This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirai, K.
Right arrow Articles by Meshi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirai, K.
Right arrow Articles by Meshi, T.

 Previous Article  |  Next Article 

Journal of Virology, April 2008, p. 3250-3260, Vol. 82, No. 7
0022-538X/08/$08.00+0     doi:10.1128/JVI.02139-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Antiviral RNA Silencing Is Restricted to the Marginal Region of the Dark Green Tissue in the Mosaic Leaves of Tomato Mosaic Virus-Infected Tobacco Plants{triangledown}

Katsuyuki Hirai,1,2 Kenji Kubota,1,2,{dagger} Tomofumi Mochizuki,3 Shinya Tsuda,3 and Tetsuo Meshi1,4*

Division of Plant Sciences, National Institute of Agrobiological Sciences, Tsukuba 305-8602, Japan,1 Department of Botany, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan,2 National Agricultural Research Center, Tsukuba 305-8666, Japan,3 CREST, Japan Science and Technology Agency, Kawaguchi 322-0012, Japan4

Received 28 September 2007/ Accepted 15 January 2008


arrow
ABSTRACT
 
Mosaic is a common disease symptom caused by virus infection in plants. Mosaic leaves of Tomato mosaic virus (ToMV)-infected tobacco plants consist of yellow-green and dark green tissues that contain large and small numbers of virions, respectively. Although the involvement of RNA silencing in mosaic development has been suggested, its role in the process that results in an uneven distribution of the virus is unknown. Here, we investigated whether and where ToMV-directed RNA silencing was established in tobacco mosaic leaves. When transgenic tobaccos defective in RNA silencing were infected with ToMV, little or no dark green tissue appeared, implying the involvement of RNA silencing in mosaic development. ToMV-related small interfering RNAs were rarely detected in the dark green areas of the first mosaic leaves, and their interior portions were susceptible to infection. Thus, ToMV-directed RNA silencing was not effective there. By visualizing the cells where ToMV-directed RNA silencing was active, it was found that the effective silencing occurs only in the marginal regions of the dark green tissue (~0.5 mm in width) and along the major veins. Further, the cells in the margins were resistant against recombinant potato virus X carrying a ToMV-derived sequence. These findings demonstrate that RNA silencing against ToMV is established in the cells located at the margins of the dark green areas, restricting the expansion of yellow-green areas, and consequently defines the mosaic pattern. The mechanism of mosaic symptom development is discussed in relation to the systemic spread of the virus and RNA silencing.


arrow
INTRODUCTION
 
Mosaic is one of the most representative symptoms of viral infection in plants (15). Mosaic symptoms are characterized by intermingled yellow-green and dark green tissues. Tobacco plants infected with Tobacco mosaic virus (TMV) develop mosaic patterns on systemic leaves that are small or invisible at the time of inoculation. TMV accumulates to high levels in yellow-green tissue, whereas no or only a few TMV particles appear in dark green tissue and tiny dark green islands (DGIs) surrounded by yellow-green tissue (3). The cells of yellow-green tissue are morphologically abnormal, whereas those of dark green tissue are normal. The boundaries between the yellow-green and dark green areas become visible when the leaves are small and remain unchanged throughout the life of the leaf (3). In 1970, Atkinson and Matthews (3) proposed that a diffusible factor, named dark green agent, was responsible for the formation and maintenance of the DGIs on TMV-infected tobacco leaves. Recently, the identity of the dark green agent, the homology-dependent immunity observed in DGIs, and the development of mosaic symptoms have been discussed in the context of RNA silencing (2, 4, 16, 25).

RNA silencing is a small RNA-based system of gene regulation in eukaryotes (10, 40). RNA silencing is induced by double-stranded RNA or by structured single-stranded RNA, which is processed into 21- to 25-nucleotide (nt) small RNA by RNase III-like enzymes such as Dicer and Dicer-like (6, 22). One type of small RNA, called a small interfering RNA (siRNA), is incorporated into an effector complex (i.e., an RNA-induced silencing complex [RISC]) that destroys RNA with complementarity to the siRNA (37). In some organisms, including plants, RNA-dependent RNA polymerase (RdRp) is also involved in RNA silencing, presumably by generating a double-stranded RNA template that is used by Dicer homologs (42). In plants, RNA silencing generates sequence-specific mobile signals that are spread via plasmodesmata and phloem to distant organs, where they establish systemic silencing (28, 38, 41).

Plant viruses are strong inducers and targets of RNA silencing, and many viruses encode silencing suppressors to counteract the antiviral effect of RNA silencing (10). Thus, both RNA silencing and suppressor activity influence the development of disease symptoms. Concerning mosaic disease development, it has been reported that dark green tissue is absent from a TMV-infected transgenic tobacco plant in which RdRp expression (derived from RDR1) is suppressed and that when transgenic Nicotiana benthamiana plants expressing the Potato virus A (a potyvirus)-encoded suppressor HC-Pro are inoculated with Barley stripe mosaic virus (a hordeivirus), no dark green tissue develops in the upper noninoculated leaves, whereas those of the nontransgenic plant develop mosaic symptoms (43, 45).

A separate study reported a recovery phenotype in which transgenic tobacco plants carrying the coat protein (CP) gene from Tobacco etch virus (TEV, a potyvirus) initially exhibited normal symptoms after infection with TEV but subsequently developed asymptomatic leaves (20). Antiviral RNA silencing was shown in the recovered leaves (19, 21). When transgenic N. benthamiana plants carrying a potyvirus gene sequence (from Tamarillo mosaic virus or Potato virus A) are infected with the cognate virus, mosaic symptoms are observed in a few leaves before the development of symptomless leaves (12, 26, 32). Based on these and other data, it has been proposed that the dark green areas are formed in mosaic leaves as a result of localized recovery (11, 26, 45); however, the recovery phenotype is never observed in nontransgenic tobacco plants infected with TEV (20), TMV (3), or Tomato mosaic virus (ToMV) (17), a species of Tobamovirus closely related to TMV. Furthermore, the dark green tissue in the first mosaic leaves of TMV-infected tobacco plants is invaded by the virus and broken down into yellowish tissue, referred to as pseudo-dark green tissue, suggesting that dark green tissue is susceptible to TMV infection (3, 33). Thus, the reported nature of the dark green areas in potyvirus-infected transgenic N. benthamiana does not fully explain the nature of the dark green tissue in tobamovirus-infected tobacco plants.

Here, we focused on ToMV-induced tobacco mosaic disease. Previously, we showed that the ToMV-encoded suppressor inhibits RNA silencing in the yellow-green areas (17); however, it is unclear whether and where ToMV-targeting RNA silencing operates in the dark green areas. To obtain a better understanding of how mosaic patterns are determined during the normal infection process, we sought to clarify where antiviral RNA silencing occurs. Our results indicate that at an early stage of infection, ToMV-directed RNA silencing is established in the margin but not in the interior of the dark green areas to prevent the spread of ToMV from the nearby yellow-green areas, so that the outlines of the mosaic pattern persist for the life of the leaf.


arrow
MATERIALS AND METHODS
 
Viruses, infectious transcripts, and inoculation. Wild-type ToMV was derived from pTLW3, which carries the full-length ToMV (L strain) cDNA (23), and infectious RNA was transcribed in vitro using T7 RNA polymerase (17). ToMV and TMV (OM strain) (27) virions were purified from the inoculated leaves of N. tabacum L. cv. Samsun. Unless otherwise noted, ToMV was inoculated onto the fifth true leaf of each tobacco plant when the eighth true leaf was between 1 and 2 cm in length at a concentration that caused approximately 100 to 150 local necrotic lesions on the corresponding leaves of N. tabacum L. cv. Xanthi nc. The plants were grown at 25°C-22°C (16 h light-8 h dark). Infectious ToMV and potato virus X (PVX) transcripts were derived from MluI-cut pTL-series plasmids and SpeI-cut pTX-series plasmids (see below), respectively. Recombinant PVX was first amplified in N. benthamiana, and leaf homogenates were used to inoculate tobacco plants. In the challenge inoculation experiments with recombinant PVX, wild-type ToMV (diluted 10-fold) was inoculated onto the first and second true leaves of tobacco plants when their third true leaves were just expanding. One week later, recombinant PVX was inoculated onto the fifth true leaves when the plants began to develop mosaic symptoms. Tomato spotted wilt virus (TSWV, ordinary strain) and cucumber mosaic virus (CMV, pepo strain) were described previously (24, 39).

Transgenic plants. G3Sm1 (17) is a transgenic tobacco line that constitutively expresses an endoplasmic reticulum-localized green fluorescent protein (GFP) variant (erG3GFP) (36). G3Sm2 harbors the same GFP gene as G3Sm1, but its expression is silenced posttranscriptionally (17). G3SmL2, which expresses erG3GFP, was generated by transforming Samsun tobacco with Agrobacterium tumefaciens AGL1 harboring pBK-erG3L200 (see below) by a leaf-disk method, essentially as described previously (13). Transgenic tobacco lines in which RDR1 was knocked down and those expressing TSWV NSs or CMV Y 2b were similarly generated using Agrobacterium harboring pBK-RD1IR (see below), pBICNSs (35), and pMD-CMVY2b (see below), respectively. T2 and T3 plants derived from two to four independent lines for each construct were used.

Plasmid construction. The pTLGC30S contains the synthetic oligonucleotide 5'-TGCTGCTGGGATTACACATGGCATGGATGAAATGCA-3' between nt 6187 and 6188 (the NsiI site of pTLW3) of the ToMV L sequence (the underlined sequence was derived from the erG3GFP gene). The 0.2-kb fragment of the ToMV CP gene (corresponding to nt 5901 to 6100) with SacI and SmaI ends was amplified by PCR using pTLW3 as a template and inserted just downstream of the erG3GFP open reading frame (ORF) (at the modified SacI site) of pBI-erG3 (36) to create pBI-erG3L200. The 1.0-kb XbaI-SmaI fragment of pBI-erG3L200 was ligated with the SacI (blunted)-XbaI fragment of pBI121 (Clontech) to create pBK-erG3L200. The red fluorescent protein (RFP) sequence used was identical to that previously reported for monomeric RFP (8). The RFP ORF was designed to avoid rare codons in plants and to mimic the AT content of the ToMV genome. Several oligonucleotides with partial complementarity were synthesized, annealed, amplified by PCR, and cloned into pCR-bluntII-TOPO (Invitrogen) to obtain pCR-R1, which had a 0.8-kb insert with CCTCTAGAGGATCCCCGGGACCATG between the vector and the initiation codon of the RFP ORF (underlined) and TAATAGCCCGGGTCGACTCGAGTGAGCTCGG between the tandem stop codons (underlined) of the RFP ORF and the vector. The 0.8-kb NcoI (blunted)-SalI fragment of pCR-R1 was inserted between the EcoRV and SalI sites of pP2C2S (5) to generate pTX-R1. A 0.2-kb fragment corresponding to a part of the ToMV CP gene (nt 5755 to 5900) with SmaI sites at its ends was amplified and inserted into the XbaI (blunted) site of pCR-R1 to yield pCR-LsD, so that the CP and RFP ORFs were in the same direction. The 0.8-kb ApaI-XhoI (blunted) fragment of pCR-LsD was inserted into the EcoRV site of pP2C2S to obtain pTX-LsD.

A 0.8-kb fragment containing the β-glucuronidase ORF (corresponding to nt 1001 to 1800; DDBJ/EMBL/GenBank accession no. S69414) with XbaI and SpeI sites at its ends was amplified from pBI121 by PCR and cloned into the XbaI and SpeI sites of pBluescript II SK+ (Stratagene) to create pSK-GUS800. A 0.3-kb fragment (corresponding to nt 2440 to 2687 of RDR1) from a cDNA clone was introduced into the filled-in XbaI site of pSK-GUS800 in the sense orientation to create pSK-G8RDR1. The same fragment was also inserted into the SmaI site of pSK-G8RDR1 in the antisense orientation to create pSK-RDR1IR. The 1.2-kb EcoRV-SacI fragment of pSK-RDR1IR was ligated with the 13-kb SmaI-SacI fragment of pBI121 to create pBK-RDR1IR. The 2b ORF (nt 2420 to 2752 of DDBJ/EMBL/GenBank accession no. D12538) of CMV (Y strain) (34) was amplified by reverse transcription (RT)-PCR and cloned between the BamHI and SacI sites of pMD1, a pBI121-based binary vector with a modified cloning site, to create pMD-CMVY2b.

RNA analysis. Total RNA was extracted from tobacco leaves using RNAiso (Takara Bio) for Northern blots or an RNeasy plant minikit (Qiagen) for PCR analysis according to the manufacturers' instructions. To detect the ToMV genome or the GFP mRNA, the total RNA was denatured, separated on 1% agarose gel containing formalin, and transferred to a Hybond-N+ membrane (GE Healthcare). After prehybridization, hybridization was performed with randomly labeled DNA probes derived from the NcoI-MluI fragment of pTLW3 and the EcoRI-ClaI fragment of the erG3GFP ORF to detect the ToMV genome and the GFP mRNA, respectively. To detect siRNAs, the total RNA was separated on a 15% polyacrylamide-7 M urea gel alongside synthetic oligoribonucleotides (20 and 25 nt) end labeled with [{gamma}-32P]ATP. After blotting onto a Hybond-NX membrane (GE Healthcare), hybridization was performed overnight at 40°C with riboprobes corresponding to the fragments (nt 5901 to 6100 of ToMV) prepared with T7 RNA polymerase from an appropriate subclone, as described previously (17). Radioactive signals were detected using a BAS2500 analyzer (Fuji Film).

Nonquantitative RT-PCR was performed using RT-PCR High Plus (Toyobo). The primers 5'-AACTGGCTCGTATGGTGGAG-3' and 5'-GGCGAACCAATCTGTATCGT-3' were used to screen for 2b-expressing transgenics (amplification of nt 41 to 303 of the CMV 2b ORF). The primers used to assay an actin transcript were reported previously (17). Quantitative RT-PCR was performed using the Opticon2 system (Bio-Rad Laboratories). To determine the expression levels of RDR1, RDR6, and ubiquitin mRNA, cDNA was synthesized from 0.5 µg of total RNA using an ExScript RT reagent kit (Takara Bio), and the cDNA corresponding to 25 ng of total RNA was amplified in 20-µl reaction mixtures containing iQ SYBR Green Supermix (Bio-Rad Laboratories). Based on the sequence of N. benthamiana RDR6 (29), the tobacco RDR6 ORF was PCR amplified and sequenced. The following primers were used in quantitative RT-PCR: RDR1 mRNA (nt 2540 to 2616), 5'-AGTACTTCACCAACTATATCATT-3' and 5'-TTCTCTGTCTGCAAATACAACG-3'; RDR6 mRNA (nt 2007 to 2119), 5'-GCAAATAGTAACCCTGCTCTCTTCC-3' and 5'-AAGCCACGTCCGAATCCAC-3'; and ubiquitin mRNA (nt 89 to 176) (18), 5'-TCCAGGACAAGGAGGGTATCC-3' and 5'-TAGTCAGCCAAGGTCCTTCCAT-3'.

GFP and RFP fluorescence. GFP and RFP fluorescence was observed using an epifluorescence stereomicroscope (MZ-FLIII; Leica) with excitation/emission wavelengths of 450 to 490 nm/500 to 550 nm for GFP and 534 to 558 nm/long-pass 560 nm for RFP. Photographs were taken using a DC500 charge-coupled device camera (Leica). Confocal images of longitudinally hand-sectioned leaf tissues embedded in agarose were captured using an LSM510 META confocal microscope (Carl Zeiss) with excitation/emission wavelengths of 488 nm/505 to 530 nm for GFP and 543 nm/575 to 615 nm for RFP.

Antiserum against NSs and immunoblot analysis. A 1.4-kb fragment encoding TSWV NSs (nt 89 to 1492; DDBJ/EMBL/GenBank accession no. AB088385) was excised from a cDNA clone and inserted into the BamHI (blunted) site of pET15b (Novagen) to yield pET-NSs. Recombinant NSs with six N-terminal His residues was expressed in Escherichia coli BL21(DE3)pLysS harboring pET-NSs, affinity purified on a HiTrap chelating HP column (GE Healthcare), and used to immunize a rabbit.

For protein analysis, leaf tissues were homogenized in sample buffer, and the cellular debris was removed. After the supernatants were boiled, the proteins were resolved by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to an Immobilon-P transfer membrane (Millipore). The membrane was treated with anti-NSs antiserum, followed by goat anti-rabbit immunoglobulin G (Fc) AP conjugate (Promega) and CDP-Star (Roche). Chemiluminescence from the immunoreactive bands was detected using an LAS-3000 analyzer (Fuji Film).

Immunohistochemistry. Leaf samples were fixed in 4% paraformaldehyde overnight at 4°C. After dehydration in a graded series of ethanol and t-butanol, the tissues were embedded in paraffin (Paraplast Plus; Sigma). Longitudinal sections (10 µm) were then cut, dried, and dewaxed in xylene, followed by hydration in a graded series of ethanol and deionized water. For immunohistochemistry, the sections were blocked in phosphate-buffered saline containing 2% skim milk and incubated with anti-ToMV antiserum (31). The antigen-antibody complexes on the sections were subsequently detected using a Vectastain ABC-AP kit and the alkaline phosphatase substrate kit III-blue (Vector Laboratories). The immunostained samples were imaged using a Microphot-FXA microscope equipped with a DS-5Mc-L1 camera (Nikon).

Nucleotide sequence accession numbers. The RFP ORF and the N. tabacum RDR6 cDNA sequence have been deposited in DDBJ under accession numbers AB361627 and AB361628, respectively.


arrow
RESULTS
 
Development of mosaic symptoms in ToMV-infected tobacco. Systemic disease symptoms are influenced by many factors, including the growth conditions and the size of the plant at the time of inoculation. To ensure that the symptoms observed on the systemically infected leaves were highly reproducible, we inoculated tobacco plants with ToMV on the fifth true leaf at a fixed concentration of infectious virus when the eighth true leaf was between 1 and 2 cm in length. The size of the eighth leaf was highly correlated with the sizes of the tenth and eleventh true leaves, which were invisible at the time of inoculation but later developed typical mosaic symptoms.

Under our inoculation conditions, mosaic symptoms usually developed first on the ninth true leaf at ~7 days postinoculation (dpi). Yellow-green and dark green areas were similarly distributed across the ninth to twelfth leaves; i.e., the dark green areas were located mainly in the proximal portion of each leaf, whereas the yellow-green areas were located mainly in the distal portion (Fig. 1A and B). The thirteenth and subsequent leaves developed a number of narrow and scattered dark green areas associated with veins. In this work, we focused mainly on the mosaic symptoms appearing on the tenth and eleventh leaves.


Figure 1
View larger version (100K):
[in this window]
[in a new window]

  		FIG. 1. Mosaic symptoms and viral distribution in ToMV-infected tobacco. (A and B) A ToMV-infected tobacco plant exhibiting typical mosaic symptoms at 8 dpi (A) and at 18 dpi (B). The 10th true leaf (arrows) was photographed to clearly visualize the mosaic pattern (lower left panels). Close-up views of the areas bounded by rectangles in the lower left panels are shown in the lower right panels. Asterisks indicate the same positions on the leaves: dark green tissue at 8 dpi (A) and pseudo-dark green tissue at 18 dpi (B). (C) Immunohistochemical detection of ToMV. Longitudinal sections were prepared from mosaic leaves and from a healthy leaf. Dotted lines indicate the boundaries between yellow-green and dark green tissues or between yellow-green and true dark green tissues. The arrow in the upper left panel indicates a class II vein, in which the vascular bundle tissues and their adjacent cells were stained. Note that the distance between yellow-green and pseudo-dark green tissues at 20 and 28 dpi varied from sample to sample. Abbreviations: Y, yellow-green tissue; D, dark green tissue; tD, true dark green tissue; pD, pseudo-dark green tissue. Bar = 250 µm.

The boundaries between yellow-green and dark green areas were sharp from the moment they became visible and remained unchanged until the leaves were senescent (Fig. 1A and B). The color of dark green tissue was uniform as long as the mosaic leaves were small and expanding; subsequently, a large portion of dark green areas became yellowish (Fig. 1B). Such an area in dark green tissue where the darkness is weakened is referred to as pseudo-dark green tissue, as described for the mosaic symptoms caused by TMV in tobacco (3). Pseudo-dark green tissue first appeared in the central portion of the dark green area (at ~14 dpi on the tenth leaf under our growth conditions) and then spread toward the yellow-green area. Ultimately, stable dark green residues (<0.5 mm wide) remained between the yellow-green and pseudo-dark green tissues (Fig. 1B), which were referred to as true dark green tissue (3). Infrequently, diffuse boundaries corresponding to the diffuse junctions in TMV-induced mosaic leaves (3) were observed. Since they disappeared at later stages of infection, we focused on the sharp boundaries.

Accumulation of ToMV and its small RNAs in mosaic leaves. The distribution of ToMV in mosaic leaves was examined by immunostaining thin sections using antibodies raised against ToMV virions. The boundaries between yellow-green and dark green tissues or between yellow-green and true dark green tissues were determined for each section based on the abnormality of cells in yellow-green tissue (e.g., round palisade cells and few air spaces). Before the breakdown of the dark green tissue into pseudo-dark green tissue (at 8 dpi in Fig. 1C), viral antigens were detected in yellow-green tissue (Fig. 1C, top). In contrast, the level of staining in dark green tissue was near background; however, the central portions of the major veins (class I and II veins) lying inside dark green tissue were stained (Fig. 1C, top). At later stages (20 and 28 dpi), both pseudo-dark green and yellow-green tissues were heavily stained, whereas the true dark green tissue was weakly stained (Fig. 1C, second and third panels). The boundaries between pseudo-dark green and true dark green tissues were sometimes vague, whereas those between yellow-green and true dark green tissues were always sharp.

Based on these observations, we dissected the mosaic leaves into their component tissues (yellow-green and dark green tissues at 8 dpi; yellow-green, pseudo-dark green, and true dark green tissues at 18 dpi) and examined the accumulation of ToMV genomic RNA and siRNAs (Fig. 2). A high level of the genomic RNA was detected in the yellow-green and pseudo-dark green tissues (Fig. 2A and B, lanes 1, 3, and 5; note that the total RNA from yellow-green and pseudo-dark green tissues was diluted 100-fold before loading for Fig. 2B), whereas a low level was detected in the true dark green tissue (Fig. 2A and B, lanes 4), consistent with the results obtained by immunostaining. In the dark green tissue, the genomic RNA detected was <1/100 of the amount in the yellow-green tissue (Fig. 2B, compare lanes 1 and 2). In parallel, high levels of ToMV siRNAs were detected in the yellow-green and pseudo-dark green tissues (Fig. 2C, lanes 1, 3, and 5), and a low level was in the true dark green tissue (Fig. 2C, lane 4). These results were consistent with our previous report that the ToMV-encoded suppressor likely inhibits RNA silencing after siRNA production (17). In the dark green tissue (sampled at 8 dpi), little if any siRNA was detected (Fig. 2C, lane 2), even though the genomic RNA detected was comparable with that in true dark green tissue (sampled at 18 dpi) (Fig. 2B, compare lanes 2 and 4).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 2. Accumulation of ToMV RNA in mosaic leaves. (A) Detection of the genomic RNA visualized by ethidium bromide staining. RNA was extracted from the 10th and 11th true leaves (excluding major veins) after dissection into yellow-green tissue (Y), dark green tissue (D), true dark green tissue (tD), and pseudo-dark green tissue (pD) under a stereomicroscope and from healthy leaves (H). (B) Detection of ToMV genomic and subgenomic RNAs by Northern blotting. The amount of total RNA loaded on lanes 1, 3, and 5 was 1/100 of that loaded on lanes 2, 4, and 6. (C) Detection of ToMV-derived siRNAs with the minus (antisense) polarity. Positions of 20- and 25-nt RNA markers are indicated on the left. The lower panel shows ethidium bromide staining for 5.8S rRNA.

RNA silencing and the development of mosaic symptoms in ToMV-infected tobacco. The observations that little or no siRNA was detected in dark green tissue (Fig. 2) and that dark green tissue was infected at a later stage (Fig. 1) raised the question of whether RNA silencing is involved in the development of mosaic symptoms in ToMV-infected tobacco plants. To clarify this, we examined the symptoms in transgenic tobacco plants in which RNA silencing was impaired. Virus-inducible RDR1 is an important component of antiviral silencing (9, 43, 44, 46). In fact, it has been reported that dark green areas are not observed in TMV-infected transgenic tobacco plants carrying an antisense construct of RDR1 (43). To confirm this for ToMV, we prepared transgenic tobacco lines carrying an RDR1 inverted-repeat construct. The transgenic lines grew normally, and two lines (RDR1IR-15 and -16) were selected for further analysis. In these lines, RDR1 expression was decreased to 15 to 20% of the wild-type level without influencing the expression of other RDR genes, as far as they were examined (Fig. 3A and data not shown). When ToMV was inoculated on these lines, mosaic symptoms developed in their upper noninoculated leaves; however, compared with the mosaic symptoms on nontransgenic tobacco plants, the areas of yellow-green tissue were significantly broadened and the total area of dark green tissue decreased (Fig. 3B). When TMV was inoculated as a reference, no or little dark green tissue was observed (Fig. 3C), as reported for TMV-infected antisense tobacco plants (43).


Figure 3
View larger version (82K):
[in this window]
[in a new window]

  		FIG. 3. Symptoms of ToMV-infected transgenic tobacco plants in which RNA silencing was impaired. (A) Quantitative RT-PCR analysis of the RDR1 and RDR6 transcript levels in RDR1IR-15 and -16 and nontransgenic (NT) tobacco plants. The ratio of RDR1 or RDR6 mRNA to ubiquitin mRNA in the NT tobacco plants was set at 1.0. The mean values obtained from three experiments are shown. Error bars indicate standard errors. (B) Symptoms on the 10th true leaves caused by ToMV infection in NT tobacco, RDR1IR-15, and RDR1IR-16 at 10 dpi. The dark green areas in RDR1IR-15 and RDR1IR-16 were decreased compared with those in the NT plant. (C) Symptoms on the 10th true leaves caused by TMV infection at 11 dpi. No (RDR1IR-15) or little (RDR1IR-16) dark green tissue was observed. (D) Western blots of transgenic plants expressing NSs. Protein extracts were prepared from healthy transgenic lines, NSs-13 (lane 1), NSs-15 (lane 2), a healthy NT plant (lane 3), and a TSWV-infected NT plant at 3 dpi (lane 4). The amount of protein loaded in lane 4 was eight times less than that loaded in the other lanes. (E) Symptoms on the 10th true leaves of ToMV-infected transgenic lines expressing NSs at 10 dpi. The leaves were completely yellowish and no dark green tissue was observed for NSs-13 or NSs-15. (F) Expression of CMV 2b mRNA in transgenic tobacco. RT-PCR products derived from the 2b transgene (top) and from actin mRNA (bottom) were stained with ethidium bromide. The RNAs used were from the transgenic lines Y2b-4 (lane 1), Y2b-13 (lane 2), Y2b-17 (lane 3), and Y2b-28 (lane 4), and NT tobacco (lane 5). Lane 6, in which a 2b-containing plasmid was used as the template, was included as a positive control. (G) Symptoms on the 10th true leaves of ToMV-infected transgenic lines expressing 2b at 10 dpi. The leaves are completely yellowish and devoid of dark green tissue. Lines Y2b-4 and Y2b-13 showed relatively severe phenotypes, as seen by a decreased number of class II veins, narrowed leaves, and stunting, whereas lines Y2b-17 and Y2b-28 showed mild phenotypes. The plants in panel G were grown alongside the plants in panel E.

We also prepared two other kinds of transgenic tobaccos, each expressing a viral suppressor (TSWV NSs or CMV 2b) that differentially inhibits RNA silencing (7, 30, 35). All the lines expressing the NSs mRNA grew normally, so the expression of NSs was confirmed by immunoblot analysis, and two lines (NSs-13 and -15) were finally selected (Fig. 3D). When ToMV was inoculated, the upper noninoculated leaves were completely yellowish and small dark green areas were only occasionally observed (Fig. 3E). The transgenic tobacco lines expressing the 2b mRNA exhibited visible phenotypes to various degrees, such as narrowed leaves, stunting, and a decreased number of class II veins (Fig. 3F and G). The phenotypes associated with CMV 2b expression in Arabidopsis have already been reported (47). For analysis, two lines (Y2b-4 and -13) with relatively severe phenotypes and two lines (Y2b-17 and -28) with mild phenotypes were selected. When inoculated with ToMV, the upper leaves became mostly yellowish (Fig. 3G), as observed in the NSs-expressing lines, irrespective of the phenotypic severity. Thus, the dark green areas were decreased in all the three types of transgenic tobacco plants in which RNA silencing activity was altered, indicating that suppression of RNA silencing inhibits the development of dark green tissue.

Visualization of the area where RNA silencing is directed against ToMV. Because dark green tissue contained little if any ToMV siRNA (Fig. 2) and was subsequently infected (Fig. 1), the number of cells that established RNA silencing against ToMV in the mosaic leaves was expected to be limited. Considering the expansion of yellow-green areas in the transgenics with defective RNA silencing (Fig. 3), antiviral RNA silencing might function to border the yellow-green areas during infection. To examine this possibility, we performed two separate experiments using GFP-expressing tobacco lines. In the first experiment, we prepared a ToMV mutant (TLGC30S) carrying a 30-nt gfp-derived sequence immediately downstream of the CP ORF (Fig. 4A) and used it to inoculate a tobacco line (G3Sm1) that constitutively expressed GFP (17), based on the hypothesis that GFP expression in G3Sm1 would be inhibited in the cells in which RNA silencing was directed against the recombinant ToMV sequence.


Figure 4
View larger version (51K):
[in this window]
[in a new window]

  		FIG. 4. Visualization of RNA silencing directed against ToMV in TLGC30S-infected GFP-expressing tobacco. (A) Structures of ToMV and TLGC30S. (B) GFP silencing in dark green tissue of a TLGC30S-infected G3Sm1 leaf (right panels). The left panels show a mosaic leaf from ToMV-infected G3Sm1. Arrowheads indicate the boundaries between yellow-green and dark green tissues. The asterisks indicate silenced regions in the dark green tissue. The leaves were photographed at 17 dpi under white (top) or blue (bottom) light. Bar = 1 mm. (C) Confocal images of longitudinal sections of ToMV- or TLGC30S-infected leaves at 17 dpi. The boundaries between yellow-green tissue (Y) and dark green tissue (D) are indicated by dotted lines. Bar = 200 µm.

TLGC30S caused mild mosaic symptoms with tiny and fragmented dark green areas in both G3Sm1 and nontransgenic tobacco plants during a similar time course, indicating that the insertion of the 30-nt gfp sequence did not induce strong systemic silencing against the genomic RNA. Had strong silencing been the case, the multiplication and/or spread of the recombinant virus would have been inhibited by a feedback mechanism, thereby resulting in a delay in symptom appearance or causing altered symptoms in G3Sm1.

As shown in Fig. 4B and C, decreased GFP fluorescence was observed in some, but not all, dark green areas in TLGC30S-infected G3Sm1; in some cases it was nearly undetectable. The regions in which GFP fluorescence was decreased were the marginal regions of the dark green areas (i.e., adjacent to yellow-green areas) with a width of 0.5 mm or less (Fig. 4C). No such decrease was observed in the other portions of the mosaic leaves, nor was it detected in G3Sm1 infected with wild-type ToMV (Fig. 4B and C). Thus, TLGC30S-directed RNA silencing is likely to be established in the marginal regions of the dark green areas, where the transgene-derived GFP mRNA would concurrently be degraded.

The second experiment involved another transgenic tobacco line (G3SmL2) that constitutively expressed GFP from an mRNA carrying a 200-nt ToMV sequence just downstream from the stop codon of the GFP ORF (Fig. 5A). Because ToMV siRNAs were detected using this 200-nt sequence as a probe (Fig. 2C), the GFP mRNA expressed in G3SmL2 was expected to be a target of RNA silencing in cells in which ToMV multiplication was inhibited by RNA silencing.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 5. Visualization of RNA silencing directed against ToMV in a ToMV-infected transgenic line (G3SmL2) expressing GFP mRNA with a ToMV-derived sequence. (A) Schematic representation of the GFP transgenes in G3Sm1 and G3SmL2. P35S indicates the cauliflower mosaic virus 35S promoter; Tn indicates the nos terminator. (B) GFP silencing in the marginal region of the dark green tissue in a ToMV-infected G3SmL2 leaf (right panels). The left panels show a mosaic leaf from ToMV-infected G3Sm1. Arrowheads indicate the boundaries between yellow-green and dark green tissues. The asterisks indicate GFP-silenced regions in the dark green tissue. The leaves were photographed at 12 dpi under white light (top) and blue light (bottom) irradiation. Bar = 1 mm. (C) Confocal images of longitudinal sections of leaves from ToMV-infected G3Sm1 and G3SmL2. The boundaries between yellow-green tissue (Y) and dark green tissue (D) are indicated by dotted lines. The leaves were sampled at 12 dpi. Bar = 200 µm. (D) GFP silencing in and along class I and II veins in a ToMV-infected G3SmL2 leaf. Asterisks indicate a strongly silenced region. The leaves were photographed as for panel B. Bar = 4 mm. (E) Healthy leaves of G3Sm1 and G3SmL2.

When G3SmL2 was inoculated with ToMV, severe mosaic symptoms developed which were indistinguishable from those observed in G3Sm1 and the nontransgenic plants, in contrast to the mild mosaic symptoms in the TLGC30S-infected plants. Importantly, the decrease in GFP fluorescence was clearly observed in most of the marginal regions of the dark green areas in ToMV-infected G3SmL2 (Fig. 5B and C). Additionally, GFP fluorescence was decreased in and along the major veins lying inside dark green areas (Fig. 5D), in contrast to strong fluorescence from major veins of healthy G3SmL2 (Fig. 5E). No such decrease in GFP fluorescence was observed in ToMV-infected G3Sm1 (Fig. 5B, C, and D). Thus, the greenish regions that first appeared on the small expanding leaves were surrounded by cells in which RNA silencing was directed against ToMV. In both experiments, the marginal regions of the dark green areas in which GFP fluorescence was decreased appeared to correspond to the areas that later became true dark green tissue. It should be noted that decreased GFP fluorescence was not observed in diffuse boundaries or in the mosaic leaves of CMV-infected G3SmL2 (data not shown).

To confirm at the molecular level that the decrease in GFP fluorescence was due to RNA silencing targeting the GFP mRNA, we performed Northern blot analysis with the RNAs isolated from GFP-positive and -negative tissues of the mosaic leaves of ToMV-infected G3SmL2. As shown in Fig. 6A, accumulation of full-sized GFP mRNA was greatly reduced in the marginal region of dark green tissue (lane 2), compared with the GFP mRNA levels in the nearby GFP-positive tissues on the yellow-green side (lane 1) and on the dark green side (lane 3). In the marginal region, a low level of the ToMV genomic RNA was detected (Fig. 6A, lane 2), as in true dark green tissue (Fig. 2A, lane 4). Small RNA analysis revealed that not only the ToMV but also gfp siRNAs were present in the marginal region (Fig. 6B, lane 2). These results indicate that decreased GFP fluorescence was due to RNA silencing and in addition that because the gfp sequence is not the direct target of RNA silencing against ToMV, the secondary siRNAs were generated there. Therefore, the possibility that the width of the marginal region where ToMV-directed RNA silencing actually occurred might be narrower than that estimated from the decreased GFP fluorescence arose. In the RNAs from yellow tissue, the gfp siRNA was not detected (Fig. 6B, lane 1) or was detected at a very low level (data not shown).


Figure 6
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 6. RNA analysis of the mosaic leaves of ToMV-infected G3SmL2. (A) Detection of GFP mRNA by Northern blotting. RNA was extracted from the 10th and 11th true leaves of ToMV-infected G3SmL2 at 15 dpi, after dissection of the leaves under an epifluorescence stereomicroscope into the marginal region of dark green tissue with no GFP fluorescence (mD) and the nearby tissues with GFP fluorescence on the yellow-green side (Y) and on the dark green side (D), and from healthy leaves (H). The lower panel shows ethidium bromide staining of the total RNA. NT, nontransgenic tobacco. (B) Detection of ToMV- and gfp-derived siRNAs with minus or antisense polarity by Northern blotting. Probes used were derived from the 200-nt ToMV sequence carried by the GFP mRNA in G3SmL2 (see Fig. 5A) and from the GFP ORF. Positions of 20- and 25-nt RNA markers are indicated on the left. The lower panel shows ethidium bromide staining of 5.8S rRNA.

Establishment of RNA silencing against ToMV in the marginal region of the dark green area. The experiments described above indicated that ToMV-directed RNA silencing was active in the border regions of the dark green areas. To confirm this for the normal infection process (i.e., in the absence of interactions between viral and transgene sequences), we designed another experiment on the basis of the principle that a virus with a ToMV-derived sequence cannot infect or invade cells in which RNA silencing against ToMV has been established. For this purpose, we used PVX as challenge virus because ToMV infection does not interfere with subsequent PVX infection. To induce typical mosaic symptoms on the fifth and sixth true leaves, which remain highly sensitive to PVX infection, the first and second true leaves of young tobacco plants were inoculated with ToMV. A GFP-silenced tobacco line (G3Sm2) (17) was used as a host. When G3Sm2 is infected with ToMV, typical mosaic symptoms develop; GFP fluorescence is restored just in the yellow-green areas by the action of the ToMV-encoded suppressor (17). This allowed us to visualize the boundaries between the yellow-green and dark green areas by fluorescence microscopy.

Two PVX derivatives were prepared (Fig. 7A): TX-R1, an RFP-tagged PVX construct, and TX-LsD, which carried a 145-nt, ToMV-derived sequence in the 5' untranslated region of the subgenomic mRNA for RFP. Because siRNAs isolated from ToMV-infected leaves contained those derived from the 145-nt sequence (data not shown), it was expected that TX-LsD would be targeted in cells in which ToMV-directed RNA silencing was established. When inoculated onto healthy tobacco plants, both TX-R1 and TX-LsD formed red fluorescent spots. When inoculated onto the mosaic leaves of G3Sm2, infection of TX-R1 (estimated from the center of each spot) occurred similarly in the yellow-green tissue and in the dark green tissue, including their borders, and the red fluorescent spots enlarged day by day (Fig. 7B and C). Therefore, neither infection nor subsequent cell-to-cell spread of the PVX derivative TX-R1 was disabled by preinfection with or the presence of ToMV. In the TX-LsD-inoculated leaves, red fluorescent spots were observed both in yellow-green areas and in the interior portions of dark green areas, and their sizes were indistinguishable, confirming that RNA silencing against ToMV was not functional in a large part of the dark green areas. Importantly, the expansion of the spots, reflecting the cell-to-cell spread of TX-LsD, was blocked at the margins of the dark green areas, just bordering the yellow-green areas, regardless of whether the infection occurred in yellow-green tissue (Fig. 7B and C, right) or in dark green tissue (Fig. 7B and C, middle). When the recombinants were infected close to the border regions, cell-to-cell spread of TX-R1 across the marginal region of a dark green area was observed at a frequency of >90%, whereas that of TX-LsD was <20% (Fig. 7D). These observations indicate that in mosaic leaves, ToMV-directed RNA silencing is established in the marginal regions of the dark green areas with a width of ~0.5 mm.


Figure 7
View larger version (41K):
[in this window]
[in a new window]

  		FIG. 7. Establishment of ToMV-directed RNA silencing in the border region of the dark green tissue. (A) Genomic structures of PVX and its derivatives, TX-R1 and TX-LsD. (B) Specific inhibition of TX-LsD spread at the margin of the dark green area. TX-R1 or TX-LsD was inoculated onto the mosaic leaves of ToMV-infected G3Sm2 at 13 dpi. The GFP and RFP signals were observed by using a fluorescence stereomicroscope 7 days after inoculation with recombinant PVX, and the images were merged. GFP fluorescence resulted from the suppression of GFP silencing in G3Sm2 by the action of the ToMV suppressor and coincided exactly with the yellow-green tissue. Note that GFP is localized in the endoplasmic reticulum and RFP in the cytosol. Arrows indicate the borders of the dark green tissue. Cell-to-cell spread of TX-LsD from the dark green side (middle) or the yellow-green (left) side was inhibited. Bar = 2 mm. (C) Confocal images of longitudinal sections from TX-R1-infected and TX-LsD-infected leaves. The boundaries between yellow-green tissue (Y) and dark green tissue (D) are indicated by dotted lines. (Left) RFP from a TX-R1 infection spot was detected in both yellow-green and dark green sides; (middle) infection of TX-LsD occurred in dark green tissue; (right) infection of TX-LsD occurred in yellow-green tissue. Bar = 200 µm. (D) Ratio of the number of TX-R1 or TX-LsD infection foci across the marginal region of dark green tissue to the total number (N) of foci counted. Foci on or apparently reaching the sharp boundary were counted, whereas those on the mottling, diffuse boundaries were not.

Although in many of the infection sites (>80%) TX-LsD did not pass from the yellow-green side to the dark green side or vice versa, approximately one-sixth of the red fluorescent spots invaded the border areas (Fig. 7D). Although we excluded the diffuse boundaries from our analysis because ToMV-directed RNA silencing was not observed there, as described above for ToMV-infected G3SmL2, and because TX-LsD passed through diffuse boundaries, some boundaries that were judged as sharp might have actually been diffuse ones. It was also possible that because TX-LsD would be expected to face strong selection pressure at the border, the derivatives devoid of a ToMV-derived sequence might be generated and allowed to move; however, our RT-PCR results indicated that this is not generally the case (data not shown).


arrow
DISCUSSION
 
We analyzed the mosaic symptoms caused by infection of ToMV in tobacco in relation to RNA silencing. Our results indicate that ToMV-directed RNA silencing is established in the marginal regions of the dark green areas (i.e., those bordering the yellow-green areas) (Fig. 4 to 7). In most cells of dark green tissue visible on the small expanding leaves, RNA silencing did not exert its effects against ToMV (Fig. 1, 2, and 7).

In mosaic leaves, the boundaries between yellow-green and dark green areas are sharply outlined, and once formed, they are retained during the life of the leaf (3). In transgenic tobacco plants in which an RNA silencing pathway was impaired by the constitutive expression of a suppressor (TSWV NSs or CMV 2b) or by decreasing the expression of RDR1, most parts of the upper leaves became yellowish, as shown in Fig. 3 and in a previous report (43). This means that in these transgenics, boundary formation was strongly inhibited. Therefore, RNA silencing functions to define the boundary between yellow-green and dark green tissues and consequently the finally visible mosaic pattern.

In tobacco, the amount of target RNA has been shown to be important for the mobile silencing signal to elicit systemic silencing (28). If this applies to ToMV infections, RNA silencing against ToMV would not occur effectively in as-yet-uninfected cells, which contain no target RNA. Therefore, it is valuable to consider virus-host interactions occurring in small developing leaves at a few days after inoculation. The regions of small developing leaves which ToMV successfully invades from the phloem to establish its replication machinery and to produce sufficient amounts of replicase (i.e., the ToMV suppressor [17]) would become yellow-green tissue. In contrast, some cells in young sink leaves would receive mobile silencing signals prior to infection from the phloem or infection front and would use the signal directly to set up the RISC machinery or would amplify the signal soon after the viral invasion. Once the RNA silencing system defeats the multiplication of the virus, the cells would become resistant to further infection. The battle between viral invasion and host RNA silencing likely occurs while the leaves are still tiny. At this stage, a small cluster of resistant cells with active ToMV-directed RNA silencing might align to form the boundary (i.e., the bordering cells on the dark green side).

Even after the boundaries between silencing-active and silencing-suppressed cells are formed, the border cells on the dark green side may receive target RNAs (i.e., the genomic RNA and its derivatives) from the adjacent cells on the yellow-green side. It is also likely that the border cells are infected latently and contain the viral replication machinery, which would protect the viral plus and minus strands from cytosolic Dicer-like enzymes and the RISC (1). The progeny or transported viral RNA could be degraded in the cytoplasm or used as a template for secondary siRNA production through the action of host RdRp, thereby maintaining RNA silencing. In support of this, electron microscopic analysis of the border regions in TMV-infected tobacco leaves has shown that decreased numbers of viral particles are present on the dark green side of the boundary (one to six cells wide) (3), consistent with our results showing that the true dark green tissue in ToMV-infected leaves (i.e., between the yellow-green and pseudo-dark green tissues) was weakly immunostained with anti-ToMV antibodies and contained a small amount of the genomic RNA (Fig. 1C and 2B). In addition, cell-to-cell spread of the recombinant PVX carrying a ToMV sequence was strongly inhibited at the margins of the dark green areas (Fig. 7B and C, middle and right). Thus, in the normal infection process, ToMV must be unable to pass through the boundary by cell-to-cell spread, and consequently, the mosaic outlines are not altered once they are established.

It has been proposed that immunity in the whole dark green areas to the same or closely related strains may be caused by RNA silencing (2, 4, 16, 25). This is true for the true dark green tissue of ToMV-infected tobacco plants. However, concerning the dark green areas that appear in the first mosaic leaves, their central portions are potentially susceptible to infection, where RNA silencing against ToMV does not work effectively, at least during the period when the leaves are expanding (Fig. 1 and 2). The cells in the interior portion of the dark green tissue may not have been infected at all or may have been infected but subsequently become free of the virus by RNA silencing at an early stage of leaf development. To discriminate between these possibilities, it is necessary to understand the change or expansion of the infected areas in tiny leaves that are just undergoing leaf and vein development. However, even in the latter case, a state of RNA silencing could not be maintained because the number of RISCs in the cell would decrease as a result of cell proliferation because of the lack of target RNAs (i.e., a lack of siRNA amplification). In addition to the cells along the boundaries between the yellow-green and dark green tissues, ToMV-directed RNA silencing was visible in and alongside the major veins lying inside dark green areas (Fig. 5D). Thus, it appears that a dark green area is surrounded by a thin band of resistant cells and protected from ToMV invasion. However, with a certain frequency, the virus may bypass a boundary via the vascular system (e.g., developing minor veins) to invade the dark green tissue; after several rounds of multiplication and cell-to-cell movement of ToMV, the infected cells would become visible as pseudo-dark green tissue.

DGIs, i.e., dark green areas surrounded by yellow-green tissue, appear on mosaic leaves. It has been proposed, mainly based on analyses of potyvirus-infected transgenic N. benthamiana, that DGIs and localized recovery are mutually related (11, 26, 45). However, in the normal infection process, with no virus-transgene interactions, virus-directed RNA silencing, at least in its amplification and maintenance, appears to involve a mechanism different from that observed in the recovery phenotype. In the case of tobacco mosaics caused by TMV or ToMV infection, the DGIs are 0.5 to 1.5 mm in diameter, which is comparable to the widths of the true dark green areas analyzed here; therefore, TMV- or ToMV-directed RNA silencing likely functions uniformly in such DGIs. However, in larger DGIs, RNA silencing against the virus may not be effective in their central portions, as in the case of the dark green areas in expanding leaves. Apart from fragmented true dark green tissue observed on fully expanded leaves at a later stage of infection, DGIs are always observed from the time when mosaic symptoms become visible on the emerging leaves. The origin of the cells comprising such DGIs could be the same as that in the marginal cells of dark green tissue (discussed above), but the successive clustering of resistant cells might not occur. Alternatively, the DGIs might be equivalent to the tiny dark green areas that are surrounded by the silencing-active border cells.

Here, we have shown that ToMV-directed RNA silencing is established in the margins of dark green tissue in the mosaic leaves. The next question is how the positions of the boundaries between yellow-green and dark green tissues are determined in the leaves. In relation to this, it is interesting that dark green areas are mostly located along veins. Further, immunostaining revealed that ToMV is present in the central portions of the major veins (Fig. 1C, top) and some minor veins (data not shown) lying inside dark green areas but not in the neighbor cells. Thus, the cells close to veins appear to be the center of the battle between host RNA silencing and viral countersilencing. In initiating ToMV-directed RNA silencing, the mobile silencing signal carrying the sequence information is necessary. Although its entity and the cells that produce it are still unknown, the signal could be moved from the phloem and/or infection front. It is also possible that another type of mobile signal enhancing a silencing pathway or inhibiting viral multiplication and/or cell-to-cell movement might be involved in the establishment of RNA silencing. It has been shown that the host plant (squash) responds to CMV infection in cells ahead of the infection front (14) and that RDR1 expression is up-regulated by salicylic acid (43). To clarify how a limited number of cells acquire RNA silencing-mediated resistance, additional studies are needed to elucidate the virus-host interactions in tiny leaves and leaf primordia.


arrow
ACKNOWLEDGMENTS
 
We thank D. Baulcombe for a PVX vector, B. Baker for a binary vector, I. Mitsuhara for a cDNA clone of RDR1, A. Tamai for a cDNA clone of TSWV, and the members of our laboratories for useful discussions. We also thank S. Nagai and Y. Matsumura for preparation of the transgenic plants and maintenance of the greenhouse.

This study was supported in part by Grants-in-Aid from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Plant Sciences, National Institute of Agrobiological Sciences, 2-1-2 Kannondai, Tsukuba 305-8602, Japan. Phone: 81-29-838-8361. Fax: 81-29-838-8347. E-mail: tmeshi{at}nias.affrc.go.jp Back

{triangledown} Published ahead of print on 23 January 2008. Back

{dagger} Present address: National Agricultural Research Center for Kyushu Okinawa Region, Koshi, Kumamoto 861-1192, Japan. Back


arrow
REFERENCES
 
    1
  1. Ahlquist, P. 2002. RNA-dependent RNA polymerases, viruses, and RNA silencing. Science 296:1270-1273.[Abstract/Free Full Text]
    2. 2
  2. Al-Kaff, N. S., S. N. Covey, M. M. Kreike, A. M. Page, R. Pinder, and P. J. Dale. 1998. Transcriptional and posttranscriptional plant gene silencing in response to a pathogen. Science 279:2113-2115.[Abstract/Free Full Text]
    3. 3
  3. Atkinson, P. H., and R. E. Matthews. 1970. On the origin of dark green tissue in tobacco leaves infected with tobacco mosaic virus. Virology 40:344-356.[CrossRef][Medline]
    4. 4
  4. Baulcombe, D. 2004. RNA silencing in plants. Nature 431:356-363.[CrossRef][Medline]
    5. 5
  5. Baulcombe, D. C., S. Chapman, and S. Santa Cruz. 1995. Jellyfish green fluorescent protein as a reporter for virus infections. Plant J. 7:1045-1053.[CrossRef][Medline]
    6. 6
  6. Brodersen, P., and O. Voinnet. 2006. The diversity of RNA silencing pathways in plants. Trends Genet. 22:268-280.[CrossRef][Medline]
    7. 7
  7. Bucher, E., T. Sijen, P. De Haan, R. Goldbach, and M. Prins. 2003. Negative-strand tospoviruses and tenuiviruses carry a gene for a suppressor of gene silencing at analogous genomic positions. J. Virol. 77:1329-1336.[CrossRef][Medline]
    8. 8
  8. Campbell, R. E., O. Tour, A. E. Palmer, P. A. Steinbach, G. S. Baird, D. A. Zacharias, and R. Y. Tsien. 2002. A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99:7877-7882.[Abstract/Free Full Text]
    9. 9
  9. Diaz-Pendon, J. A., F. Li, W. X. Li, and S. W. Ding. 2007. Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs. Plant Cell 19:2053-2063.[Abstract/Free Full Text]
    10. 10
  10. Ding, S. W., and O. Voinnet. 2007. Antiviral immunity directed by small RNAs. Cell 130:413-426.[CrossRef][Medline]
    11. 11
  11. Gammelgård, E., M. Mohan, and J. P. Valkonen. 2007. Potyvirus-induced gene silencing: the dynamic process of systemic silencing and silencing suppression. J. Gen. Virol. 88:2337-2346.[Abstract/Free Full Text]
    12. 12
  12. Germundsson, A., and J. P. Valkonen. 2006. P1- and VPg-transgenic plants show similar resistance to Potato virus A and may compromise long distance movement of the virus in plant sections expressing RNA silencing-based resistance. Virus Res. 116:208-213.[CrossRef][Medline]
    13. 13
  13. Grayburn, W. S. 1997. Plant transformation techniques and vectors. CRC Press LLC, Boca Raton, FL.
    14. 14
  14. Havelda, Z., and A. D. Maule. 2000. Complex spatial responses to cucumber mosaic virus infection in susceptible Cucurbita pepo cotyledons. Plant Cell 12:1975-1985.[Abstract/Free Full Text]
    15. 15
  15. Hull, R. 2002. Matthew's plant virology. Academic Press Ltd., London, England.
    16. 16
  16. Jorgensen, R. A., R. G. Atkinson, R. L. Forster, and W. J. Lucas. 1998. An RNA-based information superhighway in plants. Science 279:1486-1487.[Free Full Text]
    17. 17
  17. Kubota, K., S. Tsuda, A. Tamai, and T. Meshi. 2003. Tomato mosaic virus replication protein suppresses virus-targeted posttranscriptional gene silencing. J. Virol. 77:11016-11026.[Abstract/Free Full Text]
    18. 18
  18. Lacomme, C., K. Hrubikova, and I. Hein. 2003. Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. Plant J. 34:543-553.[CrossRef][Medline]
    19. 19
  19. Lindbo, J. A., and W. G. Dougherty. 2005. Plant pathology and RNAi: a brief history. Annu. Rev. Phytopathol. 43:191-204.[CrossRef][Medline]
    20. 20
  20. Lindbo, J. A., and W. G. Dougherty. 1992. Untranslatable transcripts of the tobacco etch virus coat protein gene sequence can interfere with tobacco etch virus replication in transgenic plants and protoplasts. Virology 189:725-733.[CrossRef][Medline]
    21. 21
  21. Lindbo, J. A., L. Silva-Rosales, W. M. Proebsting, and W. G. Dougherty. 1993. Induction of a highly specific antiviral state in transgenic plants: Implications for regulation of gene expression and virus resistance. Plant Cell 5:1749-1759.[Abstract]
    22. 22
  22. Margis, R., A. F. Fusaro, N. A. Smith, S. J. Curtin, J. M. Watson, E. J. Finnegan, and P. M. Waterhouse. 2006. The evolution and diversification of Dicers in plants. FEBS Lett. 580:2442-2450.[CrossRef][Medline]
    23. 23
  23. Meshi, T., M. Ishikawa, F. Motoyoshi, K. Semba, and Y. Okada. 1986. In vitro transcription of infectious RNAs from full-length cDNAs of tobacco mosaic virus. Proc. Natl. Acad. Sci. USA 83:5043-5047.[Abstract/Free Full Text]
    24. 24
  24. Mochizuki, T., and S. T. Ohki. 2004. Shoot meristem tissue of tobacco inoculated with Cucumber mosaic virus is infected with the virus and subsequently recovers from infection by RNA silencing. J. Gen. Plant Pathol. 70:363-366.[CrossRef]
    25. 25
  25. Moore, C. J., and R. M. MacDiarmid. 2006. Dark green islands: the phenomenon, p. 187-209. In G. Loebenstein and J. P. Carr (ed.), Natural resistance mechanisms of plants to viruses. Springer, Dordrecht, The Netherlands.
    26. 26
  26. Moore, C. J., P. W. Sutherland, R. L. Forster, R. C. Gardner, and R. M. MacDiarmid. 2001. Dark green islands in plant virus infection are the result of posttranscriptional gene silencing. Mol. Plant-Microbe Interact. 14:939-946.[Medline]
    27. 27
  27. Nozu, Y., and Y. Okada. 1968. Amino acid sequence of a common Japanese strain of tobacco mosaic virus. J. Mol. Biol. 35:643-646.[CrossRef][Medline]
    28. 28
  28. Palauqui, J. C., T. Elmayan, J. M. Pollien, and H. Vaucheret. 1997. Systemic acquired silencing: transgene-specific post-transcriptional silencing is transmitted by grafting from silenced stocks to non-silenced scions. EMBO J. 16:4738-4745.[CrossRef][Medline]
    29. 29
  29. Qu, F., X. Ye, G. Hou, S. Sato, T. E. Clemente, and T. J. Morris. 2005. RDR6 has a broad-spectrum but temperature-dependent antiviral defense role in Nicotiana benthamiana. J. Virol. 79:15209-15217.[Abstract/Free Full Text]
    30. 30
  30. Ruiz-Ferrer, V., and O. Voinnet. 2007. Viral suppression of RNA silencing: 2b wins the Golden Fleece by defeating Argonaute. Bioessays 29:319-323.[CrossRef][Medline]
    31. 31
  31. Saito, T., K. Yamanaka, Y. Watanabe, N. Takamatsu, T. Meshi, and Y. Okada. 1989. Mutational analysis of the coat protein gene of tobacco mosaic virus in relation to hypersensitive response in tobacco plants with the N' gene. Virology 173:11-20.[CrossRef][Medline]
    32. 32
  32. Savenkov, E. I., and J. P. Valkonen. 2002. Silencing of a viral RNA silencing suppressor in transgenic plants. J. Gen. Virol. 83:2325-2335.[Abstract/Free Full Text]
    33. 33
  33. Someya, N., K. Niinuma, M. Kimura, I. Yamaguchi, and H. Hamamoto. 2004. Pattern of N gene-mediated systemic hypersensitive response and turnover of viral replicase protein in tobacco. Arch. Virol. 149:2105-2113.[CrossRef][Medline]
    34. 34
  34. Suzuki, M., S. Kuwata, J. Kataoka, C. Masuta, N. Nitta, and Y. Takanami. 1991. Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106-113.[CrossRef][Medline]
    35. 35
  35. Takeda, A., K. Sugiyama, H. Nagano, M. Mori, M. Kaido, K. Mise, S. Tsuda, and T. Okuno. 2002. Identification of a novel RNA silencing suppressor, NSs protein of Tomato spotted wilt virus. FEBS Lett. 532:75-79.[CrossRef][Medline]
    36. 36
  36. Tamai, A., and T. Meshi. 2001. Tobamoviral movement protein transiently expressed in a single epidermal cell functions beyond multiple plasmodesmata and spreads multicellularly in an infection-coupled manner. Mol. Plant-Microbe Interact. 14:126-134.[Medline]
    37. 37
  37. Tolia, N. H., and L. Joshua-Tor. 2007. Slicer and the Argonautes. Nat. Chem. Biol. 3:36-43.[CrossRef][Medline]
    38. 38
  38. Tournier, B., M. Tabler, and K. Kalantidis. 2006. Phloem flow strongly influences the systemic spread of silencing in GFP Nicotiana benthamiana plants. Plant J. 47:383-394.[CrossRef][Medline]
    39. 39
  39. Tsuda, S., K. Hanada, Y. Minobe, M. Kameya-Iwaki, and K. Tomaru. 1993. Tomato spotted wilt virus isolates in Japan are grouped into two strains. Ann. Phytopathol. Soc. Jpn. 59:626-634.
    40. 40
  40. Vaucheret, H. 2006. Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev. 20:759-771.[Abstract/Free Full Text]
    41. 41
  41. Voinnet, O., and D. C. Baulcombe. 1997. Systemic signalling in gene silencing. Nature 389:553.[CrossRef][Medline]
    42. 42
  42. Wassenegger, M., and G. Krczal. 2006. Nomenclature and functions of RNA-directed RNA polymerases. Trends Plant Sci. 11:142-151.[CrossRef][Medline]
    43. 43
  43. Xie, Z., B. Fan, C. Chen, and Z. Chen. 2001. An important role of an inducible RNA-dependent RNA polymerase in plant antiviral defense. Proc. Natl. Acad. Sci. USA 98:6516-6521.[Abstract/Free Full Text]
    44. 44
  44. Yang, S. J., S. A. Carter, A. B. Cole, N. H. Cheng, and R. S. Nelson. 2004. A natural variant of a host RNA-dependent RNA polymerase is associated with increased susceptibility to viruses by Nicotiana benthamiana. Proc. Natl. Acad. Sci. USA 101:6297-6302.[Abstract/Free Full Text]
    45. 45
  45. Yelina, N. E., E. I. Savenkov, A. G. Solovyev, S. Y. Morozov, and J. P. Valkonen. 2002. Long-distance movement, virulence, and RNA silencing suppression controlled by a single protein in hordei- and potyviruses: complementary functions between virus families. J. Virol. 76:12981-12991.[Abstract/Free Full Text]
    46. 46
  46. Yu, D., B. Fan, S. A. MacFarlane, and Z. Chen. 2003. Analysis of the involvement of an inducible Arabidopsis RNA-dependent RNA polymerase in antiviral defense. Mol. Plant-Microbe Interact 16:206-216.[Medline]
    47. 47
  47. Zhang, X., Y. R. Yuan, Y. Pei, S. S. Lin, T. Tuschl, D. J. Patel, and N. H. Chua. 2006. Cucumber mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage activity to counter plant defense. Genes Dev. 20:3255-3268.[Abstract/Free Full Text]

Journal of Virology, April 2008, p. 3250-3260, Vol. 82, No. 7
0022-538X/08/$08.00+0     doi:10.1128/JVI.02139-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirai, K.
Right arrow Articles by Meshi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirai, K.
Right arrow Articles by Meshi, T.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»