difference between EC and CP when the three alleles most strongly associated with better outcome (B*27, B*51, and B*57) were removed (0.831 versus 1.004, P = 0.0065 [Fig. 3B]), indicating that the observed differences in VRC were not solely mediated by the most protective HLA alleles.
We next performed a subanalysis of the two alleles, A*02 and
B*07, associated with higher VRC. Chimeric viruses from A*02-expressing
EC showed significantly higher VRC than did those from non-A*02-expressing
EC (0.893 versus 0.786,
P = 0.0087). In contrast, no difference
in VRC was observed between A*02-expressing and non-A*02-expressing
CP (0.9733 versus 1.018,
P = 0.6597 [Fig.
3C]). Intriguingly,
there were no significant differences in VRC between A*02-expressing
EC and A*02-expressing CP, although a trend toward lower VRC
in A*02-expressing EC than in A*02-expressing CP was observed
(Fig.
3C). Similar results were obtained for B*07 (Fig.
3D).
Since B*57 showed the strongest negative impact on VRC of chimeric
viruses and there was biased distribution of B*57 in EC, we
repeated this analysis excluding this allele. After B*57-expressing
subjects were removed, a trend toward reduced VRC in non-A*02
EC compared to A*02 EC remained (0.815 versus 0.896,
P = 0.0650
[Fig.
3E]). The difference between A*02 EC and A*02 CP was further
weakened (
P = 0.2823) despite the fact that the difference between
non-A*02 EC and non-A*02 CP was maintained (
P = 0.0020 [Fig.
3E]). Combining A*02 and B*07, we obtained a similar result
and the difference between A*02/B*07 EC and other EC reached
significance (
P = 0.0390 [Fig.
3F]). These results further support
the hypothesis that A*02 and B*07 alleles themselves have little
impact on VRC on
gag-protease chimeric viruses compared to other
HLA alleles, but non-A*02/B*07 alleles enriched in EC have a
greater negative impact on VRC, albeit much weaker than that
of B*57. In addition, the data suggest that reduced VRC of
gag-protease chimeric viruses from EC is likely driven by HLA-mediated mutations
that include other alleles besides HLA B*57, rather than transmission
of viruses with attenuated
gag-protease genes.
Association between VRC and specific amino acid residues.
Having sequenced all of the gag-protease genes from the persons included in this study, we next examined the association between specific amino acid residues and VRC. Only clade B virus infections (n = 92) were included in this analysis. Table 2 shows the list of codons in Gag associated with lower VRC based on a q value cutoff of <0.2 (see Materials and Methods). There was no significant association between codons in protease and VRC (data not shown), but four positions in Gag (84, 207, 242, and 483) were statistically associated with differences. Gag 84T was associated with lower VRC, and interestingly T is the current consensus amino acid for clade B at this residue. Of EC, 88.5% had 84T but only 68.3% of CP were carrying T (P = 0.029). In the Los Alamos National Laboratory database, 87.5% (28/32) of clade B virus sequences sampled before 1995 in the United States included 84T, but after 1995, only 63.6% (14/22) did so (P = 0.05). These percentages correspond well to the differences observed at this residue in EC and CP and are likely explained by older strain infection in EC than in CP, as previously reported (36). T84V was reported as an escape mutation of A*02 (26), which is the most common HLA class I allele in the United States. Therefore, accumulation of T84V in the population over time can be supported by this study. Alternatively, it may be explained that limited viral evolution in EC prevents emergence of the T84V escape mutation in A*02+ EC, since this Gag epitope (SLYNTVATL) is typically first targeted during chronic infection after set point viral loads are achieved (26) and results in a higher frequency of 84T in EC. In any case, the association between 84T and lower VRC is unlikely to reflect a true causal relationship but rather infection by older strains in EC and/or maintenance of the wild-type A*02 epitope in EC.
Another significant association between VRC and specific sequence
differences was the Gag T242N mutation, a widely recognized
escape mutation from CTL restricted by B*57, which has a negative
impact on VRC (
10,
33). Therefore, an association between VRC
and the T242N mutation would be expected. However, this does
not necessarily mean a causal relationship. The other two Gag
mutations associated with reduced VRC, 207D and 483Q, were present
in only two EC and four EC, respectively. Interestingly, 207D
was present in two of the three EC with the lowest VRC of the
entire cohort (0.46 and 0.39). The final significant association
between sequence usage and diminished VRC was the 483Q mutation,
which was seen in an EC with the lowest VRC recorded, 0.39.
Codon 207 did not correspond to any predicted CTL epitopes for
the two EC with 207D. Codon 483 corresponded to predicted CTL
epitopes in three of the four EC (
http://www.hiv.lanl.gov/content/immunology/tables/ctl_summary.html).
However, those predicted epitopes were defined for non-clade
B virus sequences, and there are substantial mismatches within
this region between clade B and non-clade B sequences. Therefore,
it is unclear whether this region acts as a CTL epitope for
these subjects infected with clade B virus. Larger studies and
mutagenesis approaches will be necessary to examine whether
these rare mutations are truly associated with EC and affect
VRC or not. In summary, except for T242N, a known escape mutation
from B*57-restricted TW10-specific CTL, none of the common amino
acid changes could be causally linked to reduced VRC of
gag-protease chimeric NL4-3.

DISCUSSION
In this study, we assessed VRC of chimeric NL4-3 viruses expressing
the
gag-protease gene derived from a well-characterized cohort
of EC of HIV infection and compared these to chimeric viruses
derived from persons with progressive HIV infection. This is
the first study to directly compare VRC between large numbers
of EC and CP. Our results indicate that
gag-protease genes from
EC are attenuated in replication capacity compared to those
from CP. Moreover, our data indicate that there are differential
impacts on VRC by HLA class I alleles, which contribute to differences
observed in VRC between EC and CP. Notably, the allele most
associated with a protective effect in HIV-infected persons,
HLA-B*57, displayed the most profound impact on VRC.
Increasing evidence indicates that VRC can impact HIV pathogenesis (10, 15, 22, 33, 41). It has, however, been challenging to amplify target HIV-1 genes and to isolate primary viruses from EC due to the extremely low plasma viral loads. Recently, we and others have successfully amplified HIV-1 genes from plasma viral RNA of EC, which likely represent actively circulating viruses in vivo (3, 5, 36). The availability of these PCR products allowed us to generate chimeric viruses carrying HIV-1 genes from EC plasma. Combining the generation of chimeric NL4-3 with a recently developed GFP reporter T-cell line (11) enabled us to examine a large number of subjects in the context of diverse HLA alleles and to use flow cytometry to assess viral replication kinetics precisely. Our results provide evidence of a link between HLA class I alleles and VRC, suggesting an important mechanism by which CTL may contribute to viral containment.
Comparison of VRC of primary isolates between progressors and long-term nonprogressors/long-term survivors has been reported (7, 37, 39), but the current study adds important information to these earlier studies. Most reported studies of VRC have used primary CD4+ T cells as a source of autologous viruses, which do not necessarily represent actively replicating viruses in vivo. Given observed discrepancies between plasma viral and proviral sequences in subjects with extremely low viremia (reference 5 and our unpublished data), namely, that cellular proviruses maintain more wild-type sequences in EC subjects than do circulating plasma viruses in the same subjects, we reasoned it wise to avoid using primary isolates derived from autologous CD4+ T cells for comparison between controllers and progressors and instead focused on viruses derived from plasma. Moreover, previous studies have indicated that the envelope gene is the major determinant of overall replication capacity of HIV-1; that intraindividual envelope diversity positively correlates with in vitro VRC; and that as disease progresses and plasma viral load increases, VRC also increases (2, 39, 44). Since envelope sequences in EC are less evolved than those in CP (3, 36) and contain fewer mixtures than those in CP (our unpublished observations), indicating less envelope sequence diversity in EC, comparison of VRC of primary isolates between EC and CP could merely represent different degrees of diversity of envelope genes, something which has been observed when comparing acute/early- and late-phase HIV infection in a given subject (44). In other words, the difference in VRC of primary isolates between EC and CP might be just the result of limited envelope sequence diversity in EC due to host factors including immunity.
Here we were able to extend studies of VRC beyond the env gene. Given a growing body of evidence suggesting an important role for fitness costs by CTL escape mutations within Gag in controlling viremia (10, 28, 33, 35), we focused on this protein. Since it is not known whether the diversity of the Gag protein sequence correlates with its function, there remains the possibility that the observed differences in VRC between EC and CP might reflect distinct interindividual diversity of the Gag protein. We also note that there is still considerable overlap in VRC between EC and CP (Fig. 2B). Therefore, the observed reduction of Gag-Protease function in EC is not the sole factor to explain elite control but rather one of the factors contributing to suppression of viremia.
The novelty of the present study is not only in scale or use of EC samples but also in showing a differential impact on viral replication by different HLA class I alleles. Although only B*57 showed a significant negative impact on VRC, indirect evidence that common HLA alleles like A*02 and/or B*07 had little impact on VRC suggests that other HLA class I alleles likely had some negative impact on VRC, albeit to a lesser extent than B*57. This finding and additional observations of significantly reduced VRC in non-A*02/B*07/B*57 EC compared to non-A*02/B*07/B*57 CP indicate that reduced VRC in non-A*02/B*07/B*57 EC is likely mediated by HLA class I alleles enriched in EC. These findings further support recent studies suggesting the importance of CTL targeting Gag epitopes and inducing escape mutations with fitness costs (22, 28, 35).
Although this study implies a contribution of altered VRC to viral control in persons with HLA-B*57, it does not link other well-known protective HLA alleles like B*27 and B*51 to altered VRC. Since there are no known B*51 CTL epitopes within the Gag-protease (19), it is perhaps not surprising that we did not see any impact by this allele. On the other hand, B*27 is known to contain an immunodominant CTL epitope within Gag protein, and escape from this CTL response is frequently observed (18, 23, 27) and has been demonstrated to compromise VRC (41, 42). However, these mutations typically do not arise until late-stage infection (24, 41), and it has been demonstrated that the dominant CTL escape form R264K Gag requires an upstream mutation (S173A) which fully compensates the fitness cost and is required prior to complete escape (41). Thus, the lack of an effect of B*27 on gag-protease chimeric virus replication capacity in the present study does not contradict previous findings. These results indicate more heterogeneous mechanisms of elite control even among HIV-specific CTL responses.
Another important finding of this study is the observation that B*57 EC showed significantly reduced VRC compared to B*57 CP. This might be explained by an additional effect of other protective HLA alleles in B*57 EC that may not be present in B*57 CP. However, as reported before, accumulation of compensatory mutations that recover reduced VRC by B*57 CTL escape mutations also is a feasible explanation (10, 15). However, since we observed rare escape variants in many of the B*57 EC (unpublished data), the mechanism of attenuation of viruses in B*57 EC seems more complex. Additional studies are required to reveal the role of such rare mutations in VRC in B*57 EC. Likewise, the difference between non-A*02/B*07/B*57 EC and non-A*02/B*07/B*57 CP might be due to accumulation of compensatory mutations that recover fitness costs by escape mutations, or unique mutations in EC, rather than different HLA allele distribution between EC and CP. Larger data sets may allow this question to be answered.
It has been suggested that EC might acquire viruses with reduced replication capacity at the time of transmission, rather than having these arise in vivo. However, this would not explain the HLA-associated differences in VRC observed in the present study. Therefore, we conclude that the diminished VRC of EC viruses is achieved after transmission rather than transmitted from donors. However, very recently, it was suggested that the subjects considered to have obtained viruses from donors with protective HLA alleles could maintain lower levels of viremia, at least temporarily, after infection (22). It is quite possible that controllers who have strong immune responses obtain further benefit when an attenuated virus is transmitted, and this may further contribute to elite control. In order to clarify this point, longitudinal studies of large numbers of persons in acute infection with diverse set point viral loads will be necessary.
Although gag-protease was the focus of the current study, there remains the possibility that there is dysfunction of other HIV-1 genes that may be associated with elite control. Enrichment in EC of B*51, which contains no Gag CTL epitopes, is a potential example of an allele that modifies VRC via immune-selected mutations in another viral gene. Evaluation of function of other HIV-1 genes is warranted to further understand the mechanisms of elite control.
In conclusion, we observed significantly reduced VRC of chimeric NL4-3 viruses carrying gag-protease genes from HIV EC and found this to be associated with particular HLA class I allele expression. HLA-B*57 displayed the most profound effect on VRC, whereas the more common HLA alleles A*02 and B*07 had the least impact. Non-A*02/B*07 HLA alleles enriched in EC also appear to be able to attenuate Gag-protease function. This differential impact by HLA alleles on VRC of chimeric viruses also indicates that attenuation of gag-protease genes is achieved following transmission. It will be important to generate longitudinal data on acute infection and expand these data sets to further define the role of fitness defects in disease outcome and the potential contribution of class I-restricted selection pressure on other coding regions to viral fitness, which has potential important implications for vaccine design.

ACKNOWLEDGMENTS
We gratefully acknowledge the efforts of the clinical staff
of The International HIV Controllers Study: Erik Berg, Emily
Cutrell, Priscilla Padilla, Almas Rathod, Rachel Rosenberg,
Sue Bazner, Chris Birch, and Kristin Moss. Additionally, we
recognize and thank the laboratory staff: Brett Baker, Alissa
Rothchild, Ildiko Toth, Aisha Darrah, Brooke LaTour, and Agnes
Sarkozi. Finally, we acknowledge the hundreds of providers and
researchers from around the world who have contributed samples
to The International HIV Controllers Study. Success in this
research depends on the efforts and support of healthcare professionals
and researchers who refer subjects from around the world. A
complete list of contributors and collaborators can be found
at
http://www.hivcontrollers.org/index.php?q=contributor/alphalist/A.
We thank Zixin Hu and Daniel Kuritzkes (Brigham and Women's
Hospital) for advice regarding construction of the
gag-protease-deleted
NL4-3 vector.
This work was supported by grants AI028568 and AI030914 from the NIAID/NIH, the Howard Hughes Medical Institute, the Harvard University Center for AIDS Research (CFAR), and a gift from the Mark and Lisa Schwartz Foundation.
The ideas and opinions expressed in the manuscript are solely the responsibility of the authors and are not necessarily shared by the NIH or other funding sources, Massachusetts General Hospital, or its affiliates. The authors declare no conflicts of interest related to this study.

FOOTNOTES
* Corresponding author. Mailing address: Partners AIDS Research Center, Massachusetts General Hospital, 149 13th St., Room 5212, Charlestown, MA 02129. Phone: (617) 724-8332. Fax: (617) 726-4691. E-mail:
bwalker{at}partners.org 
Published ahead of print on 29 October 2008. 

REFERENCES
1 - Altfeld, M., T. M. Allen, E. T. Kalife, N. Frahm, M. M. Addo, B. R. Mothe, A. Rathod, L. L. Reyor, J. Harlow, X. G. Yu, B. Perkins, L. K. Robinson, J. Sidney, G. Alter, M. Lichterfeld, A. Sette, E. S. Rosenberg, P. J. Goulder, C. Brander, and B. D. Walker. 2005. The majority of currently circulating human immunodeficiency virus type 1 clade B viruses fail to prime cytotoxic T-lymphocyte responses against an otherwise immunodominant HLA-A2-restricted epitope: implications for vaccine design. J. Virol. 79:5000-5005.[Abstract/Free Full Text]
2 - Arien, K. K., G. Vanham, and E. J. Arts. 2007. Is HIV-1 evolving to a less virulent form in humans? Nat. Rev. Microbiol. 5:141-151.[CrossRef][Medline]
3 - Bailey, J. R., K. G. Lassen, H. C. Yang, T. C. Quinn, S. C. Ray, J. N. Blankson, and R. F. Siliciano. 2006. Neutralizing antibodies do not mediate suppression of human immunodeficiency virus type 1 in elite suppressors or selection of plasma virus variants in patients on highly active antiretroviral therapy. J. Virol. 80:4758-4770.[Abstract/Free Full Text]
4 - Bailey, J. R., K. O'Connell, H. C. Yang, Y. Han, J. Xu, B. Jilek, T. M. Williams, S. C. Ray, R. F. Siliciano, and J. N. Blankson. 2008. Transmission of human immunodeficiency virus type 1 from a patient who developed AIDS to an elite suppressor. J. Virol. 82:7395-7410.[Abstract/Free Full Text]
5 - Bailey, J. R., T. M. Williams, R. F. Siliciano, and J. N. Blankson. 2006. Maintenance of viral suppression in HIV-1-infected HLA-B*57+ elite suppressors despite CTL escape mutations. J. Exp. Med. 203:1357-1369.[Abstract/Free Full Text]
6 - Ball, S. C., A. Abraha, K. R. Collins, A. J. Marozsan, H. Baird, M. E. Quinones-Mateu, A. Penn-Nicholson, M. Murray, N. Richard, M. Lobritz, P. A. Zimmerman, T. Kawamura, A. Blauvelt, and E. J. Arts. 2003. Comparing the ex vivo fitness of CCR5-tropic human immunodeficiency virus type 1 isolates of subtypes B and C. J. Virol. 77:1021-1038.[CrossRef][Medline]
7 - Blaak, H., M. Brouwer, L. J. Ran, F. de Wolf, and H. Schuitemaker. 1998. In vitro replication kinetics of human immunodeficiency virus type 1 (HIV-1) variants in relation to virus load in long-term survivors of HIV-1 infection. J. Infect. Dis. 177:600-610.[Medline]
8 - Blankson, J. N., J. R. Bailey, S. Thayil, H. C. Yang, K. Lassen, J. Lai, S. K. Gandhi, J. D. Siliciano, T. M. Williams, and R. F. Siliciano. 2007. Isolation and characterization of replication-competent human immunodeficiency virus type 1 from a subset of elite suppressors. J. Virol. 81:2508-2518.[Abstract/Free Full Text]
9 - Borghans, J. A., A. Molgaard, R. J. de Boer, and C. Kesmir. 2007. HLA alleles associated with slow progression to AIDS truly prefer to present HIV-1 p24. PLoS ONE 2:e920.[CrossRef]
10 - Brockman, M. A., A. Schneidewind, M. Lahaie, A. Schmidt, T. Miura, I. Desouza, F. Ryvkin, C. A. Derdeyn, S. Allen, E. Hunter, J. Mulenga, P. A. Goepfert, B. D. Walker, and T. M. Allen. 2007. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. J. Virol. 81:12608-12618.[Abstract/Free Full Text]
11 - Brockman, M. A., G. O. Tanzi, B. D. Walker, and T. M. Allen. 2006. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. J. Virol. Methods 131:134-142.[CrossRef][Medline]
12 - Cao, K., J. Hollenbach, X. Shi, W. Shi, M. Chopek, and M. A. Fernandez-Vina. 2001. Analysis of the frequencies of HLA-A, B, and C alleles and haplotypes in the five major ethnic groups of the United States reveals high levels of diversity in these loci and contrasting distribution patterns in these populations. Hum. Immunol. 62:1009-1030.[CrossRef][Medline]
13 - Carrington, M., G. W. Nelson, M. P. Martin, T. Kissner, D. Vlahov, J. J. Goedert, R. Kaslow, S. Buchbinder, K. Hoots, and S. J. O'Brien. 1999. HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage. Science 283:1748-1752.[Abstract/Free Full Text]
14 - Chopera, D. R., Z. Woodman, K. Mlisana, M. Mlotshwa, D. P. Martin, C. Seoighe, F. Treurnicht, D. A. de Rosa, W. Hide, S. A. Karim, C. M. Gray, and C. Williamson. 2008. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS Pathog. 4:e1000033.[CrossRef][Medline]
15 - Crawford, H., J. G. Prado, A. Leslie, S. Hue, I. Honeyborne, S. Reddy, M. van der Stok, Z. Mncube, C. Brander, C. Rousseau, J. I. Mullins, R. Kaslow, P. Goepfert, S. Allen, E. Hunter, J. Mulenga, P. Kiepiela, B. D. Walker, and P. J. Goulder. 2007. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. J. Virol. 81:8346-8351.[Abstract/Free Full Text]
16 - Deeks, S. G., and B. D. Walker. 2007. Human immunodeficiency virus controllers: mechanisms of durable virus control in the absence of antiretroviral therapy. Immunity 27:406-416.[CrossRef][Medline]
17 - de la Carriere, L. C., S. Paulous, F. Clavel, and F. Mammano. 1999. Effects of human immunodeficiency virus type 1 resistance to protease inhibitors on reverse transcriptase processing, activity, and drug sensitivity. J. Virol. 73:3455-3459.[Abstract/Free Full Text]
18 - Ferrari, G., W. Neal, A. Jones, N. Olender, J. Ottinger, R. Ha, M. J. McElrath, P. Goepfert, and K. J. Weinhold. 2001. CD8 CTL responses in vaccines: emerging patterns of HLA restriction and epitope recognition. Immunol. Lett. 79:37-45.[CrossRef][Medline]
19 - Frahm, F., C. Linde, and C. Brander. 2007. Identification of HIV-derived, HLA class I restricted CTL epitopes: insights into TCR repertoire, CTL escape and viral fitness, p. 3-28. In B. T. Korber et al. (ed.), HIV molecular immunology 2006/2007. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM.
20 - Furutsuki, T., N. Hosoya, A. Kawana-Tachikawa, M. Tomizawa, T. Odawara, M. Goto, Y. Kitamura, T. Nakamura, A. D. Kelleher, D. A. Cooper, and A. Iwamoto. 2004. Frequent transmission of cytotoxic-T-lymphocyte escape mutants of human immunodeficiency virus type 1 in the highly HLA-A24-positive Japanese population. J. Virol. 78:8437-8445.[Abstract/Free Full Text]
21 - Geldmacher, C., J. R. Currier, E. Herrmann, A. Haule, E. Kuta, F. McCutchan, L. Njovu, S. Geis, O. Hoffmann, L. Maboko, C. Williamson, D. Birx, A. Meyerhans, J. Cox, and M. Hoelscher. 2007. CD8 T-cell recognition of multiple epitopes within specific Gag regions is associated with maintenance of a low steady-state viremia in human immunodeficiency virus type 1-seropositive patients. J. Virol. 81:2440-2448.[Abstract/Free Full Text]
22 - Goepfert, P. A., W. Lumm, P. Farmer, P. Matthews, A. Prendergast, J. M. Carlson, C. A. Derdeyn, J. Tang, R. A. Kaslow, A. Bansal, K. Yusim, D. Heckerman, J. Mulenga, S. Allen, P. J. Goulder, and E. Hunter. 2008. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. J. Exp. Med. 205:1009-1017.[Abstract/Free Full Text]
23 - Goulder, P. J., C. Brander, Y. Tang, C. Tremblay, R. A. Colbert, M. M. Addo, E. S. Rosenberg, T. Nguyen, R. Allen, A. Trocha, M. Altfeld, S. He, M. Bunce, R. Funkhouser, S. I. Pelton, S. K. Burchett, K. McIntosh, B. T. Korber, and B. D. Walker. 2001. Evolution and transmission of stable CTL escape mutations in HIV infection. Nature 412:334-338.[CrossRef][Medline]
24 - Goulder, P. J., R. E. Phillips, R. A. Colbert, S. McAdam, G. Ogg, M. A. Nowak, P. Giangrande, G. Luzzi, B. Morgan, A. Edwards, A. J. McMichael, and S. Rowland-Jones. 1997. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med. 3:212-217.[CrossRef][Medline]
25 - Harrigan, P. R., S. Bloor, and B. A. Larder. 1998. Relative replicative fitness of zidovudine-resistant human immunodeficiency virus type 1 isolates in vitro. J. Virol. 72:3773-3778.[Abstract/Free Full Text]
26 - Iversen, A. K., G. Stewart-Jones, G. H. Learn, N. Christie, C. Sylvester-Hviid, A. E. Armitage, R. Kaul, T. Beattie, J. K. Lee, Y. Li, P. Chotiyarnwong, T. Dong, X. Xu, M. A. Luscher, K. MacDonald, H. Ullum, B. Klarlund-Pedersen, P. Skinhoj, L. Fugger, S. Buus, J. I. Mullins, E. Y. Jones, P. A. van der Merwe, and A. J. McMichael. 2006. Conflicting selective forces affect T cell receptor contacts in an immunodominant human immunodeficiency virus epitope. Nat. Immunol. 7:179-189.[CrossRef][Medline]
27 - Kelleher, A. D., C. Long, E. C. Holmes, R. L. Allen, J. Wilson, C. Conlon, C. Workman, S. Shaunak, K. Olson, P. Goulder, C. Brander, G. Ogg, J. S. Sullivan, W. Dyer, I. Jones, A. J. McMichael, S. Rowland-Jones, and R. E. Phillips. 2001. Clustered mutations in HIV-1 gag are consistently required for escape from HLA-B27-restricted cytotoxic T lymphocyte responses. J. Exp. Med. 193:375-386.[Abstract/Free Full Text]
28 - Kiepiela, P., K. Ngumbela, C. Thobakgale, D. Ramduth, I. Honeyborne, E. Moodley, S. Reddy, C. de Pierres, Z. Mncube, N. Mkhwanazi, K. Bishop, M. van der Stok, K. Nair, N. Khan, H. Crawford, R. Payne, A. Leslie, J. Prado, A. Prendergast, J. Frater, N. McCarthy, C. Brander, G. H. Learn, D. Nickle, C. Rousseau, H. Coovadia, J. I. Mullins, D. Heckerman, B. D. Walker, and P. Goulder. 2007. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nat. Med. 13:46-53.[CrossRef][Medline]
29 - Leslie, A., D. Kavanagh, I. Honeyborne, K. Pfafferott, C. Edwards, T. Pillay, L. Hilton, C. Thobakgale, D. Ramduth, R. Draenert, S. Le Gall, G. Luzzi, A. Edwards, C. Brander, A. K. Sewell, S. Moore, J. Mullins, C. Moore, S. Mallal, N. Bhardwaj, K. Yusim, R. Phillips, P. Klenerman, B. Korber, P. Kiepiela, B. Walker, and P. Goulder. 2005. Transmission and accumulation of CTL escape variants drive negative associations between HIV polymorphisms and HLA. J. Exp. Med. 201:891-902.[Abstract/Free Full Text]
30 - Leslie, A. J., K. J. Pfafferott, P. Chetty, R. Draenert, M. M. Addo, M. Feeney, Y. Tang, E. C. Holmes, T. Allen, J. G. Prado, M. Altfeld, C. Brander, C. Dixon, D. Ramduth, P. Jeena, S. A. Thomas, A. St. John, T. A. Roach, B. Kupfer, G. Luzzi, A. Edwards, G. Taylor, H. Lyall, G. Tudor-Williams, V. Novelli, J. Martinez-Picado, P. Kiepiela, B. D. Walker, and P. J. Goulder. 2004. HIV evolution: CTL escape mutation and reversion after transmission. Nat. Med. 10:282-289.[CrossRef][Medline]
31 - Lucas, G. M. 2005. Antiretroviral adherence, drug resistance, viral fitness and HIV disease progression: a tangled web is woven. J. Antimicrob. Chemother. 55:413-416.[Abstract/Free Full Text]
32 - Marozsan, A. J., D. M. Moore, M. A. Lobritz, E. Fraundorf, A. Abraha, J. D. Reeves, and E. J. Arts. 2005. Differences in the fitness of two diverse wild-type human immunodeficiency virus type 1 isolates are related to the efficiency of cell binding and entry. J. Virol. 79:7121-7134.[Abstract/Free Full Text]
33 - Martinez-Picado, J., J. G. Prado, E. E. Fry, K. Pfafferott, A. Leslie, S. Chetty, C. Thobakgale, I. Honeyborne, H. Crawford, P. Matthews, T. Pillay, C. Rousseau, J. I. Mullins, C. Brander, B. D. Walker, D. I. Stuart, P. Kiepiela, and P. Goulder. 2006. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J. Virol. 80:3617-3623.[Abstract/Free Full Text]
34 - Martinez-Picado, J., A. V. Savara, L. Sutton, and R. T. D'Aquila. 1999. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J. Virol. 73:3744-3752.[Abstract/Free Full Text]
35 - Matthews, P. C., A. Prendergast, A. Leslie, H. Crawford, R. Payne, C. Rousseau, M. Rolland, I. Honeyborne, J. Carlson, C. Kadie, C. Brander, K. Bishop, N. Mlotshwa, J. I. Mullins, H. Coovadia, T. Ndung'u, B. D. Walker, D. Heckerman, and P. J. Goulder. 2008. Central role of reverting mutations in HLA associations with human immunodeficiency virus viral set point. J. Virol. 82:8548-8559.[Abstract/Free Full Text]
36 - Miura, T., M. A. Brockman, C. J. Brumme, Z. L. Brumme, J. M. Carlson, F. Pereyra, A. Trocha, M. M. Addo, B. L. Block, A. C. Rothchild, B. M. Baker, T. Flynn, A. Schneidewind, B. Li, Y. E. Wang, D. Heckerman, T. M. Allen, and B. D. Walker. 2008. Genetic characterization of human immunodeficiency virus type 1 in elite controllers: lack of gross genetic defects or common amino acid changes. J. Virol. 82:8422-8430.[Abstract/Free Full Text]
37 - Navis, M., I. Schellens, D. van Baarle, J. Borghans, P. van Swieten, F. Miedema, N. Kootstra, and H. Schuitemaker. 2007. Viral replication capacity as a correlate of HLA B57/B5801-associated nonprogressive HIV-1 infection. J. Immunol. 179:3133-3143.[Abstract/Free Full Text]
38 - Pereyra, F., M. M. Addo, D. E. Kaufmann, Y. Liu, T. Miura, A. Rathod, B. Baker, A. Trocha, R. Rosenberg, E. Mackey, P. Ueda, Z. Lu, D. Cohen, T. Wrin, C. J. Petropoulos, E. S. Rosenberg, and B. D. Walker. 2008. Genetic and immunologic heterogeneity among persons who control HIV infection in the absence of therapy. J. Infect. Dis. 197:563-571.[CrossRef][Medline]
39 - Quinones-Mateu, M. E., S. C. Ball, A. J. Marozsan, V. S. Torre, J. L. Albright, G. Vanham, G. van Der Groen, R. L. Colebunders, and E. J. Arts. 2000. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J. Virol. 74:9222-9233.[Abstract/Free Full Text]
40 - Rangel, H. R., J. Weber, B. Chakraborty, A. Gutierrez, M. L. Marotta, M. Mirza, P. Kiser, M. A. Martinez, J. A. Este, and M. E. Quinones-Mateu. 2003. Role of the human immunodeficiency virus type 1 envelope gene in viral fitness. J. Virol. 77:9069-9073.[Abstract/Free Full Text]
41 - Schneidewind, A., M. A. Brockman, R. Yang, R. I. Adam, B. Li, S. Le Gall, C. R. Rinaldo, S. L. Craggs, R. L. Allgaier, K. A. Power, T. Kuntzen, C. S. Tung, M. X. LaBute, S. M. Mueller, T. Harrer, A. J. McMichael, P. J. Goulder, C. Aiken, C. Brander, A. D. Kelleher, and T. M. Allen. 2007. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. J. Virol. 81:12382-12393.[Abstract/Free Full Text]
42 - Schneidewind, A., M. A. Brockman, J. Sidney, Y. E. Wang, H. Chen, T. J. Suscovich, B. Li, R. I. Adam, R. L. Allgaier, B. R. Mothe, T. Kuntzen, C. Oniangue-Ndza, A. Trocha, X. G. Yu, C. Brander, A. Sette, B. D. Walker, and T. M. Allen. 2008. Structural and functional constraints limit options for cytotoxic T-lymphocyte escape in the immunodominant HLA-B27-restricted epitope in human immunodeficiency virus type 1 capsid. J. Virol. 82:5594-5605.[Abstract/Free Full Text]
43 - Storey, J. D., and R. Tibshirani. 2003. Statistical significance for genomewide studies. Proc. Natl. Acad. Sci. USA 100:9440-9445.[Abstract/Free Full Text]
44 - Troyer, R. M., K. R. Collins, A. Abraha, E. Fraundorf, D. M. Moore, R. W. Krizan, Z. Toossi, R. L. Colebunders, M. A. Jensen, J. I. Mullins, G. Vanham, and E. J. Arts. 2005. Changes in human immunodeficiency virus type 1 fitness and genetic diversity during disease progression. J. Virol. 79:9006-9018.[Abstract/Free Full Text]
45 - Zuniga, R., A. Lucchetti, P. Galvan, S. Sanchez, C. Sanchez, A. Hernandez, H. Sanchez, N. Frahm, C. H. Linde, H. S. Hewitt, W. Hildebrand, M. Altfeld, T. M. Allen, B. D. Walker, B. T. Korber, T. Leitner, J. Sanchez, and C. Brander. 2006. Relative dominance of Gag p24-specific cytotoxic T lymphocytes is associated with human immunodeficiency virus control. J. Virol. 80:3122-3125.[Abstract/Free Full Text]
Journal of Virology, January 2009, p. 140-149, Vol. 83, No. 1
0022-538X/09/$08.00+0 doi:10.1128/JVI.01471-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Nou, E., Zhou, Y., Nou, D. D., Blankson, J. N.
(2009). Effective Downregulation of HLA-A*2 and HLA-B*57 by Primary Human Immunodeficiency Virus Type 1 Isolates Cultured from Elite Suppressors. J. Virol.
83: 6941-6946
[Abstract]
[Full Text]
-
Miura, T., Brumme, C. J., Brockman, M. A., Brumme, Z. L., Pereyra, F., Block, B. L., Trocha, A., John, M., Mallal, S., Harrigan, P. R., Walker, B. D.
(2009). HLA-Associated Viral Mutations Are Common in Human Immunodeficiency Virus Type 1 Elite Controllers. J. Virol.
83: 3407-3412
[Abstract]
[Full Text]
-
Miura, T., Brockman, M. A., Schneidewind, A., Lobritz, M., Pereyra, F., Rathod, A., Block, B. L., Brumme, Z. L., Brumme, C. J., Baker, B., Rothchild, A. C., Li, B., Trocha, A., Cutrell, E., Frahm, N., Brander, C., Toth, I., Arts, E. J., Allen, T. M., Walker, B. D.
(2009). HLA-B57/B*5801 Human Immunodeficiency Virus Type 1 Elite Controllers Select for Rare Gag Variants Associated with Reduced Viral Replication Capacity and Strong Cytotoxic T-Lymphotye Recognition. J. Virol.
83: 2743-2755
[Abstract]
[Full Text]