Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Padmanabhan, M. S. Articles by Culver, J. N. Search for Related Content PubMed PubMed Citation Articles by Padmanabhan, M. S. Articles by Culver, J. N.

 Previous Article  |  Next Article 

Journal of Virology, March 2008, p. 2477-2485, Vol. 82, No. 5
0022-538X/08/$08.00+0     doi:10.1128/JVI.01865-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Tobacco Mosaic Virus Replicase-Auxin/Indole Acetic Acid Protein Interactions: Reprogramming the Auxin Response Pathway To Enhance Virus Infection

Meenu S. Padmanabhan,¹ Sabrina R. Kramer,¹ Xiao Wang,¹ and James N. Culver^1,2*

Department of Cell Biology and Molecular Genetics, University of Maryland,¹ Center for Biosystems Research, University of Maryland Biotechnology Institute, College Park, Maryland 20742²

Received 24 August 2007/ Accepted 10 December 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The replicase protein of Tobacco mosaic virus (TMV) disrupts the localization and stability of interacting auxin/indole acetic acid (Aux/IAA) proteins in Arabidopsis, altering auxin-mediated gene regulation and promoting disease development (M. S. Padmanabhan, S. P. Goregaoker, S. Golem, H. Shiferaw, and J. N. Culver, J. Virol. 79:2549-2558, 2005). In this study, a similar replicase-Aux/IAA interaction affecting disease development was identified in tomato. The ability of the TMV replicase to interact with Aux/IAA proteins from diverse hosts suggests that these interactions contribute to the infection process. To examine the role of this interaction in virus pathogenicity, the replication and spread of a TMV mutant with a reduced ability to interact with specific Aux/IAA proteins were examined. Within young (4- to 6-week-old) leaf tissue, there were no significant differences in the abilities of Aux/IAA-interacting or -noninteracting viruses to replicate and spread. In contrast, in mature (10- to 12-week-old) leaf tissue, the inability to interact with specific Aux/IAA proteins correlated with a significant reduction in virus accumulation. Correspondingly, interacting Aux/IAA levels are significantly higher in older tissue and the overaccumulation of a degradation-resistant Aux/IAA protein reduced virus accumulation in young leaf tissue. Combined, these findings suggest that TMV replicase-Aux/IAA interactions selectively enhance virus pathogenicity in tissues where Aux/IAA proteins accumulate. We speculate that the virus disrupts Aux/IAA functions as a means to reprogram the cellular environment of older cells to one that is more compatible for virus replication and spread.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Plant susceptibility to pathogen attack can vary widely depending on developmental and environmental factors. For plant viruses, factors such as light, temperature, plant nutrition, and time of day can all influence host susceptibility (20). Even within individual plants, the position and age of the infected tissue can significantly impact its susceptibility (41). Thus, numerous factors affecting host physiology also influence pathogen susceptibility and disease response. Presumably, variations in host physiology affect the compatibility of the cellular environment with virus replication and spread. Since viruses are obligate pathogens, their infection cycle is directly impacted by the physiology of the host cell. There is, however, a growing body of evidence that plant viruses can alter the environment of infected cells to promote their own replication and spread (7). For example, members of the family Geminiviridae appear to direct infected cells to reenter the S phase through an interaction between the virus Rep protein and a host-encoded retinoblastoma-related protein (23, 47). This process leads to the production of host DNA replication machinery needed to replicate the virus's single-stranded DNA genome (19, 38). The ability to reprogram host physiology thus provides an advantage in establishing an infection and likely contributes to the development of disease.

Tobacco mosaic virus (TMV) is the type member of the genus Tobamovirus and has been studied extensively for its ability to replicate and induce host disease or resistance responses. Previously, we identified interactions between specific auxin/indole acetic acid (Aux/IAA) proteins and the helicase domain of the TMV replicase protein (32, 33). Auxin is a major plant hormone that controls an array of developmental and cellular processes (43). Aux/IAA proteins encompass a large family of proteins that are thought to function primarily as negative regulators of auxin-responsive transcription factors (ARF) (22, 36, 46). Aux/IAA proteins can be identified by four conserved motifs (domains I, II, III, and IV), with domains III and IV mediating ARF interactions, while domains I and II confer Aux/IAA nuclear localization and rapid turnover (1, 35, 48). ARFs function to regulate the expression of numerous auxin-responsive transcripts through a specific DNA binding motif that interacts with auxin-responsive elements located in the promoters of these genes (22, 45, 46). Increasing auxin concentrations result in the targeted degradation of Aux/IAA proteins via the Skp1-Cullin-F-box subunit-containing (SCF^TIR1) ubiquitin ligase complex. TIR1, the F-box component of the complex, functions as an auxin receptor and mediates the ability of Aux/IAA proteins to interact with the ubiquitin ligase complex in an auxin-dependent manner (10, 21, 25, 36, 46). Aux/IAA degradation subsequently releases interacting ARF proteins that function as either activators or repressors of auxin response genes (9, 11, 18). Auxin-regulated proteolysis of Aux/IAA proteins thus provides a sensitive means of controlling multiple genes in a developmentally significant manner.

In vitro and in vivo characterizations have identified three Aux/IAA family members from Arabidopsis, IAA26, IAA27, and IAA18 that show various abilities to interact with the TMV replicase protein. Interacting Aux/IAA proteins display alterations in nuclear localization and reduced accumulations in the presence of the TMV replicase protein (32, 33). The replicase-mediated disruption of Aux/IAA function corresponds with the display of developmental disease symptoms, suggesting that this interaction functions to affect auxin-mediated host developmental processes. Similarly, nearly one-third of the genes found to exhibit transcriptional alterations in response to TMV infection contain two or more auxin-responsive elements within their promoters (16, 32), suggesting that a significant proportion of the host genes that show transcriptional alterations in response to this virus may be affected by this interaction. Combined, these studies have led to a model whereby replicase expression during infection disrupts the localization and/or stability of interacting Aux/IAA proteins. The disruption of Aux/IAA function results in the release of ARFs and changes in the transcription of associated auxin response genes. It is the inappropriate regulation of these auxin response genes, independent of the normal auxin gradient, that results in the display of specific developmental disease symptoms.

Previously, no significant advantage to the virus was known to be associated with the Aux/IAA interactions. Specifically, a helicase mutant, TMV-V1087I, displayed a reduced ability to interact with and disrupt the localization of Aux/IAAs replicated and spread in plants at a rate similar to the wild-type virus (32). This finding suggested that this interaction was inconsequential in the efficient completion of the virus life cycle and may represent an Arabidopsis-specific interaction that contributes to disease. However, in this study, we determined that interactions between the TMV replicase and a related Aux/IAA protein in tomato lead to alterations in Aux/IAA localization that are associated with the development of disease symptoms. These interactions suggest that replicase-Aux/IAA interactions are conserved among TMV hosts and thus may confer a specific advantage to the virus. Subsequently, we further demonstrate that the ability of TMV to interact with select Aux/IAAs corresponds with an enhanced ability to spread in older developmentally mature tissues, suggesting that this interaction is involved in the cellular reprogramming of older tissues to create a more compatible environment for the virus. The biological significance of this interaction and its potential role in promoting virus infection are discussed.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
LeIAA26 cloning and yeast two-hybrid analysis. Total leaf RNA from 6-week-old Solanum lycopersicon cv. Pilgrim plants was isolated via RNeasy minipreps (Qiagen, Valencia, CA). Total leaf cDNA was generated from 1 µg of the isolated RNA using a SuperScript first-strand synthesis system (Invitrogen, Carlsbad, CA). LeIAA26-specific forward (GGATCCATGGAAGGTTATTCACAAAAATGG) and reverse (CTCGAGTTAGGTCAGCTGCTTAGTTG) primers containing BamHI and XhoI restriction sites were used to amplify the 860-bp LeIAA26 open reading frame (ORF). The amplified ORF was cloned into pCRII-TOPO (Invitrogen, Carlsbad, CA) and sequenced. Protein sequence alignments were performed using CLUSTALW (44).

Following digestion with BamHI and XhoI, the LeIAA26 ORF was ligated into similarly digested pACT-GAL4 (13). Yeast two-hybrid interaction assays were performed as previously described (17). Briefly, the L40 strain of Saccharomyces cerevisiae carrying the pLexA-TMV helicase or pLexA-ethylene response 1 protein (pLexA-ETR1) was transformed with pACT-GAL4-LeIAA26 or pACT-GAL4-AtIAA26 vectors. For semiquantitative β-galactosidase assays, individual yeast colonies carrying both the pACT and pLexA plasmids were grown on selection media without uracil, Trp, or Leu at 25°C and lifted onto nitrocellulose membranes. Membrane lifts were frozen at –80°C for 5 min and soaked in a 4% 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) solution containing 0.1% Triton X-100 and Z buffer (1 M Na₂HPO₄, 40 mM NaH₂PO₄, 10 mM KCl, 1 mM MgSO₄, 50 mM β-mercaptoethanol, pH 7.0). Yeast colonies turning blue within 30 min were scored as positive for interaction.

Construction of LeIAA26-GFP and transient expression assays. The expression vector pCMC1100, containing a polylinker domain flanked by the Cauliflower mosaic virus 35S promoter and a polyadenylation signal, was used as the parental plasmid for the construction of a LeIAA26-green fluorescent protein (LeIAA26-GFP) transient expression construct (29). The full-length LeIAA26 ORF was modified via PCR to contain a 5' KpnI site and a 3' BsiWI site. The LeIAA26 sequence was subsequently ligated to similarly digested pCMC-GUS-GFP (12), replacing the glucuronidase ORF with the LeIAA26 ORF.

Transient expression assays were performed as described previously (12, 32), using either mock-inoculated or TMV-infected Nicotiana benthamiana leaf tissue. In summary, 4 µg of pCMC-LeIAA26-GFP was ethanol precipitated onto 0.5 mg of tungsten particles (1.3 µm in diameter; Bio-Rad, Hercules, CA). The DNA-coated particles were resuspended in 95% ethanol by sonication in a Branson 2200 ultrasonic cleanser (Branson Equipment, Shelton, CT) and transferred onto plastic filter screens (Gelman Sciences, Ann Arbor, MI). The filters were air dried and mounted into a particle inflow gun (15, 42), and a 50-ms pulse of helium (50 pounds per square inch) was used to propel the particles into leaf tissues mounted 3 in. below the filters. The tissues were incubated for 16 to 20 h at room temperature, mounted on glass slides, and imaged using a Zeiss LSM510 laser scanning confocal microscope with 10x (numerical aperture of 0.8, dry) and 63x (numerical aperture of 1.2, water immersion) lenses (Carl Zeiss, Inc., Thonwood, NY). Excitation sources were 488 nm for GFP. Images were modified using Zeiss LSM Imager Examiner software, version 3.0, and processed for printing with Adobe Photoshop (Grand Prairie, TX).

Construction of pTRV2-LeIAA26 and VIGS assays. The Tobacco rattle virus (TRV) virus-induced gene-silencing (VIGS) vectors, pTRV1 and pTRV2, were kindly provided by S. P. Dinesh-Kumar, Yale University (26). The LeIAA26 ORF was PCR modified to contain 5' EcoRI and 3' KpnI sites inserted into a similarly digested pTRV2 plasmid and transformed into Agrobacterium tumefaciens strain GV3101. For VIGS assays, 50-ml cultures of A. tumefaciens containing individual TRV vectors were grown overnight at 30°C in LB media containing antibiotics, 10 mM MES (morpholineethanesulfonic acid), and 20 µM acetosyringone. Agrobacterium cells were pelleted and resuspended in infiltration media (10 mM MgCl2, 10 mM MES, 200 µM acetosyringone) at an optical density of 1.0. A. tumefaciens cells containing pTRV2-LeIAA26 or the unmodified empty pTRV2 vector were mixed with an equal volume of cells containing the pTRV1 vector and syringe infiltrated into the cotyledons of 2-week-old tomato seedlings.

Semiquantitative reverse transcriptase (RT)-PCR analysis. For mRNA analysis, total leaf RNA from either tomato or Arabidopsis was isolated using either the RNeasy RNA extraction kit (Qiagen, Valencia, CA) or Trizol reagent (Invitrogen, Carlsbad, CA). One microgram of isolated RNA was pretreated with RQ1 DNase (Promega, Madison, WI) and reverse transcribed using the SuperScript first-strand synthesis system (Invitrogen, Carlsbad, CA). In tomato, the LeIAA26 PCR primers were designed to ensure amplification of the endogenous gene with the forward primer (AGCTTATGACAGCTTATCACA) binding at bp 560 in the ORF and the reverse primer (GTTGGCTCTACATCTTGTTAGCTCA) binding within the 3' untranslated region. LeEFI primers (GAGATGCACCACGAAGCTCTCC and CATCTTAACCATACCAGCATCAC) were designed to amplify a 500-bp fragment as an internal control. In Arabidopsis, AtTIR1 primers (TGCAAGGATCTCCGTCGC and ATCCGTTAGTAGTAATGA) amplified a 490-bp ORF fragment. AtIAA26 primers (CTCATGACCATGGAAGGTTGTCC and GTGCATCATCTTCTCTTGCT) produce an 810-bp fragment, and AtEF1 primers (CTGGTACCTCCCAGGCTGATTGTGC and TCAAGAGTTTAGGCTCCTTCTCATT) amplify a 920-bp fragment. Semiquantitative PCRs utilized 2 to 3 µl of cDNA in each 50-µl PCR. PCR samples were removed at various cycles, and products were visualized via agarose gel electrophoresis and photographed using AlphaImager (Alpha Innotech, San Leandro, CA). The intensity levels of amplified PCR fragments were quantified using AlphaEase software (Alpha Innotech, San Leandro, CA). Band intensities for LeIAA26 fragments were normalized to the intensity of the internal control LeEF1 and used to calculate the percentage of reduction in LeIAA26 transcript levels in tomato VIGS samples.

Plant growth conditions and virus assays. All plants were maintained in growth chambers for a 12-h photoperiod at 24°C. Four- to 6-week-old and 10- to 12-week-old Arabidopsis ecotype Shahdara plants were used for virus inoculation. Rosette leaves were dusted with carborundum (Fisher Scientific Company, Pittsburgh, PA) and mechanically inoculated with 10 µg of purified wild-type (wt) TMV or TMV-V1087I. Each virus assay sample represented leaf tissue taken from two independently inoculated rosette leaves totaling 30 mg of fresh leaf weight. Samples were ground in either 10 mM sodium phosphate buffer, pH 7.0, or directly in Laemmli sample buffer (24). Protein levels loaded onto denaturing polyacrylamide gel electrophoresis (PAGE) gels were equalized by determining total protein levels via a Bradford assay and/or by direct visualization on Coomassie-stained PAGE gels (3). Equivalently loaded samples, 8 µg protein per well, were separated by PAGE and blotted onto nitrocellulose membranes. Blotted proteins were probed with anti-TMV-coat protein (anti-TMV-CP) antibody as previously described (8). TMV CP levels were quantified using ImageJ (2).

Generation of transgenic plants and analysis of protein levels. The pCMC-IAA26-GFP construct was used to PCR modify the IAA26-GFP ORF to contain 5' XbaI and 3' XhoI sites (32). This PCR product was ligated into a similarly digested pBI121 vector (Clonetech, Mountain View, CA) and introduced into A. tumefaciens strain GV3101. Floral dip transformation was used to introduce the 35S::IAA26-GFP construct into A. thaliana ecotype Shahdara (6). Transformants were selected on 1x Marushige and Skoog agar containing 30 mg/liter of kanamycin and confirmed by PCR analysis of leaf-extracted genomic DNA. T2 plants from confirmed transgenic lines were used in subsequent Western blot protein assays for the detection of the IAA26-GFP fusion protein using anti-GFP antibodies (Clontech, Mountain View, CA). The construction of 35S::IAA26-P108L-GFP has previously been described (33).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The helicase domain of the TMV replicase protein interacts with a tomato Aux/IAA protein and disrupts its cellular localization. Previously, we demonstrated that Arabidopsis Aux/IAA proteins IAA26, IAA27, and IAA18 colocalize with the TMV replicase, disrupting their accumulation and nuclear localization (32, 33). Sequence diversities between these Aux/IAA proteins ranged between 50 to 75% identity, suggesting that the virus replicase is capable of interacting with diverse Aux/IAA family members. To determine if the diversity of this interaction extends beyond Arabidopsis, a tomato homologue of IAA26 (TC184101) was identified from an annotated expressed sequence tag library (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=tomato). A sequence comparison showed that the tomato LeIAA26 protein shared 48% identity and 63% similarity with AtIAA26. The entire LeIAA26 ORF was amplified from Solanum lycopersicon cv. Pilgrim. Sequence analysis of this 863-bp fragment revealed 100% identity to the annotated expressed sequence tag.

The ability of LeIAA26 to interact with the TMV replicase was examined within a yeast two-hybrid system. Although weaker than AtIAA26, LeIAA26 did produce a significant level of interaction with the helicase domain of the TMV replicase protein (Fig. 1A). To determine if this interaction affected the localization of LeIAA26 in vivo, a GFP fusion protein, LeIAA26-GFP, was transiently expressed via particle bombardment in either mock- or TMV-infected tissues at 6 days postinoculation (Fig. 1B). Previous studies have shown that AtIAA26, which normally localizes to the nucleus, colocalizes with the TMV 126-kDa replicase protein to produce cytoplasmic vesicle-like inclusions (33). Similar to results with AtIAA26, in mock-inoculated tissues, LeIAA26 localized tightly to the nucleus. However, in TMV-infected tissue, LeIAA26 displayed lower levels of accumulation in the nucleus and produced distinct cytoplasmic vesicle-like structures (Fig. 1B). The disruption of the localization of LeIAA26, along with the association of LeIAA26 with cytoplasmic vesicles, was similar to that observed for interacting Arabidopsis Aux/IAA members (33), indicating that replicase-Aux/IAA interactions produce a similar effect on Aux/IAA localization within diverse TMV hosts.

View larger version (33K): [in this window] [in a new window]

FIG. 1. The TMV replicase interacts with an IAA26 homologue derived from tomato plants and disrupts its localization within the nucleus. (A) Yeast two-hybrid interaction between the TMV helicase domain (Hel) and Arabidopsis IAA26 (At-IAA26), tomato IAA26 (Le-IAA26), and a negative control construct expressing Arabidopsis ETR1 (5). (B) Transient expression of LeIAA26-GFP via particle bombardment in mock- and TMV-inoculated tissues at 6 days postinfection. LeIAA26-GFP localizes to the nucleus (N) in mock-inoculated tissues but is relocalized to the cytoplasm in TMV-infected tissues.

Disruption of LeIAA26 localization corresponds with the development of virus-like symptoms in tomato. Previous studies have implicated the TMV replicase-AtIAA26 interaction in the induction of virus-like symptoms (32). To determine if LeIAA26 has a similar affect in tomato, we targeted the LeIAA26 transcript for degradation using a TRV-induced gene-silencing system (26). Either TRV constructs with no inserts or the full-length LeIAA26 sequence was coinfiltrated into 2-week-old tomato seedlings, cv. Pilgrim. Plants infiltrated with TRV-LeIAA26 displayed stunting and leaf curling compared to the unmodified TRV-infiltrated control plants. This phenotype was strikingly similar to the symptoms induced by TMV infection. TRV silencing of LeIAA26 was confirmed by semiquantitative RT-PCR. Amplified band intensities normalized to internal LeEF1 bands revealed that within TRV-LeIAA26-infected plants displaying stunting and leaf curling, the mRNA levels of LeIAA26 were at least 53% lower than that found in TRV control plants, indicating that the LeIAA26 transcripts were partially silenced in these tissues (Fig. 2C). Although we cannot rule out the potential effects from the cosilencing of sequence-similar Aux/IAA proteins, the observed plant phenotypes are consistent with previous silencing experiments done in Arabidopsis (32) and suggest a role for the TMV-induced disruption of Aux/IAA proteins in the induction of disease symptoms.

View larger version (45K): [in this window] [in a new window]

FIG. 2. Silencing of LeIAA26 correlates with the appearance of virus-like symptoms in tomato plants. (A) Mock- and TMV-infected tomato leaves at 2 weeks postinoculation. (B) Developmental leaf effects caused by the vector (TRV empty) and the LeIAA26 silencing vector (TRV-LeIAA26) at 3 weeks postinfiltration. (C) Relative levels of LeIAA26 transcripts as detected by semiquantitative PCR in silenced and empty TRV tissues.

Replicase-Aux/IAA interactions correspond with enhanced virus accumulations in mature leaf tissues. The conserved nature of the IAA26-replicase interaction suggests that this interaction plays a role in virus biology. To investigate this possibility, the ability of a TMV helicase mutant, TMV-V1087I, deficient in its interaction with IAA26, was examined for alterations in virus spread and accumulation (Fig. 3A). Although this mutant produces attenuated disease symptoms, it was previously shown to replicate and spread at levels that were similar to those of the wt TMV, which interacts with Aux/IAA proteins (32). However, we repeatedly noticed that on mature senescing leaf tissue, TMV-V1087I produced local lesions in the N gene-containing tobacco that did not expand beyond the initial infection site (Fig. 3B and C). Specifically, in Nicotiana tabacum cv. Xanthi-nc, a local lesion host for TMV, TMV-V1087I produces local lesions on young newly expanded leaves that are similar in size and timing of appearance to those produced by wt TMV. In contrast, within older senescing leaves, TMV-V1087I induced lesions that did not expand over time and that, after 6 to 8 days, were noticeably smaller in size than the lesions produced by the wt TMV. This finding provided the first indication that tissue age can impact the infection of an Aux/IAA interaction-deficient virus.

View larger version (111K): [in this window] [in a new window]

FIG. 3. Local lesion spread of wt TMV and TMV-V1087I in different-age leaves. (A) Yeast two-hybrid analysis demonstrating differences in the interactions of the Arabidopsis AtIAA26 and the wild-type or V1087I helicase domain of TMV. (B) Newly expanded Nicotiana tabacum cv. Xanthi-nc leaf inoculated on the left side with TMV-V1087I and on the right side with wt TMV. (C) Similarly inoculated senescing Xanthi-nc leaf. Pictures taken at 8 days postinoculation.

To confirm that the observed differences in lesion sizes were not specific to tobacco or related to the necrotic resistance response, we monitored both wt TMV and TMV-V1087I accumulations in inoculated Arabidopsis thaliana ecotype Shahdara leaves (Fig. 4). Shahdara is a systemic host for TMV and has been shown to rapidly accumulate detectable levels of virus in both inoculated and systemic tissues (8). As observed in the local lesion assay, young 4- to 6-week-old inoculated Shahdara leaves produced similar accumulations of both wt TMV and TMV-V1087I (Fig. 4A). However, in leaves 10 to 12 weeks of age, accumulations of TMV-V1087I were significantly lower than those of wt TMV (Fig. 4B). These findings support an age-induced variation in the accumulation of a TMV mutant that is deficient in Aux/IAA interactions.

View larger version (17K): [in this window] [in a new window]

FIG. 4. Accumulation of wt TMV versus TMV-V1087I in different-age Arabidopsis leaf tissues. (A) Virus accumulation in 4- to 6-week-old inoculated leaves. dpi, days postinoculation. (B) Accumulation in 10- to 12-week-old inoculated leaves. Each data point represents the average and standard deviation derived from 8 to 10 independent inoculated leaves inoculated with 10 µg of wt TMV or TMV-V1087I. Virus infections were monitored for the accumulation of TMV CP by Western immunoblotting.

IAA26 accumulation is enhanced in mature tissues. IAA26 protein levels were compared among different-age leaf tissues as a means of determining if Aux/IAA protein accumulation levels correlated with the observed age-induced variations in TMV accumulation (Fig. 5). Arabidopsis ecotype Shahdara transformed with 35S::IAA26-GFP, an IAA26 GFP fusion construct under the control of the Cauliflower mosaic virus 35S promoter, was examined for protein accumulation. Previous results indicated that IAA26-GFP could be transiently expressed in leaf tissues (33). Additionally, IAA26-GFP was shown to be degraded upon IAA treatment and its nuclear localization disrupted during TMV infection (33). Combined, these findings indicate that the IAA26-GFP fusion functions in a manner consistent with those of other reported Aux/IAA proteins (18, 34, 37). In this study, Western immunoblot detection of the presence of IAA26-GFP by use of GFP-specific antibodies failed to detect the fusion protein in 4-week-old leaf tissues. In contrast, in 10-week-old tissue, IAA26-GFP was readily detected (Fig. 5A). RT-PCR analysis indicated that the 35S::IAA26-GFP plants produced similar amounts of mRNA in young and old tissues (Fig. 5B). Additionally, the infiltration of 50 µM IAA into older leaf tissues rapidly reduced the detectable accumulation of IAA26-GFP in these tissues (Fig. 6A). Thus, the accumulation of IAA26-GFP in older tissues is consistent with a reduction in the auxin-mediated degradation of this protein.

View larger version (63K): [in this window] [in a new window]

FIG. 5. Stability and expression of IAA26-GFP in 4- and 10-week-old leaf tissues from Arabidopsis plants transformed with a 35S::IAA26-GFP construct. (A) Western immunoblot assays using GFP-specific antibodies for the detection of IAA26-GFP (57 kDa) in four independent plants (lanes 1 to 4) using 4- and 10-week-old leaf tissue. (B) PCR amplification of IAA26-GFP transcript in 4- and 10-week-old leaf tissues.

View larger version (51K): [in this window] [in a new window]

FIG. 6. IAA26 protein and TIR1 transcript accumulation in Arabidopsis leaf tissue. (A) Western immunoblot detection of IAA26-GFP in 10-week-old leaves from two independent 35S::IAA26-GFP-transformed plants infiltrated with water (lanes 1 and 3) or 50 µM IAA. Leaf proteins extracted at 1 h post-IAA infiltration. Results demonstrate the degradation of IAA26-GFP in response to auxin treatment. (B) Detection of the auxin receptor and Aux/IAA F-box transcript, TIR1, in 4- and 10-week-old leaf tissue, indicating reduced accumulations of TIR1 transcript in older tissues.

Upon binding auxin, the F-box protein TIR1 has been shown to associate with Aux/IAA proteins to mediate ubiquitin ligation and subsequent proteolysis via the proteasome (18). Previous studies have shown that TIR1 transcription is regulated by the microRNA mir393 (30). Furthermore, mir393 is upregulated in response to stress and pathogen infection (30, 40). To determine if the accumulation of IAA26-GFP corresponds with reduced levels of TIR1 mRNA, a semiquantitative PCR analysis was performed. This analysis revealed reduced levels of TIR1 mRNA in older leaf tissue compared to young leaf tissue (Fig. 6B). This finding further supports reduced auxin-mediated proteolysis in older plant tissues that could lead to increased accumulations of Aux/IAA proteins (27).

Increased accumulations of IAA26 affect TMV accumulation. To more directly investigate the role of the Aux/IAA interaction on virus infection, the abilities of both wt TMV and TMV-V1087I to accumulate in IAA26-P108L-GFP-expressing transgenic Shahdara plants were assessed. Similar P108L mutations have been shown to block the auxin-mediated degradation of Aux/IAA proteins, resulting in increased Aux/IAA accumulations (18, 31). Previously, we demonstrated that the IAA26-P108L-GFP protein is resistant to auxin degradation (33). However, this mutant protein retains its ability to interact with the TMV helicase, and its nuclear localization is disrupted during TMV infection (33). In addition, transgenic Shahdara plants expressing IAA26-P108L-GFP display an auxin-resistant phenotype that includes leaf curling and stunting (Fig. 7A and B).

View larger version (64K): [in this window] [in a new window]

FIG. 7. Excess levels of auxin-resistant IAA26-P108L-GFP affect the accumulation of TMV in a helicase interaction-dependent manner in Arabidopsis ecotype Shahdara. (A) Photo of 6-week-old nontransformed and 35S::IAA26-P108L-GFP-transformed plants. (B) Western immunoblot for the detection of IAA26-P108L-GFP in transformed plants using GFP-specific antibodies. (C) Comparison of wt TMV and TMV-V1087I accumulation in 35S::IAA26-P108L-GFP plants at 3 and 6 days postinoculation (dpi). (D) Accumulation of TMV-V1087I in 6-week-old nontransformed wt Shahdara or 35S::IAA26-P108L-GFP-transformed Shahdara plants. Each data point represents the average and standard deviation generated from four to seven independently inoculated plants that were monitored for the accumulation of TMV CP by Western immunoblotting.

We speculated that excess accumulations of IAA26, derived from the auxin-resistant P108L mutant, would significantly affect the accumulation of the interaction-deficient TMV-V1087I, even in young leaf tissues. The leaves of 4- to 6-week-old 35S::IAA26-P108L-GFP Shahdara plants were inoculated with either wt TMV or TMV-V1087I. Western immunoblot analysis for the accumulation of TMV CP indicated that in comparison to the wild-type virus, TMV-V1087I is reduced in its ability to accumulate at 6 days postinoculation (Fig. 7C). Similarly, we speculated that independent of age, TMV-V1087I would show reduced accumulations in leaf tissue that contained high levels of the IAA26-P108L-GFP protein. For this experiment, the ability of TMV-V1087I to accumulate in 4- to 6-week-old 35S::IAA26-P108L-GFP transgenic Shahdara plants was compared to its ability to accumulate in similar age-nontransformed Shahdara plants. Again, TMV-V1087I showed a reduced ability to accumulate in 35S::IAA26-P108L-GFP plants (Fig. 7B). Combined, these findings indicate that the accumulation of IAA26-P108L-GFP affects TMV-V1087I infection, even in young host tissues.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The obligate association of viruses with their hosts affects all aspects of the infection process and often results in physiological alterations and disease symptoms that impact plant production. In addition, the display of disease symptoms is often modulated by the developmental status of the host and its surrounding environment. Yet very little information exists regarding the mechanisms through which viruses affect host physiology and induce disease. Even less is known about the roles host development and the environment play in promoting virus diseases. In this study, we demonstrate the importance of an interaction between the TMV replicase and host-derived auxin-mediated transcription regulators in promoting virus infection under select host conditions.

Previous findings confirmed that replicase-Aux/IAA interactions affect the transcriptional activation of auxin-responsive genes and correspond to the induction of developmental disease symptoms in Arabidopsis (32, 33). Furthermore, the TMV replicase was shown to interact with and disrupt the nuclear localization of several related Arabidopsis Aux/IAA proteins (33). We have now identified a tomato Aux/IAA protein that shares homology with AtIAA26 as well as interacts with the TMV helicase domain and displays reduced nuclear localization within TMV-infected tissues. Virus-like symptoms were also observed in tomato plants silenced for LeIAA26, indicating that the functional disruption of LeIAA26 also disrupts host physiology in tomato plants. These findings are similar to the effects of Aux/IAA interactions identified for Arabidopsis and suggest this interaction is conserved among TMV hosts and thus potentially involved in the infection process.

Auxin is a key plant hormone and plays an important role in promoting plant growth and development. Alterations in the auxin regulatory pathway clearly affect host physiology and could potentially alter the cellular environment during infection. Yet, our previous studies failed to identify what advantage if any TMV gained through the interaction and disruption of specific Aux/IAA proteins. One possibility is that this interaction functions to alter the physiology of an infected cell to make it more compatible for virus replication and spread. In our original study, a TMV helicase mutant, TMV-V1087I, with a reduced ability to interact with host Aux/IAA proteins did not replicate or spread at a level significantly different from wt TMV (32). However, in these initial studies, we utilized only highly susceptible young plants for infectivity assays. In subsequent studies, we observed that TMV-V1087I is reduced in accumulation compared to the wt virus but only in older fully developed leaf tissues. This finding suggests that the developmental or physiological age of inoculated tissue can affect TMV propagation.

Expression data available via Genevestigator indicate that IAA26 transcripts accumulate to similar levels in juvenile, adult, and senescent Arabidopsis leaves (39, 49). However, auxin levels regulating gene transcription are typically higher in younger tissues (14, 27, 28). Using a transgenically expressed GFP-tagged IAA26 protein, we confirmed that although transcriptionally active in both young and old tissues, IAA26-GFP protein accumulated to detectable levels only in older mature leaf tissues. IAA26-GFP accumulation in older tissue also corresponded with decreased mRNA levels of the auxin receptor and Aux/IAA-targeting F-box protein TIR1. As described above, TIR1 transcripts can be regulated via gene silencing by microRNA mi393 (30). Interestingly, mir393 has been shown to be upregulated in response to several abiotic stresses, including dehydration (40). In preliminary studies, we have also noted that TMV-V1087I produces smaller and more-restricted local lesions on drought-stressed tobacco plants than does the wt virus (data not shown). This drought-induced variation occurs independent of plant age, indicating that environmental factors also appear to influence the functional importance of the replicase-Aux/IAA interaction during virus infection. This finding is consistent with the proposed regulation of Aux/IAA proteins by TIR1 and suggests that any factor affecting the auxin-targeted degradation of Aux/IAA proteins could affect TMV infection.

Additional evidence linking the accumulation of an interacting Aux/IAA protein to the effects on TMV infection is found in studies demonstrating the poor accumulation of TMV-V1087I in older leaf tissue and in tissues that accumulate an auxin-resistant mutant, IAA26-P108L-GFP. Thus, the inability of TMV-V1087I to accumulate to wt levels corresponds with the accumulation of interacting Aux/IAA proteins, either in older tissues where there is less auxin-mediated degradation of Aux/IAA proteins or in tissues expressing an auxin degradation-resistant form of IAA26. These findings suggest that interacting Aux/IAA proteins regulate cellular factors that affect virus infection. The ability to affect Aux/IAA function could therefore provide an important advantage to TMV in establishing an infection. We propose that TMV disrupts interacting Aux/IAA functions as a means of manipulating its cellular environment and promoting its own replication and spread. The ability to reprogram its cellular environment represents a significant advantage for a virus such as TMV, whose plant-to-plant spread is dependent upon mechanical damage that may occur within any-age tissue or diverse environmental conditions. Thus, the replicase-Aux/IAA interaction could serve to enhance infections that occur initially within less-productive or stressed host tissues.

The importance of plant age and environment has long been known to affect the outcome of virus infections. Specifically for TMV, the developmental age of an inoculated leaf has been shown to affect the number of infection sites, with young expanded tobacco leaves producing more infection sites than older expanded leaves (41). In fact, plant age has often been reported as a key factor influencing disease. In general, older plants produce milder or fewer infections and less disease than plants inoculated at a young age. This age-related phenomenon has been termed "mature plant resistance" and has been attributed to the physiological changes, such as reduced ribosome content, that occur during leaf maturation (20). However, a mechanistic understanding for this type of resistance is unknown. The interaction and disruption of Aux/IAA proteins by the TMV replicase and the correspondence of this interaction with the ability of the virus to accumulate in older host tissues may represent one such mechanism whereby TMV overcomes this age-related resistance phenomenon.

Replicase-Aux/IAA interactions also correspond with the induction of developmental disease symptoms (32). In terms of evolution, virus-host interactions that result in minimal perturbations in host biology would presumably be favored, since there is no evident advantage gained from damaging the host. However, disease development remains a constant for many virus-host combinations. This suggests that disease may be an indispensable result of a successful infection. Supporting this possibility are studies linking virus-host interactions needed for infection to the induction of disease. For example, the need to escape host RNA interference defenses appears to outweigh physiological disruptions in the host's microRNA pathway caused by virus-encoded RNA interference suppressors (4). The physiological changes caused by the TMV replicase-Aux/IAA interaction apparently do not significantly affect infection, at least in young leaf tissue where both Aux/IAA-interacting and -noninteracting viruses replicate and move similarly (32). Based on this finding, the disease symptoms associated with the TMV replicase-Aux/IAA interaction appear to impart no significant cost to the virus in terms of completing its life cycle. Thus, the advantage conferred by enhanced virus accumulation in older tissues may function to maintain this interaction and the disease symptoms it induces.

 
This work was supported in part by a National Research Initiative Competitive Grant (2005-35319-16099) from the USDA Cooperative State Research, Education, and Extension Service and by the National Science Foundation (IBN-0113536).

 
* Corresponding author. Mailing address: Center for Biosystems Research, University of Maryland Biotechnology Institute, College Park, MD 20742. Phone: (301) 405-2912. Fax: (301) 314-9075. E-mail: jculver{at}umd.edu

Published ahead of print on 19 December 2007.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Abel, S., P. W. Oeller, and A. Theologis. 1994. Early auxin-induced genes encode short-lived nuclear proteins. Proc. Natl. Acad. Sci. USA 91:326-330.[Abstract/Free Full Text]
2
2. Abramoff, M. D., P. J. Magelhaes, and S. J. Ram. 2004. Image processing with Image J. Biophotonics Int. 11:36-42.
3
3. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
4
4. Chapman, E. J., A. I. Prokhnevsky, K. Gopinath, V. V. Dolja, and J. C. Carrington. 2004. Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. Genes Dev. 18:1179-1186.[Abstract/Free Full Text]
5
5. Clark, K. L., P. B. Larsen, X. Wang, and C. Chang. 1998. Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors. Proc. Natl. Acad. Sci. USA 95:5401-5406.[Abstract/Free Full Text]
6
6. Clough, S. J., and A. Bent. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16:735-743.[CrossRef][Medline]
7
7. Culver, J. N., and M. S. Padmanabhan. 2007. Virus-induced disease: altering host physiology one interaction at a time. Annu. Rev. Phytopathol. 45:221-243.[CrossRef][Medline]
8
8. Dardick, C. D., S. Golem, and J. N. Culver. 2000. Susceptibility and symptom development in Arabidopsis thaliana to Tobacco mosaic virus is influenced by virus cell-to-cell movement. Mol. Plant-Microbe Interact. 13:1139-1144.[CrossRef][Medline]
9
9. Deshaies, R. J. 1999. SCF and Cullin/Ring H2-based ubiquitin ligases. Annu. Rev. Cell Dev. Biol. 15:435-467.[CrossRef][Medline]
10
10. Dharmasiri, N., S. Dharmasiri, and M. Estelle. 2005. The F-box protein TIR1 is an auxin receptor. Nature 435:441-445.[CrossRef][Medline]
11
11. Dharmasiri, N., and M. Estelle. 2004. Auxin signaling and regulated protein degradation. Trends Plant Sci. 9:302-308.[CrossRef][Medline]
12
12. dos Reis Figueira, A., S. Golem, S. P. Goregaoker, and J. N. Culver. 2002. A nuclear localization signal and a membrane association domain contribute to the cellular localization of the Tobacco mosaic virus 126-kDa replicase protein. Virology 301:81-89.[CrossRef][Medline]
13
13. Durfee, T., K. Becherer, P. L. Chen, S. H. Yeh, Y. Yang, A. E. Kilburn, W. H. Lee, and S. J. Elledge. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555-569.[Abstract/Free Full Text]
14
14. Esmon, C. A., A. G. Tinsley, K. Ljung, G. Sandberg, L. B. Hearne, and E. Liscum. 2006. A gradient of auxin and auxin-dependent transcription precedes tropic growth responses. Proc. Natl. Acad. Sci. USA 103:236-241.[Abstract/Free Full Text]
15
15. Finer, J. J., P. Vain, M. W. Jones, and M. D. McMullin. 1992. Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Rep. 11:323-328.
16
16. Golem, S., and J. N. Culver. 2003. Tobacco mosaic virus induced alterations in the gene expression profile of Arabidopsis thaliana. Mol. Plant-Microbe Interact. 16:681-688.[Medline]
17
17. Goregaoker, S. P., D. J. Lewandowski, and J. N. Culver. 2001. Identification and functional analysis of an interaction between domains of the 126/183-kDa replicase-associated proteins of Tobacco mosaic virus. Virology 282:320-328.[CrossRef][Medline]
18
18. Gray, W. M., S. Kepinski, D. Rouse, O. Leyser, and M. Estelle. 2001. Auxin regulates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature 414:271-276.[CrossRef][Medline]
19
19. Hanley-Bowdoin, L., S. Settlage, and D. Robertson. 2004. Reprogramming plant gene expression: a prerequisite to geminiviurs DNA replication. Mol. Plant Pathol. 5:149-156.[CrossRef]
20
20. Hull, R. 2002. Matthews’ plant virology. Elsevier Academic Press, San Diego, CA.
21
21. Kepinski, S., and O. Leyser. 2005. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435:446-451.[CrossRef][Medline]
22
22. Kim, J., K. Harter, and A. Theologis. 1997. Protein-protein interactions among the Aux/IAA proteins. Proc. Natl. Acad. Sci. USA 94:11786-11791.[Abstract/Free Full Text]
23
23. Kong, L. J., B. M. Orozco, J. L. Roe, S. Nagar, S. Ou, H. S. Feiler, T. Durfee, A. B. Miller, W. Gruissem, D. Robertson, and L. Hanley-Bowdoin. 2000. A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J. 19:3485-3495.[CrossRef][Medline]
24
24. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
25
25. Leyser, O. 2002. Molecular genetics of auxin signaling. Annu. Rev. Plant Biol. 53:377-398.[CrossRef][Medline]
26
26. Liu, Y., M. Schiff, and S. P. Dinesh-Kumar. 2002. Virus-induced gene silencing in tomato. Plant J. 31:777-786.[CrossRef][Medline]
27
27. Ljung, K., R. P. Bhalerao, and G. Sandberg. 2001. Sites and homeostatic control of auxin biosynthesis in Arabidopsis during vegetative growth. Plant J. 28:465-474.[CrossRef][Medline]
28
28. Ljung, K., A. K. Hull, M. Kowalczyk, A. Marchant, J. Celenza, J. D. Cohen, and G. Sandberg. 2002. Biosynthesis, conjugation, catabolism and homeostasis of indole-3-acetic acid in Arabidopsis thaliana. Plant Mol. Biol. 49:249-272.[CrossRef][Medline]
29
29. McCabe, D. E., W. F. Swain, B. J. Martinel, and P. Christou. 1988. Stable transformation of soybean (Glycine max) by particle acceleration. Bio/Technology 6:923-926.[CrossRef]
30
30. Navarro, L., P. Dunoyer, F. Jay, B. Arnold, N. Dharmasiri, M. Estelle, O. Voinnet, and J. D. Jones. 2006. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312:436-439.[Abstract/Free Full Text]
31
31. Ouellet, F., P. J. Overvoorde, and A. Theologis. 2001. IAA17/AXR3: biochemical insight into an auxin mutant phenotype. Plant Cell 13:829-841.[Abstract/Free Full Text]
32
32. Padmanabhan, M. S., S. P. Goregaoker, S. Golem, H. Shiferaw, and J. N. Culver. 2005. Interaction of the tobacco mosaic virus replicase protein with the Aux/IAA protein PAP1/IAA26 is associated with disease development. J. Virol. 79:2549-2558.[Abstract/Free Full Text]
33
33. Padmanabhan, M. S., H. Shiferaw, and J. N. Culver. 2006. The Tobacco mosaic virus replicase protein disrupts the localization and function of interacting Aux/IAA proteins. Mol. Plant-Microbe Interact. 19:864-873.[CrossRef][Medline]
34
34. Park, J. Y., H. J. Kim, and J. Kim. 2002. Mutation in domain II of IAA1 confers diverse auxin-related phenotypes and represses auxin-activated expression of Aux/IAA genes in steroid regulator-inducible system. Plant J. 32:669-683.[CrossRef][Medline]
35
35. Ramos, J. A., N. Zenser, O. Leyser, and J. Callis. 2001. Rapid degradation of auxin/indoleacetic acid proteins requires conserved amino acids of domain II and is proteasome dependent. Plant Cell 13:2349-2360.[Abstract/Free Full Text]
36
36. Reed, J. W. 2001. Roles and activities of Aux/IAA proteins in Arabidopsis. Trends Plant Sci. 6:420-425.[CrossRef][Medline]
37
37. Rogg, L. E., J. Lasswell, and B. Bartel. 2001. A gain-of-function mutation in IAA28 suppresses lateral root development. Plant Cell 13:465-480.[Abstract/Free Full Text]
38
38. Rojas, M. R., C. Hagen, W. J. Lucas, and R. L. Gilbertson. 2005. Exploiting chinks in the plant's armor: evolution and emergence of geminiviruses. Annu. Rev. Phytopathol. 43:361-394.[CrossRef][Medline]
39
39. Schmid, M., T. S. Davison, S. R. Henz, U. J. Pape, M. Demar, M. Vingron, B. Scholkopf, D. Weigel, and J. U. Lohmann. 2005. A gene expression map of Arabidopsis thaliana development. Nat. Genet. 37:501-506.[CrossRef][Medline]
40
40. Sunkar, R., and J. K. Zhu. 2004. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16:2001-2019.[Abstract/Free Full Text]
41
41. Takahashi, T. 1972. Studies on viral pathogenesis in plant hosts. III. Leaf age-dependent susceptibility to tobacco mosaic virus in ‘Samsun NN’ and ‘Samsun’ tobacco plants. Phytopathol. Z. 75:140-155.
42
42. Takeuchi, Y., M. Dotson, and N. T. Keen. 1992. Plant transformation: a simple particle bombardment device based on flowing helium. Plant Mol. Biol 18:835-839.[CrossRef][Medline]
43
43. Teale, W. D., I. A. Paponov, and K. Palme. 2006. Auxin in action: signalling, transport and the control of plant growth and development. Nat. Rev. Mol. Cell Biol. 7:847-859.[CrossRef][Medline]
44
44. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
45
45. Ulmasov, T., Z. B. Liu, G. Hagen, and T. J. Guilfoyle. 1995. Composite structure of auxin response elements. Plant Cell 7:1611-1623.[Abstract]
46
46. Ulmasov, T., J. Murfett, G. Hagen, and T. J. Guilfoyle. 1997. Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9:1963-1971.[Abstract]
47
47. Xie, Q., A. P. Sanz-Burgos, H. Guo, J. A. Garcia, and C. Gutierrez. 1999. GRAB proteins, novel members of the NAC domain family, isolated by their interaction with a geminivirus protein. Plant Mol. Biol. 39:647-656.[CrossRef][Medline]
48
48. Zenser, N., K. A. Dreher, S. R. Edwards, and J. Callis. 2003. Acceleration of Aux/IAA proteolysis is specific for auxin and independent of AXR1. Plant J. 35:285-294.[CrossRef][Medline]
49
49. Zimmermann, P., M. Hirsch-Hoffmann, L. Hennig, and W. Gruissem. 2004. GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol. 136:2621-2632.[Abstract/Free Full Text]

---

Journal of Virology, March 2008, p. 2477-2485, Vol. 82, No. 5
0022-538X/08/$08.00+0     doi:10.1128/JVI.01865-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Padmanabhan, M. S. Articles by Culver, J. N. Search for Related Content PubMed PubMed Citation Articles by Padmanabhan, M. S. Articles by Culver, J. N.