Previous Article | Next Article ![]()
Journal of Virology, March 2008, p. 2376-2384, Vol. 82, No. 5
0022-538X/08/$08.00+0 doi:10.1128/JVI.02100-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan 48109-0620,1 Global AIDS Program, CDC-Haiti, Port-au-Prince, Haiti2
Received 21 September 2007/ Accepted 12 December 2007
|
|
|---|
|
|
|---|
Whereas recombinogenic template switching occurs during the synthesis of essentially every retroviral DNA, marker segregation can result only for virions in which two different RNAs were copackaged. Although there is some evidence that individual cell coinfection is common in human immunodeficiency virus (HIV)-infected individuals (16), it is likely that many retroviruses are the products of singly infected cells and therefore contain two RNAs that, barring errors introduced by host RNA polymerase II, are identical. Thus, recombinogenic template switching is often genetically silent. Retroviruses presumably gain a selective advantage by copackaging two copies of their genome and using both as templates during reverse transcription. However, the nature of this advantage is uncertain.
Based primarily on the results of cell-free reverse transcriptase reactions, it was suggested previously that template switching might be error prone and thus an important source of genetic variation (27). However, studies examining crossover junctions generated during retroviral replication appear to refute this speculation. Although most such studies have been performed with simple retroviruses and thus may not pertain to HIV type 1 (HIV-1), these analyses suggest that whereas high-frequency errors do occur at the required first-strand transfer site (19), recombinogenic template switching is not particularly error prone (4, 29, 36, 42, 44).
Another possible advantage conferred by template switching is that it might serve as a fidelity mechanism and promote genomic stability. The "forced copy choice" model for retroviral recombination, which suggests that reverse transcriptase template switching results when reverse transcriptase encounters a template RNA break, was conceived to explain how retroviruses could replicate broken RNA genomes (7). Template breakage is likely not required for recombinogenic template switching, since parameters that should not affect RNA integrity, such as mutations in reverse transcriptase (5, 14) or limiting deoxynucleotide concentrations (15, 23, 30), appear capable of influencing recombination rates at least as much as RNA damage (13). Nonetheless, template switching may contribute to replication error avoidance by serving as a salvage pathway for reverse transcription elongation complexes that are halted by conditions such as template damage, substrate limitation, or enzymatic defects.
A prediction of forced copy choice recombination models is that retroviral replication errors should increase under conditions where template switching is not possible, as would be the case if a reverse transcription complex contained only a single RNA template of a particular genome segment instead of the normal homdimeric RNA genome. The experiments presented here tested this prediction and showed that preventing homologous template switching by reducing template copy numbers correlated with higher gene inactivation rates and lower frequencies of intact genome synthesis.
|
|
|---|
Plasmids.
pHEF-VSVG (6) is a vesicular stomatitis virus (VSV) G protein expression construct that was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, from Lung-Ji Chang. pCMV
R8.2 (22) encodes all HIV-1 proteins except the envelope glycoproteins and Vpu.
pCMVLacSV40Puro, which encodes an HIV-1-based vector that expresses lacZ from the cytomegalovirus (CMV) immediate-early promoter and puromycin resistance from an SV40 promoter, was previously called pHIVlac (1). The SV40 promoter in pCMVLacSV40Puro was replaced with the Rous sarcoma virus (RSV) promoter (nucleotides 483 to 806 from pREP8; Invitrogen) to produce pCMVLacRSVPuro. To generate pCMV S/D- LacRSVPuro, the CMV promoter in pCMVLacRSVPuro was altered by site-directed mutagenesis so that the putative splice donor site (ACGGTAAAT) was changed to TTCCGTCTC.
A minimal HIV-based "empty" vector, pEmpty, was produced from pCMVLacSV40Puro by replacing the internal promoters and genes plus downstream long terminal repeat (LTR) with an altered 3'-LTR. The 3'-LTR fragment was produced by overlapping PCR using the primers 5'-CCATCGATAAGACAAGATATCCTTGATCTGTGGA-3', 5'-GCGGAAAGTCCCTTGTAGCA-3', 5'-AGGGACTTTCCGCACTAGTTCTGGTTAGACCAGATCTGAG-3', and 5'-CTGCAGACTTGAAGCACTCAAGGCAAGCT-3'. The resulting PCR fragment was digested with ClaI plus PstI and used to replace the corresponding fragment in pCMVLacSV40Puro. As a result, the 3' end of the RNA encoded by pEmpty lacked the polypurine tract and most of the 3' LTR, including R sequences required to accept minus-strand transfer products. An additional retroviral vector, called pCMVLacSV40, was produced from pCMVLacSV40Puro by replacing the puromycin resistance gene and downstream LTR with the altered 3'-LTR described above.
Virus production and infection. 293T cells were transfected with expression clones by calcium phosphate precipitation (40) to produce replication-defective HIV particles bearing VSV G envelope protein. Virus-containing medium was harvested from 293T cells at 48 and 72 hours posttransfection, passed through 0.2-µm filters, and stored at –70°C.
Fresh 293T cells were infected with retroviral vectors and selected in 1 µg/ml puromycin at 48 hours postinfection. Twelve days later, puromycin-resistant colonies were fixed and stained with X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) for β-galactosidase activity as described previously (3). Viral vectors were produced for serial passage by transfecting pools of puromycin-resistant clones with helper plasmids (pHEF-VSVG and pCMV
R8.2), and the resulting virions were harvested for further infections at 2 days posttransfection. To infect hydroxyurea (HU)-treated cells, 293T cells were pretreated with the indicated concentrations of HU (Sigma-Aldrich, St. Louis, MO) for 2 hours and the medium was replaced with medium containing fresh HU and retroviral particles. At 12 hours postinfection, the medium was replaced with medium containing 200 µM zidovudine (AZT), and colonies were selected in puromycin and stained with X-Gal as described above. Where indicated, cells were exposed to 200 µM AZT at 1.5 h postinfection to limit the time available to complete reverse transcription.
Integrated provirus structure analysis. Individual puromycin-resistant colonies were expanded and divided to generate duplicate samples of cloned cells for X-Gal staining and for DNA preparation. Total cell DNA was prepared using the DNeasy tissue kit (Qiagen, Valencia, CA). Integrated HIV vectors were amplified by PCR using the following primer pairs (numbering refers to coordinates of the CMVLacSV40Puro proviral sequence and F or R to forward or reverse primers, respectively): 205F, CGACAGGCCCGAAGGAATA; 955R, GTAAAACGACGGGATCTAGCATG; 931F, TCCATGCTAGATCCCGTCG; 1683R, TAGGTAGTCACGCAACTCGCC; 1563F, GCTGCATAAACCGACTACACAAA; 2313R, GTGGCCTGATTCATTCCCC; 2259F, CGATCGTAATCACCCGAGTGT; 3014R, ACTGTGAGCCAGAGTTGCCC; 2784F, ACACCAGCAGCAGTTTTTCCA; 3539R, GCCACTTCAACATCAACGGTAAT; 5221F, GGATTGATGGTAGTGGTCAAATG; 6075R, CCTCACTACTTCTGGAATAGCTCAG; 6348F, GGAGAGCGTCGAAGCG; and 6623R, TAGAAGGGGAGGTTGCGG. Primers were removed from the amplified fragments using the QIAquick PCR purification kit (Qiagen, Valencia, CA) or by agarose gel electrophoresis and purification using the QIAquick gel extraction kit (Qiagen, Valencia, CA). All puromycin-resistant cell clones yielded puro-specific PCR products. When lack of another PCR product indicated a proviral deletion, alternate primer pairs were used to generate deletion junction-containing fragments. The nucleotide sequences of PCR fragments were determined by the University of Michigan DNA Sequencing Core Facility.
|
|
|---|
![]() View larger version (20K): [in a new window] |
FIG. 1. Plasmids used to express HIV-based retroviral vectors, as described in the text. CMV, SV40, and RSV indicate promoters from the respective viruses. CMV S/D– indicates a variant CMV promoter cassette in which a putative 5' splice site was mutationally inactivated. The diagrams are not precisely to scale.
|
To calibrate the assay used here and address the relative contributions of lacZ inactivation and of positional effects to total white-colony formation, a population of CMVLacSV40Puro vectors was passaged serially for five sequential single rounds of replication in 293T cells (Fig. 2). This was achieved as follows. After one round of vector reverse transcription and integration, the population of infected cells was selected in puromycin. One plate of puromycin-resistant cells was X-Gal stained to generate the white-colony percentage data presented in Fig. 2, while the colonies on a duplicate plate were pooled. The integrated viral vectors in this infected cell pool were then remobilized by transfection with helper function plasmids. To perform a subsequent round of reverse transcription, the resulting viral particles were used to infect duplicate plates of fresh cells: one to score for X-Gal staining and the other as a source of integrated vectors for a subsequent round of remobilization.
![]() View larger version (14K): [in a new window] |
FIG. 2. Accumulation of lacZ mutations during serial passage of CMVLacSV40Puro. Viral particles containing two CMVLacSV40Puro genomes were serially passaged on 293T cells, and mutations in the lacZ indicator gene were monitored by determining the number of white colonies following staining with X-Gal. The solid line connects the mean data from three experiments, and the error bars represent standard deviations of the means. The dotted line represents the least-squares fit for a line representing the data by the equation y = 5.8x + 2.7 (r2 = 0.92).
|
The results showed that serial passage of CMVLacSV40Puro resulted in a nearly linear increase in white colonies over sequential rounds of viral replication (Fig. 2). Approximately 10% of all puromycin-resistant colonies showed no detectable β-galactosidase activity after one round of infection, with this number increasing to 35% white colonies following five rounds of reverse transcription. These data suggest that CMVLacSV40Puro vectors accumulated lacZ-inactivating mutations at a rate of approximately 6% per replication cycle (linear slope), with a frequency of white colonies due to positional effects of about 3% (y intercept). Note that relatively few products of reverse transcription conditions where this background appears significant (e.g., pseudodiploid genomes from untreated cells and single replication cycles) were characterized in this study, and whether or not detected point mutations inactivated lacZ was not rigorously explored. Thus, the sequencing analyses described below lack the power to confirm this deduced position effect value.
Comparing defective product frequencies with one or two copies of lacZ template RNA. To test the hypothesis that template switching contributes to replication fidelity, a skewed vector expression approach was used to produce viral particles containing predominantly single copies of lacZ (26). When two different HIV-1-based RNAs are coexpressed in individual virus-producing cells, the vector RNAs segregate into virions at random, generating encapsidated RNA homo- and heterodimers in proportions predictable by the Hardy-Weinberg equation (10). Thus, experimentally, RNA dimer proportions in HIV-1 populations can be controlled by altering vector coexpression ratios.
Here, generating haploid virions containing a single RNA copy of lacZ involved coexpressing pCMVLacSV40Puro with a molar excess of an additional vector plasmid called pEmpty (Fig. 1). pEmpty was produced by deleting lacZ, the puromycin resistance gene, and their respective promoters from pCMVLacSV40Puro, as well as ablating sequences needed for reverse transcription from the downstream LTR. As a result, pEmpty generated a short RNA vector that could heterodimerize with CMVLacSV40Puro RNA to facilitate its packaging but that could not contribute, either directly or via homologous recombination, to the production of puromycin resistance-conferring proviruses. RNase protection assays showed that vectors produced by transfection with a 20-fold molar excess of pEmpty compared to pCMVLacSV40Puro contained an average of 25-fold more Empty than CMVLacSV40Puro RNA copies, thus confirming that pEmpty was efficiently expressed and encapsidated (data not shown). In addition, the molecular analysis of CMVLacSV40Puro proviral products of heterozygous virions confirmed that recombination with Empty RNAs was not detected in puromycin-resistant proviruses (see below).
In the skewed vector approach used here, producer cells were transfected with a 20-fold molar excess of pEmpty over pCMVLacSV40Puro, the resulting virions were harvested, and fresh cells were infected and selected in puromycin. The puromycin resistance colony-forming titer that was observed under these conditions was reduced 100-fold relative to that for virions produced without pEmpty cotransfection. From a 20:1 cotransfection ratio, virions containing CMVLacSV40Puro homodimers, CMVLacSV40Puro/Empty heterodimers, or Empty RNA homodimers are predicted to arise at 0.2%, 9.1%, and 90.7%, respectively, according to the Hardy-Weinberg equation. Thus, much but not all of the observed titer reduction could be explained by predicted proportions of Empty vector homodimers. Of the predicted 9.3% of all particles that should be capable of producing puromycin resistance-conferring proviruses from a 20:1 transfection, 98% should contain a single copy of lacZ RNA.
Using this approach, the frequencies of lacZ-inactivating mutations arising during reverse transcription of virions with RNA genome populations comprised either of principally a single lacZ template or of two gene copies were compared (Fig. 3A). Initial results comparing white-colony titers for single-copy lacZ vectors to those for two lacZ templates revealed a modest, albeit consistent, twofold increase in apparent lacZ inactivation rates in the absence of a second lacZ gene copy (Fig. 3A [data from experiments with 0 mM HU]).
![]() View larger version (29K): [in a new window] |
FIG. 3. lacZ inactivation frequencies for haploid and pseudodiploid genome virions. (A) Effects of template copy number on mutation frequency. Vectors containing either two copies or primarily a single copy of lacZ were used to infect 293T cells in a single-round infection assay. Each point represents the mean from four experiments, with error bars showing the standard errors. (B) Error rates for heterozygous virions with one or with primarily two lacZ gene copies. Bars represent the means from two experiments, with error bars showing the standard deviations of the means.
|
Confirming that lacZ gene copy number, and not RNA heterodimerization, affects white-colony product frequency. An additional test was performed to ensure that the skewed RNA expression approach used to generate vectors with a single lacZ template did not cause the observed high lacZ inactivation frequency. For this approach, a new vector called pCMVLacSV40 was created, in which the intact lacZ gene was retained but from which the puromycin resistance coding sequences of pCMVLacSV40Puro were deleted (Fig. 1). Most virions capable of conferring puromycin resistance that were generated in the presence of excess CMVLacSV40 RNA (which replaces Empty RNA in the experiments here) and limiting CMVLacSV40Puro RNA would be predicted to contain RNA heterodimers with two copies of lacZ but only one puro gene copy. Fresh cells infected with virions produced under these conditions displayed low puromycin resistance titers similar to those of CMVLacSV40Puro/Empty heterodimers. However, as shown in Fig. 3B, in either the presence or absence of HU, the lacZ inactivation rate among products of CMVLacSV40Puro/ CMVLacSV40 heterodimeric virions was indistinguishable from rates with CMVLacSV40Puro homodimers. These results contrasted with the marked increase in white colonies observed for CMVLacSV40Puro/Empty heterodimer products and support the notion that the higher white colony frequency observed during infection with single-lacZ-copy virions was primarily dependent on the lacZ copy number.
Addressing contributions of packaged subgenomic RNAs to haploid genome-associated replication defects. Extracting proviral sequences by PCR from infected cell clones revealed that one 4-kilobase deletion arose at a high frequency (Fig. 4A). This common deletion, which was observed in nearly 60% of all analyzed CMVLacSV40Puro white proviruses, was generated by haploid and by pseudodiploid RNA genomes and whether or not cells were treated with HU.
![]() View larger version (43K): [in a new window] |
FIG. 4. Effects of eliminating potential subgenomic spliced product. (A) Schematic illustration of pCMVLacSV40Puro, indicating the positions and sequences of potential splice donor and acceptor sites. Numbers 2056 and 6025 indicate the vector map positions that comprise the common 4-kb deletion's junctions; the residues indicated in uppercase were retained in the deletion product, whereas nucleotides indicated in lowercase were deleted. The major class splicing consensus sequence is from reference 37. (B) lacZ inactivation frequencies for haploid and pseudodiploid genome virions. A comparison of observed values for vectors that possessed the major putative splice sites (CMVLacRSVPuro), for one that lacked the putative splice acceptor (CMVLacSV40Puro), and for one that lacked both putative splice donor and splice acceptor (CMV S/D-LacRSVPuro) is shown. Mutations in the lacZ indicator gene were measured as the number of white colonies following staining with X-Gal. Bars show the means from two experiments, with error bars representing the standard deviations of the means.
|
These new vectors were then tested to address whether or not mutating these putative splice junctions would eliminate haploid genome-associated increases in lacZ inactivation rates. Each of the three lacZ-puro vectors was expressed either alone or in the presence of excess pEmpty, and the resulting virions were used to direct one round of replication in either untreated or HU-treated cells (Fig. 4B). The results revealed that all three lacZ-puro vectors, when reverse transcribed from haploid genomes produced by transfection with an excess of pEmpty, exhibited higher white-colony frequencies than the corresponding products from homodimeric virions (Fig. 4B). As had been observed for CMVLacSV40Puro, increases in white-colony formation were more pronounced in the presence of HU for both the vector derivatives (right half of Fig. 4B). These results confirmed the correlation between lacZ RNA template copy number and proviral error rates and indicated that the high-frequency putative spliced RNA products of CMVLacSV40Puro were not solely responsible for the higher white-colony rates observed with single-copy lacZ vectors. Thus, the property of enhanced defective genome synthesis correlated with imbalanced gene copy number, even in the absence of the previous major product.
Assessing the spectra of lacZ-inactivating mutations. The lacZ genes from many individual β-galactosidase-negative proviruses (each templated by one of the three lacZ-puro vectors, expressed either alone or with excess pEmpty, and reverse transcribed in the presence or absence of HU) were then isolated, mapped, and sequenced (Table 1). Of the total of 82 such white-colony provirus structures summarized in Table 1, 53 contained large deletions in lacZ and 29 differed from the parental sequence only by the possession of one or more small mutations, including point mutations and frameshifts or small deletions revealed only by DNA sequencing.
|
View this table: [in a new window] |
TABLE 1. Distribution of lacZ mutationsa
|
![]() View larger version (22K): [in a new window] |
FIG. 5. Observed lacZ-puro vector deletion products. (A) Deletions likely generated by spliced templates. The structure expected from an intact CMVLacSV40Puro provirus is shown together with putative 5' (S/D1 and S/D2) and 3' (S/A1 to -5) deletion junctions revealed by molecular analysis of individual reverse transcription products (note that the S/D and S/A presented in Fig. 4 are the same as S/D1 and S/A5 here). Numbers indicate map positions of the deletion junctions relative to the intact provirus, where 1 is the first nucleotide in the 5' LTR. Deletion junction sequences that remained in deleted replication products are shown in uppercase, while deleted sequences are in lowercase. (B) Deletion junctions generated by nonhomologous recombination. Examples of deletions that lack putative splicing signals and were likely generated by nonhomologous recombination are shown. The clone number is indicated on the left. Numbers above and below each deletion junction indicate the nucleotide positions relative to the intact provirus, where 1 is the first nucleotide in the 5' LTR. Sequence homologies at deletion junctions are boxed. Clones 3, 107, and 417 were generated by infection with CMVLacSV40Puro, while clones 502 and 546 were produced using CMVLacRSVPuro. Clone 546 contained an 11-nucleotide insertion that, when used in a BLAST query with its flanking viral sequences, revealed 19 nucleotides that matched sequences located on human chromosome 20 (GenBank accession no. AL359828), possibly indicating that it contained a transductive insertion (9). Clones 910, 927, and 963 were generated during shortened periods of reverse transcription (see Fig. 6) by CMVLacSV40Puro, CMVLacRSVPuro, or CMVS/D– LacRSVPuro, respectively.
|
Taken together, these data indicate that most if not all of the deletions observed in lacZ-puro vector products can be explained either by the ability of reverse transcriptase to use spliced subgenomic RNA templates or by viral nonhomologous recombination.
In contrast to the deletion derivatives characterized above, 29 of the 82 "white-colony" proviruses did not contain length variation but instead were revealed by sequencing to differ from the parental sequence by point mutations in lacZ. Although point mutations appeared to contribute to lacZ inactivation less frequently than deletions, some clones contained multiple changes, with as many as 10 point mutations in a single mutant lacZ gene (data not shown). Interestingly, 27 of the total of 51 observed nucleotide substitutions were G-to-A transitions.
Although the numbers of sequences considered here limit the statistical power of these interpretations, when all products of the three vectors were considered together, the following trends emerged. Of 12 clones generated by pseudodiploid virions in the absence of HU, 8 were inactivated by point mutations (Table 1, rows 1, 5, and 9), while 4 contained deletions. Among 14 proviruses templated by homodimerized RNAs in cells treated with HU, 8 contained nucleotide substitutions and 6 contained deletions (Table 1, rows 2, 6, and 10). Thus, the defective reverse transcription products generated by vectors containing two lacZ templates included approximately equal proportions of alleles with lacZ-inactivating point mutations and with deletions.
In contrast, clones resulting from infection with single-gene-copy lacZ vectors predominantly contained deletions (Table 1, rows 3, 4, 7, 8, 11, and 12). Thirteen analyzed clones generated by haploid vectors in untreated cells contained deletions, while only three were disrupted by point mutations. Among 41 analyzed products of haploid vectors reverse transcribed in HU-treated cells, 31 contained deletions and only 10 contained point mutations (Table 1, rows 4, 8, and 12).
Assessing underrepresentation of intact genome products at early time points during reverse transcription. Cataloging of defective reverse transcription products (Table 1 and discussed above) showed that the spliced-RNA-templated 4-kb CMVLacSV40Puro deletion was observed among products generated with or without HU treatment and among products of both haploid and pseudodiploid homozygous virions. This suggested that the spliced RNA that templated the deletion product was constitutively present in virion RNA populations. These observations also raised the possibility that the reason the spliced RNA's proviral form was overrepresented among haploid genome products was due to disadvantages of full-length genome synthesis in the absence of a second RNA gene copy.
Some of the increased proportions of lacZ inactivation observed in the presence of HU (Fig. 3) may reflect a selective advantage of deletion products, which could be completed faster than full-length lacZ vectors. The half-time to completion of HIV DNA synthesis is about 4 h under optimal intracellular conditions (24), and reverse transcription in the presence of HU takes even longer due to limiting substrate availability (15, 23, 30). Here, single-copy lacZ gene vectors were more prone to generating lacZ inactivation products than were homozygous genomes, and many defective products contained deletions. Thus, we hypothesized that part of the reason that virions containing a single copy of the assayed lacZ gene might be less capable of generating full-length DNAs than were homozygous genomes was that reverse transcriptase elongation for single-gene-copy genomes proceeded less efficiently than when a second copy was present.
To test this hypothesis, proviruses generated during limited durations of DNA synthesis were examined. This approach addressed whether or not the same spectra of deletion products that were enriched by skewed vector ratios also were overrepresented under conditions known to disfavor full-length provirus synthesis. Reverse transcription was disrupted prematurely by treating cells with inhibitory concentrations of AZT at 1.5 h after initiation of infection (Fig. 6). This resulted in roughly 70-fold decreases in proviral product yields, as determined by puromycin resistance titers (not shown). Note that no HU was used in these experiments.
![]() View larger version (37K): [in a new window] |
FIG. 6. lacZ inactivation rates for products of limited-time reverse transcription. AZT was added at either 12 h or 1.5 h postinfection to stop reverse transcription. Mutations in the lacZ indicator gene were measured as the number of white colonies following staining with X-Gal. Bars show the means from two experiments, with error bars representing the standard deviations of the means.
|
|
View this table: [in a new window] |
TABLE 2. Distribution of lacZ mutations in clones generated after limited reverse transcriptiona
|
|
|
|---|
Molecular analysis of individual defective replication products revealed that gene-inactivating mutations were fairly equally divided between point mutations and sequence deletions when virions contained homodimeric, pseudodiploid genomes. Among the point mutations observed, most were G-to-A substitutions, which is suggestive of the activity of the APOBEC3 family of cellular deaminases. These substitutions occurred even though the helper plasmid used encoded Vif (22) and virions were produced in 293T cells, which have little deaminase activity and are permissive for HIV vif mutants (34). Eighteen of 23 observed G-to-A mutations were in the context of GA dinucleotides, which is more consistent with APOBEC3F than 3G activity (20, 35, 39).
In contrast to the error distribution among products of two-gene-copy virions, most defective products generated from single-gene-copy virions contained deletions. Many deletions appeared to be templated by spliced subgenomic RNAs. The spliced RNAs revealed by these reverse transcription products were generated using cryptic splice donors and acceptors that were far downstream of 5' packaging signals, and thus splicing did not interfere with RNA packaging. These spliced RNAs were likely constitutive low-level components of the encapsidated virion RNA population. Although the splice signals observed here resided in nonviral vector sequences, some instances of packaging and reverse transcription of virus-derived subgenomic RNAs have been reported (11, 12). Many deletions that appeared to be mediated by nonhomologous recombination were detected among the defective reverse transcription products studied here as well.
The results reported here suggest that like limiting the time available for reverse transcription by AZT treatment (Fig. 6), reverse transcription using a single template provides conditions that disfavor intact genome synthesis. Under conditions that disfavored full-length genome production, shorter products (templated by spliced RNAs or generated by nonhomologous recombination-mediated deletion) became overrepresented in the proviral population. Note that much of the template copy number-associated difference observed here was evident only when magnified by HU treatment. Additionally, many observed defective products were templated by short, aberrantly spliced RNAs. Thus, although preventing the formation of the predominant spliced product did not relieve template copy number-associated replication defects, as revealed by screening for gene inactivation, the limited numbers of individual products characterized prevent an assessment of whether single-template replication increases defective products solely by disfavoring lengthy product formation or whether there is some influence on nonhomologous template switching or other error rates as well.
Advantages of RNA copackaging for intact genome synthesis, as indicated by the results here, may be important to viral replication in vivo. Some target cells for HIV infection, especially macrophages and resting T cells, are predominantly nondividing cells containing low concentrations of dNTPs (8, 18, 43). The fact that HIV replication is challenged in these cells is supported by the analysis of HIV proviruses from primary patient cells. Many of these proviruses are defective, and significant deletions of viral sequences are common (33). Thus, the virus's pseudodiploid genome organization may be particularly beneficial to successful HIV replication under conditions that increase the time required to complete viral DNA synthesis, such as low dNTP concentrations.
Based on the observations reported here and the remarkable frequency of template switching observed during HIV DNA synthesis (roughly one crossover per kilobase [25, 32, 44]), we propose a model wherein the second copackaged RNA genome is recruited to and serves as part of the reverse transcriptase elongation complex. This model suggests that the presence of the acceptor template may aid processivity by facilitating recombinogenic acceptor template recruitment when the donor template is damaged or other impediments are encountered, and/or it may prevent the formation of secondary structures in the nascent DNA that could impede reverse transcriptase elongation. Evidence for some aspects of the model that secondary RNAs may aid reverse transcriptase processivity, such as the recruitment of acceptor templates into elongating reverse transcription complexes prior to template switching, have been provided previously (28). When templates are broken or elongation is otherwise prevented, the only recourse with a single-copy RNA would be abortive synthesis or deletion, and since nonhomologous recombination occurs only 0.1 to 1% as frequently as homologous recombination, this would decrease proviral yield as well as quality (41). Speculatively, observed titer decreases in excess of those predicted by RNA ratios, as well as the observation of increased frequency of deletions among products templated by single-copy genes, may suggest that the pseudodiploid nature of retroviruses also contributes to the lower frequency of deletion-containing defective-interfering particles observed in retroviral populations than is seen for many other RNA viruses (38).
We thank Wenfeng An for initiating these studies; Vicki Larson for her excellent technical assistance; Alyssa Borders for preparing figures; Leslie Goo, Eric Garcia, and Adewunmi Onafuwa-Nuga for critical readings of the manuscript; and an anonymous reviewer for suggestions on interpretation.
Published ahead of print on 19 December 2007. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»