Previous Article | Next Article ![]()
Journal of Virology, May 2008, p. 4275-4283, Vol. 82, No. 9
0022-538X/08/$08.00+0 doi:10.1128/JVI.02249-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Wentao Qiao,
Jian Wang,
Fengwen Xu,
Yue Li,
Jun Zhou,
Qimin Chen, and
Yunqi Geng*
Key Laboratory of Molecular Microbiology and Biotechnology (Ministry of Education) and Key Laboratory of Microbial Functional Genomics (Tianjin), College of Life Sciences, Nankai University, Tianjin 300071, China
Received 17 October 2007/ Accepted 16 February 2008
|
|
|---|
|
|
|---|
The gene that encodes IFP35 (interferon-induced 35-kDa protein), an interferon-induced protein, was first isolated through differential screening of a cDNA library from HeLa cells that were treated with gamma interferon (3). IFP35 can be induced by alpha/beta-interferon in various cells, including fibroblasts, monocytes/macrophages, and epithelial cells. It can translocate from the cytoplasm to the nucleus upon interferon stimulation (3). IFP35 contains a unique N-terminal leucine zipper motif, but it lacks the basic domain that is crucial for DNA binding. Its C terminus has two tandem Nmi/IFP35 homology domains (NIDs). IFP35 can homodimerize in vitro and can be stabilized by Nmi (N-Myc-interacting protein) through heterodimerization. It can also interact with CKIP-1 (casein kinase 2-interacting protein-1) (40) and B-ATF (basic leucine zipper transcription factor, ATF-like) (37). These protein-protein interactions suggest a potential role for IFP35 in apoptosis and other cytokine-signaling pathways.
Foamy viruses (FVs), also known as spumaretroviruses, are complex retroviruses which compose the only genus in the Spumaretrovirinae subfamily of the Retroviridae. These viruses can infect humans and monkeys as well as many other mammals (such as cattle, cats, and horses). Infection leads to lifelong latency in almost all organs, without detectable viral replication. FVs are unique among the retroviruses in certain aspects, such as their forming a separate pol mRNA, having an infectious DNA genome, and encoding two functional promoters, the long terminal repeat (LTR) and the internal promoter. The transactivator protein (Tas) of FV acts as the key regulator of viral replication and gene expression. Tas is a DNA binding protein that can transactivate both the LTR and the internal promoter by specifically binding to transactivation-responsive elements (19, 21).
Interferons are believed to play a protective role against the lytic replication of prototype FV (PFV) by inhibiting the synthesis of viral proteins and RNAs (33). Gamma interferon plays an important role in controlling FV replication to nonpathogenic levels in vitro (13). Regad et al. reported that PML could inhibit the replication of PFV by interfering with Tas (31). However, a later study by Meiering and Linial found that the endogenous PML did not play an important role in PFV latency in vitro (25). The replication of PFV was found to occur in the presence of substantial PML, either in fully permissive cells or during the reactivation of latent PFV. Therefore, there must be some other unknown factors that play more-important roles in inhibiting PFV.
In this study, we provide evidence that IFP35 plays a key role in the interferon-mediated anti-FV response. IFP35 was identified as a novel bovine Tas (BTas)-interacting protein via yeast two-hybrid screening. Overexpression of IFP35 not only can down-regulate the transactivation ability of BTas and Tas but also can efficiently inhibit the replication of bovine FV (BFV) and PFV. These results indicate that IFP35 may represent a novel pathway in the antiviral action of interferon.
|
|
|---|
133-183aa), pCMV-BTas (
167-183aa), pEGFP-BTas (90-183aa), pEGFP-BTas (1-167aa), and pEGFP-BTas (167-249aa) vectors were constructed by inserting an individual PCR fragment into a pcDNA3.1 (+) or pEGFP-N1 vector. pCMV-AD-BTas (1-133aa) and pCMV-AD-IFP35 were subcloned into a pCMV-AD (Stratagene) vector. The sequences of all of the new constructs were confirmed by sequencing. Cells, reagent, and viruses. 293T, HeLa, fetal bovine lung (FBL), CV-1, and BFV indicator cell line (BICL) cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 50 IU/ml penicillin, and 50 µg/ml streptomycin at 37°C in humidified air with 5% CO2. Anti-Flag M2 monoclonal antibody (MAb), antitubulin MAb, and anti-Myc rabbit antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The antibodies to BTas and IFP35 were produced by the immunization of mice and purified according to a standard protocol. Protein A beads and anti-β-actin MAb were purchased from Sigma-Aldrich. BFV3026 was isolated from peripheral lymphoid cells by us in 1993.
Yeast two-hybrid screening. A fragment of BTas containing residues 1 to 183 was cloned into pGBKT7 (Clontech) and used as the bait. The screening was performed by using the human B-cell cDNA library (a gift from Charles Wood). Clontech's Matchmaker GAL4 two-hybrid system 3 (PT3247-1) was used according to the manufacturer's instructions. Among 1 x 107 cDNA clones screened, 50 clones were identified as partners that interact with BTas containing amino acids (aa) 1 to 183 [BTas (1-183aa)]. One of the candidates encodes the N-terminally truncated IFP35 in which aa 1 to 91 are deleted [IFP35 (92-288aa)].
Immunoprecipitation. Cultures of 293T cells in 100-mm-diameter dishes were transfected with various combinations of plasmids using the polyethyleneimine reagent (9). Forty-eight hours following transfection, cells were harvested and washed twice with phosphate-buffered saline (PBS). The cells were lysed in 1 ml lysis buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 1% NP-40, 0.2% sodium dodecyl sulfate [SDS], and 1 mM phenylmethylsulfonyl fluoride), sonicated, and centrifuged at 4°C (10,000 x g, 15 min). The supernatant (500 µl) was incubated with the antibody indicated in Fig. 1 at 4°C for 2 h. The protein A-Sepharose (50%, 25 µl) equilibrated in lysis buffer was then added, and the mixture was incubated for an additional 2 h. Immunocomplexes were washed five times with the lysis buffer, boiled in 35 µl of 2x Laemmli buffer, electrophoresed on 12% SDS-polyacrylamide gels, and then subjected to Western blotting.
![]() View larger version (30K): [in a new window] |
FIG. 1. Identification of the BTas domain responsible for binding to IFP35. (A) Schematic representation of BTas and deletion mutants. (B, C, and D) Myc-IFP35 was transiently transfected into 293T cells together with the indicated BTas wild type or truncation mutants. BTas proteins were immunoprecipitated (IP) (anti-BTas) and immunoblotted with the antibodies indicated on the left side of each blot. , anti. (E) HeLa cells were transfected with Myc-BTas. Forty-eight hours later, the cell lysates were incubated with control mouse immunoglobulin G (IgG) or mouse anti-IFP35 antibody. The immunoprecipitated proteins were immunoblotted with the indicated antibodies.
|
Subcellular localization. HeLa and 293T cells were grown on coverslips and cotransfected 24 h later with 0.2 µg of pcDNA3.1 (+) or pCMV-BTas and 0.5 µg of pMyc-IFP35. Forty-eight hours later, cells were fixed in 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. Indirect immunofluorescence was carried out by using the anti-BTas and anti-Myc antibodies and the Texas Red-conjugated goat anti-rabbit (Molecular Probes) and fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse (Dako) secondary antibodies. Cellular nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). Fluorescence microscopy was carried out by using an Olympus fluorescence microscope.
FV-activated GFP assay. BHK21 cells were transfected with the green fluorescent protein (GFP) gene that was driven by the BFV LTR for establishing an indicator cell line named BICL. BICL cells were plated in six-well plates at a density of 2 x 105 cells per well. After 24 h, the BICL cells were incubated with 1/20 of the infected HeLa or 293T cells (1 x 104), which were infected by means of the coculture method. Cellular fluorescence was observed after 48 h, and the GFP-positive cells were counted. After we monitored the level of fluorescence, the BICL cells were trypsinized and counted with a hemocytometer. Total cells were counted under an inverted light microscope and the GFP-positive cells under an inverted fluorescence microscope. The percentage of GFP-positive cells was calculated based on these numbers.
IFP35 siRNA. Three small interfering RNA (siRNA) oligonucleotides derived from the human IFP35 RNA sequence were designed to contain a sense strand of 21 nucleotides of the IFP35 gene. The three sequences were cloned into the pBS/U6 vector (a gift from Yang Shi) by following the manufacturer's instructions and confirmed by sequencing. One sequence from the three sequences was selected for stable transfection (oligonucleotide 1, GGAGATCCAGAAGGCTGAGAAAGCTTTCTCAGCCTTCTGGATCTCCCTTTTTG, and oligonucleotide 2, AATTCAAAAAGGGAGATCCAGAAGGCTGAGAAAGCTTTCTCAGCCTTCTGGATCTCC). pBS/U6-siCRLF3 was a gift from Li Liu and used as a negative control (39). The pBS/U6-siIFP35 plasmids were transfected into 293T or HeLa cells, and IFP35 expression was assayed by immunoblotting or fluorescence microscopy. Twenty-four hours after the siRNA transfection, BFV3026 was added to infect the cells, and FV replication was assessed 96 h later by enhanced-GFP (EGFP) expression through coculture with BICL cells.
EMSA. 293T cells were transfected with the empty vector, BTas alone, IFP35 alone, or BTas and IFP35. Two days later, the cells were lysed in 0.3 M NaCl for 30 min at 4°C, sonicated, and harvested by centrifugation at 14,000 x g. The supernatants were then aliquoted and kept at –70°C. The BFV LTR was synthesized with the oligonucleotide BFV LTR (795 to 816) sense (5'-ATAGCTATTTTAGTAAGTTAGC-3'). Position 1 is defined in this paper as the first nucleotide of the BFV proviral genome (GenBank accession no. AY 134750). Probes were purified, digitonin labeled, and used in electrophoretic mobility shift assays (EMSA) with a DIG gel shift kit (Roche).
|
|
|---|
To identify the specific binding region of BTas for IFP35, a series of Flag-BTas deletion mutants (Fig. 1A) were constructed and cotransfected with Myc-tagged IFP35. As shown in Fig. 1B, all of the C-terminally truncated mutants, including BTas (1-183aa) and BTas (1-217aa), retained the same ability to bind IFP35 as that of the wild-type protein. These results suggested that the IFP35 binding domain was not located in the activation domain (AD) (aa 184 to 249). The binding region was defined as BTas (133-183aa), since BTas (1-167aa) and BTas (
133-183aa) could not bind to IFP35 and BTas (
167-183aa) bound weakly, while BTas (167-249aa) and BTas (90-183aa) remained full binding ability (Fig. 1C and D). We also found that endogenous IFP35 coimmunoprecipitated with Myc-BTas in HeLa cells (Fig. 1E). To map the BTas binding domain in IFP35, a series of Flag-IFP35 deletion mutants (Fig. 2A) were constructed and cotransfected with Myc-BTas. We found that IFP35 without its N-terminal leucine zipper domain retained the ability to bind to BTas, while IFP35 without NID2 did not (Fig. 2B). Therefore, BTas-IFP35 complex formation is specific and depends on the presence of NID2.
![]() View larger version (24K): [in a new window] |
FIG. 2. Identification of the IFP35 domain responsible for binding to BTas. (A) Schematic representations of IFP35 and deletion mutants. WT, wild type; L-zip, leucine zipper. (B) Myc-BTas was transiently transfected into 293T cells together with the indicated IFP35 wild type or truncation mutants. IFP35 proteins were immunoprecipitated (IP) (anti-IFP35) and immunoblotted with the antibodies indicated on the left side of each blot. , anti.
|
![]() View larger version (27K): [in a new window] |
FIG. 3. Overexpression of IFP35 confers resistance to BFV infection. (A) 293T cells were transfected with the empty vector or IFP35 and then infected with BFV. After 96 h of indirect immunofluorescence, microscopy was performed using rabbit anti-Myc antibody ( -Myc) visualized with Texas Red and the mouse anti-Gag antibody followed by FITC labeling. (B) 293T cells were transfected with 0.5 µg pcDNA3.1 (+) (gray bars) or 0.5 µg pCMV-BTas (black bars). After the transfection (24 h later), cells were infected by BFV3026. After 96 h, 1/20 of the cells were cocultured with BICL (BFV indicator cell line) and observed after 48, 72, and 96 h. EGFP-positive cells were observed with an Olympus fluorescence microscope and counted. (C) HeLa cells were transfected with 0.5 µg pcDNA3.1 (+) (gray bars) or 0.5 µg pCMV-BTas (black bars). After the transfection (24 h later), cells were infected by BFV3026. After 96 h, 1/20 of the cells were cocultured with BICL and observed after 48, 72, and 96 h and EGFP-positive cells were observed and counted. (D) Total RNAs of 293T and HeLa cells were extracted, and an equal amount of RNA was amplified by reverse transcription-PCR (RT-PCR) by using primers specific for IFP35 and for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal control, respectively. (E) Equal numbers of 293T and HeLa cells were lysed and immunoblotted with anti-IFP35 antibody. The same blots were reprobed with anti-actin antibody. WB, Western blotting. (F) Equal numbers of 293T and HeLa cells were infected with BFV (the same titer). After 96 h, the cell lysates were immunoblotted with anti-Gag antibody. The same blots were reprobed with anti-actin antibody.
|
Intracellular localization of BFV BTas and IFP35. We next investigated the molecular mechanism involved in IFP35's inhibition of BFV replication. Using indirect immunofluorescence, BTas was found to accumulate predominantly in the nucleus, while IFP35 displayed a clear cytoplasmic distribution in HeLa cells (Fig. 4A) and 293T cells (Fig. 4C) cells when each was expressed alone. We next examined the localization of the two proteins when they were coexpressed. Interestingly, different results were seen for the two cell lines. In HeLa cells, there appeared to be high expression of BTas and IFP35 in both the nucleus and the cytoplasm (Fig. 4B). In contrast, IFP35 relocalizes to the nucleus along with BTas in 293T cells (Fig. 4D). These results suggest that the expression of BTas could induce a redistribution of IFP35 from the cytoplasm to the nucleus in 293T cells through a direct protein-protein interaction. This result may explain the discrepancy in results obtained with HeLa and 293T cells (Fig. 3B and C).
![]() View larger version (38K): [in a new window] |
FIG. 4. Intracellular localization of BFV BTas and IFP35. Indirect immunofluorescence was used to localize BTas (with mouse anti-BTas antibody and FITC-conjugated rabbit anti-mouse secondary antibody) and IFP35 (with rabbit anti-Myc antibody and Texas Red-conjugated goat anti-rabbit secondary antibody). Nuclei were visualized with DAPI stain. (A) Individual expression of BTas or Myc-IFP35 in HeLa cells. (B) Coexpression of BTas and Myc-IFP35 in HeLa cells. The merged images show the colocalization of BTas and IFP35 (yellow). (C) Individual expression of BTas or Myc-IFP35 in 293T cells. (D) Coexpression of BTas and Myc-IFP35 in 293T cells. The merged images show the colocalization of BTas and IFP35 (yellow). In about 80% of cells, coexpression of both proteins resulted in a distinct redistribution of IFP35 to the nucleus, with only weak expression of IFP35 in the cytoplasm.
|
![]() View larger version (20K): [in a new window] |
FIG. 5. IFP35 inhibits BTas-mediated BFV LTR transcriptional activation. (A) 293T cells were transfected with 0.1 µg of the reporter plasmid pLTR-luc and 0.01 µg of pCMV β-gal, with or without 0.2 µg of pCMV-BTas and 0, 0.1, 0.2, 0.3, 0.4, or 0.5 µg of pCMV-IFP35. Luciferase activities were measured as described in Materials and Methods. The bottom rows of panels A and B show a Western blot from aliquots of the cells indicating the level of BTas expression. , anti. (B) HeLa cells were transfected with 0.1 µg of the reporter plasmid pLTR-luc and 0.05 µg of pCMV β-gal, combined with 0.2 µg of pCMV-BTas and 0, 0.1, 0.2, or 0.5 µg of pCMV-IFP35. Luciferase activities were measured. (C) 293T cells were transfected with 0.1 µg of the reporter plasmid pLTR-luc and 0.01 µg of pCMV β-gal in combination with 0.2 µg of pCMV-BTas and 0.5 µg of pCMV-IFP35, pCMV-IFP35 (92-288aa), or pCMV-IFP35 (1-170aa). The expression of IFP35 in the transfected cells was monitored by Western blotting (at the bottom). All transfections were performed in triplicate.
|
Knockdown of endogenous IFP35 by siRNA promotes BTas-induced BFV LTR activation.
We have shown above that the overexpression of IFP35 has no inhibitory effect on the BTas-induced BFV LTR activation or replication of BFV in HeLa cells, which contain more endogenous IFP35 than do 293T cells. Thus, endogenous IFP35 may play an important role in the replication of FV. To examine this more closely, RNA interference analysis with IFP35-specific oligonucleotides was performed. First, pBS/U6-siIFP35 (encoding IFP35 siRNA), pBS/U6-siCRLF3 (encoding a control siRNA), and pBS/U6 (the empty vector) were each cotransfected with EGFP-IFP35 into 293T cells. Both fluorescence microscopy (Fig. 6A) and Western blotting (Fig. 6B) showed that the expression of IFP35 was significantly reduced with pBS/U6-siIFP35 compared to that with the two controls. These results suggested that pBS/U6-siIFP35 could effectively inhibit the overexpressed IFP35. The efficiency of pBS/U6-siIFP35 in depleting endogenous IFP35 was also examined in HeLa cells. The expression of IFP35 was significantly knocked down in the siIFP35-transfected HeLa cells, while transfection with either pBS/U6 or pBS/U6-siCRLF3 had no effect (Fig. 6C). HeLa cells were transfected with BFV LTR-luc or a luc plasmid containing three copies of NF-
B binding site [pNF-
B (3x)-luc] and BTas in the presence or absence of pBS/U6-siIFP35 plasmids to determine whether BFV LTR or NF-
B activation would be enhanced by depleting endogenous IFP35. NF-
B was examined because the BFV LTR contains an NF-
B binding site and BTas can stimulate the NF-
B pathway in HeLa cells. Luciferase assays showed that the induction of the BFV LTR promoter in the siIFP35-transfected cells increased but that BTas-induced NF-
B activation was not affected (Fig. 6D). These results suggest that the inhibition of IFP35 is specific to the BFV LTR and independent of the NF-
B signal pathway. We next transfected HeLa cells with the pBS/U6-siIFP35, pBS/U6-siCRLF3, or pBS/U6 plasmid and then infected the cells with BFV. After 96 h, the transfected cells were cocultured with BICL indicator cells. The siIFP35-transfected cells showed about a twofold increase in viral titer (Fig. 6E), supporting the idea that endogenous IFP35 inhibits BFV replication in HeLa cells.
![]() View larger version (39K): [in a new window] |
FIG. 6. Knockdown of endogenous IFP35 by siRNA-promoted, BTas-induced BFV LTR activation. (A and B) 293T cells were cotransfected with pEGFP-IFP35 and pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 48 h, fluorescence microscopy was performed (A), and equal numbers of cell lysates were immunoblotted with the indicated antibodies (B). (C) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 48 h, equal numbers of cell lysates were immunoblotted with the indicated antibodies. (D) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 24 h, pLTR-luc or pNF- B (3x)-luc and pCMV β-gal, along with pCMV-BTas or pcDNA3.1 (+), were introduced. Luciferase activities were measured after 96 h. (E) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3 and then infected by BFV3026 (24 h later). After 96 h, 1/20 of the cells were cocultured with BICL cells, and EGFP-positive cells were observed and counted after 48 h. All experiments were performed in triplicate. , anti.
|
![]() View larger version (36K): [in a new window] |
FIG. 7. IFP35 does not inhibit the binding of BTas to the BFV LTR. (A) EMSA were performed with extracts from 293T cells that had been transfected with either the empty vector, BTas, IFP35, or BTas and IFP35. Digitonin-labeled sequences derived from the BFV LTR were used as the probe. (B) Equivalent aliquots from EMSA samples were analyzed by Western blotting and visualized using anti-BTas and anti-IFP35 antibodies. (C) 293T cells were transfected with BTas (1-133aa), IFP35, the GAL4-binding domain controlled by the immediate early promoter of cytomegalovirus (CMV-BD), CMV-BD-BTas (1-133aa) or CMV-AD-IFP35, and pLTR-luc and pCMV β-gal. After 48 h of transfection, luciferase activities were measured. , anti.
|
IFP35 inhibits Tas-induced PFV LTR activation. To determine whether our findings on the inhibition of Tas activity by IFP35 could be extended to other FVs, we examined whether Tas from PFV can interact with IFP35. At 48 h after cotransfection of 293T cells with Myc-tagged IFP35 and PFV Flag-tagged Tas, cell extracts were immunoprecipitated using anti-Flag antibody. Precipitated proteins were resolved by SDS-polyacrylamide gel electrophoresis and analyzed by Western blotting using the anti-Myc and anti-Flag antibodies. Myc-IFP35 was observed to bind to Flag-Tas (Fig. 8A). Similar data were obtained when the samples were immunoprecipitated with the anti-IFP35 antibody and analyzed by the anti-Flag antibody (Fig. 8A). 293T cells were transfected with a luciferase reporter plasmid under the control of the PFV LTR and increasing amounts of IFP35, with or without Tas. Similarly to the results with BFV, IFP35 showed no effect on the basal promoter activity of LTR-luc, but it reduced PFV LTR transactivation by Tas in a dose-dependent manner (Fig. 8B), with a decrease of 84% using 500 ng of IFP35-encoding plasmid.
![]() View larger version (33K): [in a new window] |
FIG. 8. IFP35 inhibits Tas-induced PFV LTR activation. (A) Myc-IFP35 was transfected into 293T cells together with Flag-Tas or the empty vector. Proteins were immunoprecipitated and immunoblotted with the antibodies indicated above the blots and immunoblotted with the antibodies indicated on the left side of each blot. , anti. (B) 293T cells were transfected with 0.1 µg reporter PFV pLTR-luc and 0.01 µg pCMV β-gal, with 0.2 µg pCMV-Tas and 0, 0.1, 0.2, or 0.5 µg pCMV-IFP35 as indicated. Luciferase activities were measured. All transfections were performed in triplicate.
|
|
|
|---|
Some proteins that dimerize via their leucine zipper motif but lack a basic region for binding DNA have been found to be negative regulators of transcription (4). It was suggested that IFP35 might be a negative transcriptional regulator, since it contains this kind of unique N-terminal leucine zipper motif (3). However, there is no experimental evidence that IFP35 perturbs gene transcription, even though IFP35 has been found to interact with two leucine zipper proteins, CKIP-1 and B-ATF (37, 40). In this report, we show using transactivation assays with 293T cells that IFP35 can reduce BTas-dependent activation of the BFV LTR in a dose-dependent manner. This inhibition requires both NID2, which is necessary for the formation of an IFP35-BTas complex, and the N-terminal leucine zipper motif. This result provides evidence for the idea that the N-terminal leucine zipper motif of IFP35 is a negative regulator of transcription. In addition, our EMSA results show that IFP35 neither directly binds to the BFV LTR nor inhibits the binding of BTas to the BFV LTR. Because the interaction domain in BTas that binds to IFP35 is near the activation domain of BTas, IFP35 may inhibit BTas-induced transactivation by interfering with the interaction of a cellular transcriptional activation factor(s) and BTas.
As an early response to viral infections, cells produce a spectrum of early inflammatory proteins that can activate cytolytic functions of T cells or directly inhibit viral replication. Latent transcription factors in the cytoplasm of these cells respond to external signals and subsequently transmit them to the nucleus. For example, steroid receptors (8) and caspase-activated DNase (10) can receive an activating signal in the cytoplasm and rapidly shuttle into the nucleus. Other diverse transcription factor families, including the interferon regulatory factor (IRF) (32), the signal transducer and activator of transcription (STAT) (7), the NF-
B (15, 16), and the nuclear factor of activated T cells (NFAT) (6) families, can also respond to the external signals in the same way. The functional diversity of such transcription factors depends upon modifications (such as phosphorylation) and/or interactions with other transcription factors that are coexpressed and/or activated in the infected cells (34, 36). In this study, we observed a cytoplasm-to-nucleus translocation of IFP35 when it was coexpressed with BTas. A similar cytoplasm-to-nucleus translocation of IFP35 was reported when IFP35 was induced by the interferon treatment (3). We believe that this redistribution is necessary for the biological function of IFP35. Our results suggest that BTas could act as a chaperone for the nuclear entry of IFP35 by direct interaction.
The different inhibitory effects of IFP35 on BFV in HeLa and 293T cells may be caused by the level of endogenous IFP35, which is at a higher level in HeLa cells than in 293T cells (3, 5). We believe that endogenous IFP35 plays a more important role in inhibiting BFV in HeLa cells than in 293T cells. This idea is supported by the increase in BFV LTR-driven activation after the repression of endogenous IFP35 by RNAi. Thus, endogenous IFP35 might account for the low activation of BFV in HeLa cells. In addition, very little IFP35 entered the nucleus when BTas and IFP35 were cotransfected into HeLa cells, which is different from the results with 293T cells. Coupled with the high level of endogenous IFP35, this may explain why overexpressed IFP35 did not inhibit BFV replication in HeLa cells.
Most retroviruses cause disease after infecting natural or accidental hosts. The genomic organization of FVs shows striking similarity to those of other retroviruses, especially human T-cell leukemia virus type I and human immunodeficiency virus type 1. In addition, FVs share many characteristics with the human pathogen hepatitis B virus, such as reverse transcription late in infection, leading to a DNA genome (23). However, no specific disease related to FVs has been reported (23). Understanding the mechanisms responsible for latent infection induced by FV may yield insight into pathogenesis by other retroviruses. It may also aid in the development of FVs as vectors for gene therapy. In this study, although most the experiments were done in a heterologous system (bovine FV Tas and human IFP35), the Tas-mediated transactivation of either BFV or PFV could be significantly reduced when enough IFP35 was present. Our data suggest that IFP35 could be a general mechanism for inhibiting FV replication.
This work was supported by the National Basic Research Program of China (grant 2005CB522903) and the National Natural Science Foundation of China (grants 30570072 and 30770097).
Published ahead of print on 27 February 2008. ![]()
J.T. and W.Q. contributed equally to this work. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»