This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Diehl, W. E.
Right arrow Articles by Hunter, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diehl, W. E.
Right arrow Articles by Hunter, E.

 Previous Article  |  Next Article 

Journal of Virology, November 2008, p. 11140-11151, Vol. 82, No. 22
0022-538X/08/$08.00+0     doi:10.1128/JVI.00269-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Identification of Postentry Restrictions to Mason-Pfizer Monkey Virus Infection in New World Monkey Cells{triangledown}

William E. Diehl,1,2 Elizabeth Stansell,1,2,{dagger} Shari M. Kaiser,3,{ddagger} Michael Emerman,3 and Eric Hunter1,2*

Emory Vaccine Center, Yerkes National Primate Research Center, Emory University, Atlanta, Georgia 30329,1 Department of Pathology, Emory University, 1364 Clifton Road N.E., Atlanta, Georgia 30322,2 Department of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 981093

Received 6 February 2008/ Accepted 8 September 2008


arrow
ABSTRACT
 
TRIM5{alpha} has been shown to be a major postentry determinant of the host range for gammaretroviruses and lentiviruses and, more recently, spumaviruses. However, the restrictive potential of TRIM5{alpha} against other retroviruses has been largely unexplored. We sought to determine whether or not Mason-Pfizer monkey virus (M-PMV), a prototype betaretrovirus isolated from rhesus macaques, was sensitive to restriction by TRIM5{alpha}. Cell lines from both Old World and New World primate species were screened for their susceptibility to infection by vesicular stomatitis virus G protein pseudotyped M-PMV. All of the cell lines tested that were established from Old World primates were found to be susceptible to M-PMV infection. However, fibroblasts established from three New World monkey species specifically resisted infection by this virus. Exogenously expressing TRIM5{alpha} from either tamarin or squirrel monkeys in permissive cell lines resulted in a block to M-PMV infection. Restriction in the resistant cell line of spider monkey origin was determined to occur at a postentry stage. However, spider monkey TRIM5{alpha} expression in permissive cells failed to restrict M-PMV infection, and interference with endogenous TRIM5{alpha} in the spider monkey fibroblasts failed to relieve the block to infectivity. Our results demonstrate that TRIM5{alpha} specificity extends to betaretroviruses and suggest that New World monkeys have evolved additional mechanisms to restrict the infection of at least one primate betaretrovirus.


arrow
INTRODUCTION
 
Infectious betaretroviruses have been isolated from a number of diverse mammalian species, including mice (7, 30), cats (29), sheep (46), and a number of primate species from both the Old World (4, 10, 58) and New World (11, 17, 57, 59, 62). The prototypical members of this retrovirus genera are mouse mammary tumor virus (MMTV) and Mason-Pfizer monkey virus (M-PMV). Both of these viruses have been shown to cause disease in their natural hosts; MMTV was identified based on its ability to cause mammary carcinoma in mice (7), and M-PMV has been shown to cause an AIDS-like disease in juvenile rhesus macaques (28).

In addition to these infectious betaretroviruses, a large number of betaretrovirus-like (type II) endogenous retroviruses have been detected in the genomes of mammals (51). In fact, the only retrovirus sequences that appear to have been added to the human genome since speciation are members of the human mouse mammary tumor virus-like 2 (HML-2) group of the betaretrovirus-like human endogenous retrovirus K (HERV-K) elements. Some of these HML-2 integrants are polymorphic among human populations, and, based upon homology of the long terminal repeat (LTR) sequences, several proviruses appear to have been added to the genome less than 1 million years ago (2, 3, 18, 60). In contrast to this strong evidence for recently active betaretroviral infection in humans, there is no clear evidence that retroviruses of other genera have been introduced to the human genome since speciation. Among hominids, this bias toward the recent addition of betaretroviral-like sequences is unique to humans, as the genomes of both chimpanzees and gorillas contain more than 100 copies of the gammaretrovirus-like Pan troglodytes endogenous retrovirus type 1, which is completely absent from the human genome (19, 68). These retrovirus relics are of importance because they are clear evidence of previous retrovirus infections and, as such, likely represent ancestral selective pressures.

TRIM5{alpha} has clearly been shown to be a major factor in determining the host range of both gammaretroviruses and lentiviruses in primates (15, 21, 38, 50, 65), and more recently, this finding has been extended to spumaviruses (64). TRIM5{alpha} has been proposed to interact with capsid (CA) determinants of sensitive viruses, and this interaction results in an abortive infection prior to nuclear entry (45, 53). Recognition of TRIM5{alpha}-sensitive virus cores occurs soon after entry into the cell (12), and restriction results in production of normal to reduced levels of early reverse transcriptase products but greatly reduced levels of full-length DNA (12, 53). The actual mechanism of TRIM5{alpha}-mediated restriction and the requirements for cellular cofactors remain incompletely understood. However, restriction appears to cause premature dissociation of virus cores (54), and may involve the degradative functions of the proteasome (1).

Studies have shown that TRIM5{alpha} has been under strong selective pressure over much of the course of primate evolution (43, 55) and that the TRIM5 locus is highly divergent (42). All of these data suggest that TRIM5{alpha} has evolved as an antiretroviral agent and that cycles of retroviral challenge and subsequent selection for protective TRIM5{alpha} alleles have shaped primate evolution (43, 49). An example of this type of selection, in response to a gammaretroviral pathogen, may have resulted in the susceptibility of humans to human immunodeficiency virus (HIV) infection (20). This highlights the importance of studying TRIM5{alpha} and other restriction factors in general.

One of the aspects of TRIM5{alpha} biology that has yet to be fully explored is the breadth of activity of this protein. In the only study, to date, to test a betaretrovirus for its sensitivity to TRIM5{alpha}-mediated restriction, Lee and Bieniasz (23) found that a reconstituted HERV-K(HML-2) was not restricted by the tested TRIM5{alpha} proteins. In the current study, we used M-PMV to more fully explore the possibility that TRIM5{alpha} can mediate postentry blocks to betaretrovirus infections. Cells isolated from 11 different species including human, Old World and New World monkeys, and prosimians were screened for infectivity, using M-PMV engineered to be capable of a single round of infection pseudotyped with the vesicular stomatitis virus G (VSV-G) protein. We found that cells from three New World monkey species (squirrel, tamarin, and spider monkeys) showed >20-fold reduction in M-PMV infectivity, and time course experiments showed the block to be prior to completion of reverse transcription. When exogenously expressed in permissive cells, TRIM5{alpha} from squirrel and tamarin monkeys was found to restrict M-PMV infection. In squirrel and tamarin monkey fibroblasts, the small interfering RNA (siRNA) knockdown of TRIM5{alpha} and the expression of dominant-negative TRIM5 both relieved the block to M-PMV infection. Conversely, the expression of spider monkey TRIM5{alpha} in permissive cells failed to block M-PMV infection, and neither the siRNA knockdown nor dominant-negative antagonism of TRIM5{alpha} in spider monkey fibroblasts relieved the barrier to M-PMV infectivity. These results demonstrate that New World monkey TRIM5{alpha} proteins have the capability of inhibiting betaretroviral infection and that these primates likely have multiple mechanisms for restricting betaretroviral infection.


arrow
MATERIALS AND METHODS
 
Cell culture. Information regarding cells used in this study is shown in Table 1. Penicillin (10 U/ml) and streptomycin (10 µg/ml) were added to all cultures. HeLa cells expressing the TRIM5{alpha} protein from human, rhesus macaque, African green monkey, squirrel monkey, tamarin monkey, and spider monkey (50) (kindly provided by Byeongwoon Song, Emory University) were cultured in the presence of 1 µg/ml of puromycin. All TRIM5{alpha}-expressing Crandell feline kidney (CRFK) cells were maintained under the selection of 5 µg/ml of puromycin.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Cell lines used in this study

Viral production. Virus stocks were generated by calcium phosphate-mediated transfection of 293T cells (27, 39). Briefly, 1 x 107 293T cells were plated in 150-mm2 plates and transfected in the presence of 25 mM chloroquine on the following day. For the production of VSV-G pseudotyped green fluorescent protein (GFP)-expressing M-PMV, 21 µg of pSARM-EGFP (32, 52), an M-PMV proviral vector with the viral env gene replaced by enhanced GFP (EGFP), and 2 µg pLP/VSV-G (Invitrogen) were transfected per 150-mm2 plate. For the production of VSV-G pseudotyped Moloney murine leukemia virus (MoMLV), 21 µg pLXSG (kindly provided by Paul Lewis, Oregon Health Sciences University), 14 µg of the pCS2+-mGP (63) Moloney gag/pol expression vector, and 7 µg pLP/VSV-G were transfected per 150-mm2 plate. For the production of VSV-G pseudotyped GFP-expressing HIV type 1 (HIV-1), 21 µg pNL-EGFP/CMV-WPRE{Delta}U3, a vector based on pNL-EGFP/CMV (41) (which features the WPRE element for increased mRNA stability and a deleted U3 region for added safety), 14 µg pCD/NL-BH*{Delta}{Delta}{Delta} (69), and 7 µg pLTR-G (40) were transfected per 150-mm2 plate (all vectors were kindly provided by Jakob Reiser, Louisiana State University Health Sciences Center). For the production of VSV-G pseudotyped GFP-expressing simian immunodeficiency virus SIVmac239, 21 µg pSIV/GFP{Delta}env (12) (kindly provided by Paul Bieniasz, Aaron Diamond AIDS Research Center) and 7 µg pLP/VSV-G were transfected per 150-mm2 plate.

In all cases, the medium was changed 16 h posttransfection, and virus-containing medium was collected after an additional 48 h. This virus-containing medium was spun at 500 x g for 5 min, passed through a 0.45-µm-pore-sized filter, and stored at –80°C. During the course of our experiments, it was observed that titers of M-PMV decreased around 200-fold after being frozen and thawed. Similar to previous results with other viruses (61), we found that the addition of 10% dimethyl sulfoxide to the virus-containing medium prior to freezing prevented this loss of viral titer (data not shown).

Virus infectivity assays and transductions. Cells were seeded the day before infection at 5 x 104 cells per well of a six-well plate, except in the case of 293T and CV-1 cells, for which 1 x 105 cells were plated. The following day, cells were exposed to a 500-µl total volume of virus-containing growth medium supplemented with 8 µg/ml polybrene for a total of 16 h at 37°C. Following this incubation period, the medium was replaced with fresh growth medium. For analysis by flow cytometry, 60 to 72 h after exposure to virus, cells were trypsinized, spun at 500 x g for 5 min, and resuspended in phosphate-buffered saline (PBS) without Ca2+ and Mg2+ supplemented with 2% fetal bovine serum (FBS). Flow cytometry was conducted using a FACSCalibur system (BD Biosciences); at least 50,000 gated events were collected for each sample. Data analysis was conducted using FlowJo software, Macintosh version 8.1.1 (Tree Star, Inc.). All virus stocks were titrated on the highly permissive CRFK cells, using this method. Based on the CRFK infectivity, functional multiplicities of infection (MOI) were determined.

TRIM5{alpha} cloning and expression. Total RNA was isolated from AG05311 (squirrel monkey), AG05352 (spider monkey), and AG05356 (woolly monkey) cells using TRIzol (Invitrogen) according to the manufacturer's protocol. cDNA was generated using anchored-oligo(dT)18 primers and a Transcriptor First Strand cDNA synthesis kit (Roche). Squirrel monkey TRIM5{alpha} was amplified using "Squirrel F" (5'-GAGCAGGAATTCGCCACCATGTACCCATACGACGTCCCAGACTACGCTTCCAGAATCCTGGGGAGTATAAAGG-3') and "Squirrel R" (5'- GAGCAGATCGATGGCTCAAGACCTTGGTGAGCACAGAGTCATGG-3'); spider monkey TRIM5{alpha} was amplified using "Spider F" (5'-GAGCAGGAATTCGCCACCATGTACCCATACGACGTCCCAGACTACGCTTCCGAAATCCTG TTGAATATAAAGGAG-3') and "Spider/Woolly R" (5'-GAGCAGATCGATGG CTCAAGAGCTTGGTGAGCACAGAGTCATGG-3'); and woolly monkey TRIM5{alpha} was amplified using "Woolly F" (5'-GAGCAGGAATTCGCCACCATGTACCCATACGACGTCCCAGACTACGCTTCCGAAATCCTGGTGAATATAAAGGA-3') and "Spider/Woolly R." All forward primers were designed to include a Kozak consensus sequence (22) and a sequence corresponding to the hemagglutinin (HA) tag (13). PCR was conducted using Pfu polymerase (Stratagene), and the resulting product was digested with EcoRI and ClaI and cloned into the MLV-based expression vector pLPCX (Clontech) cut with EcoRI and ClaI. Clones were sequenced; the TRIM5{alpha} sequences correspond to the GenBank accession numbers AY843517 (squirrel monkey), AY843516 (spider monkey), and AY843520 (woolly monkey) previously reported for these species. VSV-G pseudotyped TRIM5{alpha}-expressing MoMLV stocks were prepared in the same manner as GFP-expressing MoMLV virus described above, replacing pLXSG with the pLPCX-TRIM5{alpha} vector.

The generation of CRFK cells expressing the TRIM5{alpha} gene from the human, rhesus, sooty mangabey, baboon, titi, and tamarin has been previously described (20, 25, 43). To generate CRFK cells expressing woolly monkey, spider monkey, or squirrel monkey TRIM5{alpha}, CRFK cells were transduced with TRIM5{alpha}-expressing MLV in six-well plates as described above. Two days after transduction, these cells were split and placed under selection with 5 µg/ml of puromycin. Two weeks later, the puromycin-resistant cells were plated at low density (~200 cells/plate) in 150-mm2 plates. Clones were picked from well-isolated colonies and expanded. TRIM5{alpha} expression was verified by Western blot analysis using monoclonal antibodies against the HA epitope (Covance) and β-actin (Sigma-Aldrich). Of the clones that express TRIM5{alpha}, two were tested for antiviral activity. In all cases similar results were obtained from the two clones (data not shown).

Vesicular stomatitis virus infections. A viral stock of VSV{Delta}G*-G (56), a VSV derivative capable of a single-round infection that contains GFP in place of the G protein, was kindly provided by John Altman (Emory University). Cells were seeded the day before infection at 5 x 105 cells per well of a six-well plate and 16 h later were exposed to a total volume of 500 µl of virus-containing Dulbecco's modified Eagle's medium, supplemented with 8 µg/ml Polybrene and 2% FBS, for a total of 2 h at 37°C. Following this incubation period, the medium was replaced with fresh growth medium. Four hours later, cells were trypsinized, fixed with PBS containing 4% paraformaldehyde, washed three times with PBS supplemented with 2% FBS, and analyzed by flow cytometry.

Quantitative real-time PCR analysis of reverse transcription products. TaqMan primer/probe sets were developed to selectively amplify regions in either the strong-stop DNA reverse transcription (RT) product or the gag portion of the full-length RT product. The primers "ssDNA F" (5'-CCACCATTAAATGAGACTTGATCAG-3'), "ssDNA R" (5'-GGAGGGAGTGGGAATTGAAG-3'), and "ssDNA probe" (5'-ACACTGTCTTGTCTCCATTTCTTGTGTCTCTTG-3') were used to quantify the strong-stop DNA product. The primers "gag F" (5'-GCTTGGAAGATGAGGCAGCGAAAT-3'), "gag R" (5'-ATTACAGTGGGTGCGGAAGGAGTA-3'), and "gag probe" (5'-TAATCCCGATTGGCCTCCCTTCCTAA-3') were used to quantify full-length RT products. The strong-stop DNA probe was tagged at the 5' end with 6-carboxyfluorescein, and the gag probe was tagged at the 5' end with hexachloro-6-carboxyfluorescein; both probes contained a 3' Iowa Black FQ nonfluorescent quencher (Integrated DNA Technologies).

One day prior to infection, 3 x 105 cells were seeded in 60-mm2 plates. VSV-G pseudotyped M-PMV-EGFP was DNase treated for 1 h at 37°C with 1 U of Turbo DNase (Ambion) per 10 µl virus. Cells were incubated in the presence of DNase-treated virus at an MOI of approximately 0.35 at 4°C for 2 h in a total volume of 500 µl in CO2-independent medium (Gibco) supplemented with 2% FBS and 8 µg/ml Polybrene. Following this incubation, virus-containing medium was replaced with culture medium, and cells were placed at 37°C. At various times thereafter, cells were harvested; total DNA was isolated using a Qiagen DNeasy kit. Real-time PCRs contained 1x FastStart TaqMan Probe Master Mix (Roche) with 400 nM 5-carboxy-x-rhodamine passive reference dye, 250 ng DNA, 250 nM probe, and either 60 nM gag-specific primers or 80 nM strong-stop DNA-specific primers. A standard curve was generated by twofold serial dilutions of pSARM-EGFP. PCRs were performed in 384-well plates using a 7900HT Fast Real-Time PCR system (Applied Biosystems) with the following reaction conditions: 5 min at 95°C, followed by 45 cycles of 30 s at 95°C, 30 s at 59°C, and 30 s at 72°C. DNA harvested from cells incubated with virus lacking glycoprotein was used as a control for these experiments. In this control, quantitative PCR (qPCR) analysis of this DNA detected approximately 1,000 copies of strong-stop DNA at 0 h and less than 200 copies at later time points, while less than 30 copies of gag DNA were detected at all times analyzed (data not shown).

Generation of TRIM5-dominant-negative-expressing cells. Dual-expressing lentivirus vectors, based on the pNL-EGFP/CMV-WPRE{Delta}U3 vector, were generated to express dominant-negative forms of New World monkey TRIM5 proteins, which lack the B30.2 domain. These vectors were designed with the cytomegalovirus (CMV) promoter driving expression of a transcript containing the dominant-negative TRIM5, an internal ribosomal entry site (IRES), and yellow fluorescent protein (YFP). The encephalomyocarditis virus (EMCV) IRES was amplified from pIRESneo2 (Clontech) using the primers "IRES F1'" (5'-CTGCAGGATCCTCGCGATCGATGTCGACCGCCCCCCCCCCCCTAACGTTACTG GCCGAAGCC-3') and "IRES R" (5'-CTTGCTCACCATGGTGGCGGCGCGCCTATTATCATCGTGTTTTTCAAAGGAAAACCACGTCCCCGT-3'). YFP was amplified from pEYFP-Golgi (Clontech), using the primers "eYFP F" (5'-GATGATAATAGGCGCGCCGCCACCATGGTGAGCAAGGGCGAGGAGCTG TTCAC-3') and "eYFP R" (5'-ACCTCACTCGAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCGAGAGTGAT-3'). A second round of PCR was performed utilizing the IRES and YFP PCR products as templates, using the primers "IRES F2'" (5'-ACCTCAGCTAGCGCTACCGGTGAATTCCCGGGCCTGCAGGATCCTCGCGATCGATGTCGACCGCCC-3') and "eYFP R." The vector pNL-CXIYW{Delta} was generated by digesting the 1,382- nucleotide IRES-YFP PCR fragment with NheI and XhoI and cloning it into pNL-EGFP/CMV-WPRE{Delta}U3, which was also digested with NheI and XhoI.

To generate the spider monkey TRIM5 dominant-negative vector, a TRIM5 fragment was digested from the pLPCX-based TRIM5{alpha} expression vectors using EcoRI and EcoRV. To generate the dominant-negative tamarin monkey TRIM5 vector, the tamarin TRIM5{alpha} gene was amplified from the AG05308 cellular RNA using the primers "Squirrel F" and "Squirrel R" as described above, followed by digestion with EcoRI and EcoRV. The EcoRI-EcoRV TRIM5 fragments were cloned into pNL-CXIYW{Delta} cut with BamHI that was filled in with Klenow fragments and EcoRI. This cloning strategy results in a truncated TRIM5 protein with an in-frame stop codon after amino acid 323. Clones were verified by sequencing.

VSV-G pseudotyped virus was generated from these vectors as described for GFP-expressing HIV. The resulting viruses were concentrated by ultracentrifugation for 2.5 h at 100,000 x g and used to stably transduce CRFK, TRIM5-expressing CRFK, or fibroblasts. Western blotting was used to detect expression of HA-tagged TRIM5 dominant-negative protein and β-actin, as well as YFP (using rabbit polyclonal anti-GFP [Clontech]) in total protein extracts from transduced cells. YFP was found to be efficiently expressed via the IRES in CRFK cells but was poorly expressed in the New World monkey fibroblasts.

TRIM5 dominant-negative-expressing cells were infected with GFP-expressing challenge viruses as described previously. Analysis of GFP and YFP expression was performed using an LSRII flow cytometer (BD Biosciences) with the following filter configuration: 505LP to 510/21 for GFP detection and 525LP to 560/40 for YFP detection. This configuration allows for discrimination between YFP and GFP, in spite of their large spectral overlap. For each sample, at least 100,000 gated events were collected.


arrow
RESULTS
 
Cell lines from New World monkeys resist infection with M-PMV. In this study, we determined whether species-specific postentry barriers to M-PMV infection exist by using a VSV-G pseudotyped, GFP-expressing M-PMV (M-PMV-EGFP) to screen a variety of cell lines for infectivity. M-PMV-EGFP expresses GFP instead of the viral envelope glycoprotein (32, 52). When complemented in trans by an appropriate viral envelope glycoprotein, the resulting virus is capable of entering a target cell, integrating into the chromosome, and expressing virus proteins, but infectious virus is not produced (data not shown). The use of GFP as a reporter gene, in conjunction with detection using flow cytometry, allows for the discrimination between the establishment of infection, as determined by the percent GFP-positive cells, and levels of viral gene expression, as determined by the intensity of GFP fluorescence. Viral stocks were pseudotyped with VSV-G to identify postentry restrictions to M-PMV, since it has been shown that VSV-G is able to mediate infection in a broad range of species and tissues (5, 9, 14, 24).

This VSV-G pseudotyped M-PMV-EGFP was used to infect cells isolated from humans, four Old World monkeys, five New World monkeys, and one prosimian species (Table 1 and Fig. 1A). The cells were incubated overnight at an MOI of approximately 0.35; this MOI was used to minimize multiple integrations and remain within the linear range of flow cytometric analysis. All of the cell lines tested displayed mean fluorescent intensity values between 190 (293T cells) and 725 (squirrel monkey fibroblasts) in GFP-positive cells, indicating comparable levels of viral gene expression in all cells once the virus entered and integrated. However, the cells varied greatly in the efficiency of infection. The cell lines that were screened were classified into four categories of sensitivity (Fig. 1B): those that were as permissive as CRFK, those that were 3- to 5-fold less permissive than CRFK, those that were 25- to 50-fold less permissive than CRFK, and those that were over 1,000-fold less permissive than CRFK cells. All cells from Old World monkeys and one of the human cell lines (HOS) were readily infected with M-PMV. The other human cell line (293T) along with fibroblasts isolated from lemur, titi, and woolly monkeys displayed a slight (three- to fivefold) decrease in M-PMV susceptibility. In contrast, fibroblasts derived from squirrel and spider monkeys displayed a marked decrease (25- to 50-fold) in M-PMV sensitivity. Finally, fibroblasts from tamarin monkeys were found to be highly resistant to M-PMV infection, with >1,000-fold reduction in GFP-positive cells.


Figure 1
View larger version (34K):
[in this window]
[in a new window]

  		FIG. 1. M-PMV infectivity is reduced in New World monkey cell lines. (A) Phylogenetic tree showing the relationship of primate species (adapted from Bininda-Emonds et al., 2007 [6]). * indicates that cells from this species were examined in this study. mya, millions of years ago. (B) Results of transductions using VSV-G pseudotyped M-PMV-EGFP. Cells from the indicated species were incubated with virus overnight at an MOI of approximately 0.35 and analyzed for GFP expression by flow cytometry 48 h later. (C) Cells from the indicated species were incubated with increasing amounts of VSV-G pseudotyped M-PMV overnight and analyzed for GFP expression by flow cytometry 48 h later.

We also assessed M-PMV infectivity over a broad range of viral inputs in CRFK and HOS cells and fibroblasts derived from New World monkeys (Fig. 1C). Cells were incubated overnight with VSV-G pseudotyped M-PMV-EGFP at an MOI between 0.01 and 2.75, and infection was quantified by flow cytometry 48 h later. The 3- to 5-fold M-PMV infectivity defect observed for titi and woolly monkey fibroblasts and the stronger (25- to 50-fold) block in squirrel and spider monkey cells were observed at every viral input tested. For cells of these last two species, significant M-PMV infection was observed only at the highest virus inputs. In contrast, fibroblasts from tamarin monkeys exhibited infection near background levels (0.01% GFP-positive cells) at all virus inputs tested. These results show that cells of New World monkey origin block M-PMV infection to various degrees.

The block to M-PMV infection in squirrel, tamarin, and spider monkey fibroblasts is virus specific. To determine the extent to which the VSV-G protein mediates entry into cells of different origins, the same panel of fibroblasts was infected with GFP-expressing VSV. This virus, which is capable of only a single round of infection, was used at an MOI of 1 to infect these cells (Fig. 2A). Infection of CRFK and HOS cells resulted in approximately 62% of cells being GFP positive. However, infections of the primate fibroblast lines resulted in 20% to 27% GFP-positive cells. Therefore, VSV appears to exhibit a 2.5- to 3-fold reduction in infectivity in these New World monkey fibroblasts. Similar results were observed when infections were carried out at an MOI of 0.1 (data not shown). Furthermore, all of the New World monkey fibroblasts, with the exception of tamarin fibroblasts, produced as much GFP (as measured by mean fluorescent intensity) as CRFK or HOS cells. GFP-positive tamarin fibroblasts were found to be 5- to 10-fold less bright than GFP-positive CRFK cells (data not shown), but this expression defect was distinct from the establishment of infection. Thus, while there appears to be a small defect in VSV entry in the New World monkey fibroblasts, and for tamarin fibroblasts a second level of VSV restriction at the stage of viral gene expression, these defects do not account for the 25- to 1,000-fold defect in M-PMV infectivity observed for squirrel, tamarin, and spider monkey cells.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 2. Observed infectivity differences are specific to M-PMV. (A) Results of infections using VSV{Delta}G*-G, a vesicular stomatitis virus derivative capable of a single-round infection that contains GFP in place of the G protein. Cells were incubated with virus at an MOI of approximately 1 for 2 h and analyzed for GFP expression 5 h later. (B) Results of transductions using VSV-G pseudotyped, GFP-expressing murine leukemia virus. Cells were incubated overnight in the presence of virus at an MOI of approximately 0.35 and analyzed for GFP expression 48 h later. (C) The average IRM-PMV/MLV is shown for selected cell lines. * indicates cell lines that have IR values that differ in a statistically significant manner from 1. Data shown are the means ± standard errors of the means of representative experiments, each with n = 3.

Refractivity of M-PMV infection in the resistant New World monkey cells could also reflect a nonspecific insensitivity to retrovirus infection. To control for this, MoMLV infectivity in these cells was therefore assessed by infecting cells with VSV-G pseudotyped GFP-expressing MoMLV at an MOI of approximately 0.35 (Fig. 2B). All of the cell types tested show a reduced susceptibility (3- to 11-fold) compared to the very permissive CRFK cells. However, the pattern of reduced susceptibility was different from that seen with M-PMV infections.

To discern virus-specific differences, a ratio of M-PMV to MoMLV infectivity [designated IR(M-PMV/MLV)] was determined for each of these cell lines (Fig. 2C). An IR(M-PMV/MLV) value less than 1 indicates an M-PMV-specific block in the cells, an IR(M-PMV/MLV) value above 1 suggests a MoMLV-specific block, and IR(M-PMV/MLV) values near 1 indicate that no specific block could be determined. Squirrel, tamarin, and spider monkey fibroblasts were found to have IR values of 0.5, 0.007, and 0.2, respectively; all of these values were determined to be significantly lower than 1 (P < 0.05) using Tukey's test. These data demonstrate that squirrel, tamarin, and spider monkey fibroblasts are not generically resistant to retroviral infection but specifically resist M-PMV infection.

New World monkey fibroblasts display a postentry block to M-PMV infection. To determine where the block to M-PMV infection occurred in the three nonpermissive cell lines, real-time qPCR was used to detect initial products of RT (minus-strand strong-stop DNA), as well as those representing complete transcription of the genome (gag), at various times after M-PMV infection in CRFK cells and squirrel, tamarin, and spider monkey fibroblasts. Infections were synchronized by incubating fibroblasts or CRFK cells with DNase-treated VSV-G pseudotyped M-PMV-EGFP at an MOI of approximately 0.35 at 4°C, which allows the virus to adsorb to the cell surface but not enter or start RT. After adsorption, the medium was replaced, and the cells were incubated at 37°C for various times. Total DNA was then harvested, and strong-stop DNA or gag RT products were quantified. The results of strong-stop DNA product quantification are shown in Fig. 3A. Readily quantifiable amounts of strong-stop DNA products were detected in squirrel, tamarin, and spider monkey fibroblasts early (2 to 6 h) after infection. The amounts of strong-stop DNA detected in these fibroblasts are, however, significantly reduced compared to that detected in CRFK cells. This decrease in detected strong-stop DNA is seen at all times examined, but the differences between the levels of strong-stop DNA quantified in CRFK cells and those detected in the fibroblast lines increases over the time period examined. Figure 3B shows a 2.5- to 7-fold reduction in strong-stop DNA levels in fibroblast lines at early times postinfection, and a much greater (13- to 35-fold) reduction in strong-stop DNA levels 48 h after infection.


Figure 3
View larger version (30K):
[in this window]
[in a new window]

  		FIG. 3. Quantitative PCR analysis of RT products in primate fibroblasts. Cells (3 x 105) were incubated with DNase-treated VSV-G pseudotyped M-PMV-EGFP virus at an MOI of approximately 0.35 for 2 h at 4°C, after which the cells were returned to 37°C, and total DNA was isolated at the indicated times. (A) Early RT products (strong-stop DNA) were detected in CRFK cells, spider monkey fibroblasts, squirrel monkey fibroblasts, or tamarin monkey fibroblasts using real-time qPCR. (B) Changes in quantified strong-stop DNA products compared to CRFK cells at 2 h, 4 h, and 48 h after the start of infection are shown. (C) Late reverse transcriptase products (gag) were detected in CRFK cells, spider monkey fibroblasts, squirrel monkey fibroblasts, or tamarin monkey fibroblasts, using real-time qPCR. (D) Changes in quantified gag products compared to CRFK cells at 2 h, 4 h, and 48 h after start of infection are shown. Data are the means ± standard errors of the means from duplicate experiments; total n = 12.

The levels of full-length reverse transcriptase products were also quantified, and the results are shown in Fig. 3C. Reduced levels of late reverse transcriptase products were observed at all time points in the three New World monkey fibroblast lines compared to that of CRFK cells. At 2 h postinfection, there is a 2.1- to 3.4-fold reduction (Fig. 3D); this difference increases to a 7- and 13-fold reduction by 4 h, and further to a 50- to 75-fold reduction by 48 h postinfection. Combined, these qPCR data argue for two separate blocks to VSV-G pseudotyped M-PMV infection in these cells: a minor defect to viral entry attributable to VSV-G and a postentry block that manifests itself several hours after the initiation of infection. This postentry block occurs after the initiation of RT but before RT can be completed, resulting in production of early RT products but much reduced levels of late RT products. The timing and phenotype of this postentry restriction to M-PMV infection of squirrel, tamarin, and spider monkey fibroblasts are reminiscent of the TRIM5{alpha}-mediated restriction of HIV-1 (47, 53).

TRIM5{alpha} from squirrel and tamarin monkeys, but not spider monkeys, restricts M-PMV infection. Due to the TRIM5{alpha}-like characteristics of the postentry restriction to M-PMV infection in squirrel, tamarin, and spider monkey fibroblasts, we explored the possibility that TRIM5{alpha} from these species accounts for the restriction to M-PMV infection. CRFK cells stably expressing human, rhesus macaque, sooty mangabey, baboon, titi monkey, or tamarin monkey TRIM5{alpha} from a retroviral vector have been previously described (20, 25, 43). Additional CRFK clones stably expressing squirrel, woolly, or spider monkey TRIM5{alpha} from a pLPCX retroviral vector were generated for this study. Comparable levels of TRIM5{alpha} were expressed in these cells (Fig. 4A and data not shown). It should be noted that the mass differences in TRIM5{alpha} detected in these blots are consistent with sequence data, in that the TRIM5{alpha} genes from woolly and spider monkeys have a tandem triplication in the v3 region of the B30.2 domain compared to the TRIM5{alpha} genes from squirrel and tamarin monkeys (43, 49).


Figure 4
View larger version (37K):
[in this window]
[in a new window]

  		FIG. 4. Exogenous expression of tamarin and squirrel monkey TRIM5{alpha} inhibits M-PMV infection. (A) Total protein (30 µg) from CRFK cells (lane 1) or CRFK cells stably expressing HA-tagged TRIM5{alpha} from tamarin monkey (lane 2), squirrel monkey (lane 3), woolly monkey (lane 4), or spider monkey (lane 5) was subjected to Western blot analysis for either the HA epitope (upper panel) or β-actin (lower panel). (B) CRFK cells expressing TRIM5{alpha} from the indicated species were incubated with VSV-G pseudotyped M-PMV-EGFP overnight at an MOI of approximately 0.25 and analyzed for GFP expression by flow cytometry 48 h later. (C) CRFK cells expressing TRIM5{alpha} from the indicated species were exposed to VSV-G pseudotyped SIV/GFP{Delta}env overnight at an MOI of approximately 0.35 and analyzed for GFP expression 48 h later. (D) HeLa cells stably transduced with TRIM5{alpha} from the indicated species or an empty vector control (LPCX) were exposed to VSV-G pseudotyped M-PMV-EGFP overnight at an MOI of approximately 0.25 and analyzed for GFP expression 48 h later. Data shown are the means ± standard errors of the means of representative experiments, each with n = 3.

The TRIM5{alpha}-expressing CRFK cells were incubated with VSV-G pseudotyped M-PMV-EGFP overnight and analyzed for GFP expression 48 h later. The results of a representative infection are shown in Fig. 4B. Similar levels of GFP-positive cells were observed in CRFK cells expressing human, titi, and woolly monkey TRIM5{alpha}, consistent with the results from infection of the fibroblast lines. In contrast, cells expressing squirrel monkey TRIM5{alpha} showed a 5-fold reduction, and tamarin monkey TRIM5{alpha}-expressing cells showed a 50-fold reduction in M-PMV infectivity. On the other hand, expression of spider monkey TRIM5{alpha} in CRFK cells did not inhibit M-PMV infection (this result was consistent in two independently isolated cell clones [data not shown]). These data implicate TRIM5{alpha} as the factor responsible for the postentry restriction to M-PMV in squirrel and tamarin monkey fibroblast lines. Based on the potency of the TRIM5{alpha}-mediated restriction of M-PMV in CRFK cells and the qPCR data from New World monkey fibroblasts, the combination of a weak VSV-G-mediated entry defect and a much stronger TRIM5{alpha}-mediated postentry restriction can account for the bulk of the infectivity decrease observed for tamarin fibroblasts. Similarly, the 25-fold reduction in M-PMV infectivity in squirrel monkey fibroblasts is the result of a weak defect in VSV-G-mediated entry combined with a slightly more potent TRIM5{alpha}-mediated postentry restriction.

To confirm the functionality of the spider monkey TRIM5{alpha} protein, CRFK cells expressing the different New World monkey TRIM5{alpha} proteins were challenged with SIVmac239-based GFP-expressing virus at an MOI of 0.35 (12). SIV is known to be sensitive to restriction by the TRIM5{alpha} proteins from many New World monkey species, including squirrel, tamarin, and spider monkeys (35, 48, 50, 67). Figure 4C shows that CRFK cells expressing TRIM5{alpha} from these New World monkey species exhibit at least a 150-fold reduction in the infectivity of SIVmac239 compared to that of the parental CRFK cells, confirming the functionality of the TRIM5{alpha} protein expressed in each of these cell lines.

The specificity of these TRIM5{alpha} proteins was examined further in challenges with VSV-G pseudotyped, GFP-expressing HIV-1 and MoMLV; a summary of these results is shown in Table 2. MoMLV is not blocked by any of the New World TRIM5{alpha} proteins tested, whereas HIV-1 is restricted by the TRIM5{alpha} proteins from woolly and spider monkeys but appears insensitive to the squirrel or tamarin monkey TRIM5{alpha} proteins. The block to M-PMV infection in spider monkey fibroblasts was the only instance where expression of TRIM5{alpha} in CRFK cells did not reproduce a block to infectivity.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Correlation of viral infectivity in New World monkey fibroblasts and CRFK cells expressing TRIM5{alpha} from New World monkeys

To confirm the weak restriction of M-PMV by squirrel monkey TRIM5{alpha} and rule out the possibility that spider monkey TRIM5{alpha} was inactive against M-PMV because of the cellular context in which it was expressed, HeLa cells expressing the same primate TRIM5{alpha} proteins (kindly provided by Byeongwoon Song, Emory University) were tested for susceptibility to M-PMV infection (Fig. 4D). Expression of squirrel monkey TRIM5{alpha} in HeLa cells resulted in a 3.5-fold reduction in M-PMV infectivity, expression of tamarin monkey TRIM5{alpha} resulted in a 7-fold reduction in M-PMV infection, and no reduction in M-PMV infectivity was seen with cells expressing the spider monkey TRIM5{alpha} (Fig. 4D). These results confirm the observations from TRIM5{alpha}-expressing CRFK cells, although the potency of restriction is reduced. This may result from the formation of TRIM5{alpha} heterotrimers in these cells, which also endogenously express the human TRIM5{alpha} protein. Thus, it appears that expression of the TRIM5{alpha} protein from squirrel or tamarin monkeys is capable of blocking M-PMV infection, whereas a novel mechanism appears to be responsible for the restriction of M-PMV infection in spider monkey cells.

TRIM5{alpha} restricts M-PMV infection during early postentry stages. To verify that the phenotype of the restriction observed for TRIM5{alpha}-expressing CRFK cells was similar to that seen in the fibroblasts, qPCR was used to detect strong-stop DNA and gag reverse transcript products. In CRFK cells and squirrel monkey TRIM5{alpha}-expressing CRFK cells, equivalent levels of early RT products are produced, but these products are mostly lost over the first 24 h in squirrel monkey TRIM5{alpha}-expressing cells (Fig. 5A). By 48 h postinfection, there is 2.5-fold-less strong-stop DNA in these cells compared to that in CRFK cells. In tamarin TRIM5{alpha}-expressing cells, there was already a three- to fourfold reduction in the amount of strong-stop DNA products at between 2 and 6 h postinfection compared to CRFK cells, indicating that the tamarin TRIM5{alpha} protein blocks M-PMV at a slightly earlier stage in these cells. The difference in infectivity further increased to 14-fold by 48 h after infection.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 5. qPCR analysis of RT products in TRIM5{alpha}-expressing CRFK cells. CRFK cells or CRFK cells expressing squirrel monkey TRIM5{alpha} or tamarin monkey TRIM5{alpha} were incubated with DNase-treated VSV-G pseudotyped M-PMV-EGFP virus at an MOI of approximately 0.35 for 2 h at 4°C, after which the cells were returned to 37°C. Total DNA was isolated at the indicated times and used to detect early (strong-stop DNA) and late (gag) reverse transcriptase products. Data are the means ± standard errors of the means of a representative experiment with n = 6.

In contrast, the levels of gag products are reduced threefold at 4 h postinfection in cells expressing either squirrel or tamarin monkey TRIM5{alpha} proteins (Fig. 5B). In tamarin monkey TRIM5{alpha}-expressing cells, the difference in gag products increases to 35-fold at 48 h postinfection, whereas the difference in gag products increases only slightly over this time in squirrel monkey TRIM5{alpha}-expressing cells. These qPCR results are strikingly similar to those obtained with squirrel and tamarin monkey fibroblasts, in that late RT is affected more than early RT.

Inhibition of TRIM5{alpha} in spider monkey cells does not relieve the observed restriction of M-PMV infection. The data presented above point to a postentry block to M-PMV infection in spider monkey fibroblasts that occurs at a similar point in the viral life cycle as TRIM5{alpha}-mediated restriction. The inability of the TRIM5{alpha} from these cells to block M-PMV in permissive cells suggests that either a species-specific cofactor is required for TRIM5{alpha} activity or that a novel restriction factor is functioning in spider monkey fibroblasts. To differentiate between these possibilities, we have investigated the effect of inhibiting TRIM5{alpha} activity in these cells.

Initial experiments employing siRNAs targeting spider or tamarin monkey TRIM5{alpha} expression, although capable of modestly increasing (17.5-fold and 7.5-fold, respectively) susceptibility to infection by highly sensitive SIV, showed no effect on M-PMV infection of spider monkey cells and only increased M-PMV infection 1.5-fold in tamarin monkey cells (data not shown). We therefore utilized expression of a dominant-negative TRIM5 to more effectively inhibit the function of this protein.

(i) Truncated forms of New World monkey TRIM5 can counteract the antiviral activity of TRIM5{alpha} exogenously expressed in CRFK cells. Bicistronic lentivirus vectors were constructed that express YFP and truncated forms of the spider and tamarin monkey TRIM5 proteins, which lack the B30.2/SPRY domain. Similar truncated proteins have been shown to act as dominant-negative inhibitors of TRIM5{alpha}-mediated anti-HIV activity in cells from several different species of Old World monkeys (26).

To verify that the lentivirus vectors produced both the truncated forms of TRIM5 and YFP, CRFK cells were transduced with empty (NL-CXIYW{Delta}) vector or vectors expressing truncated forms of spider or tamarin TRIM5. Western blot analysis of total protein extracts taken from these cells (Fig. 6A) show an HA-tagged protein of a size consistent with that predicted for the truncated forms of TRIM5 (~39 kDa). In addition, transduced cells produced detectable levels of YFP, although more YFP is produced from the empty vector than those expressing the mutant versions of TRIM5. Similar results were observed with flow cytometric detection of YFP, where empty vector-transduced cells were 5- to 10-fold brighter than TRIM5-expressing vector-transduced cells. We believe this difference in expression is due to more efficient IRES-independent initiation of YFP translation in the empty vector.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 6. Truncated forms of TRIM5 have dominant-negative activity in TRIM5{alpha}-expressing CRFK cells. (A) Total protein from mock-transduced CRFK cells (lane 1) or CRFK cells transduced with NL-CXIYW{Delta} (lane 2), HA-tagged dominant-negative TRIM5{alpha} from spider monkey (lane 3), or tamarin monkey (lane 4) was subjected to Western blot analysis for the HA epitope (upper panel), YFP, using a polyclonal anti-GFP antibody (middle panel), or β-actin (lower panel). (B and C) CRFK cells stably expressing spider or tamarin monkey TRIM5{alpha} were transduced with either the empty (NL-CXIYW{Delta}) vector or a lentiviral vector expressing a truncated form of the cognate TRIM5. (B) The transduced cells were exposed to VSV-G pseudotyped SIV/GFP{Delta}env overnight at an MOI of approximately 0.35 and analyzed for YFP and GFP expression 60 h later. Differences in SIV infectivity (GFP positive) in TRIM5 dominant-negative transduced (YFP positive) cells compared to infectivity in untransduced (YFP negative) cells are shown. (C) Cells were exposed to VSV-G pseudotyped M-PMV overnight at an MOI of approximately 0.5 and analyzed for GFP expression 60 h later. Changes in M-PMV infectivity (GFP positive) in TRIM5 dominant-negative transduced (YFP positive) cells compared to infectivity in untransduced (YFP negative) cells are shown. All data represent the means ± standard errors of the means with an n = 3. *, P value calculated to be less than 0.05, using Tukey's test. D/N, dominant-negative.

To evaluate the dominant-negative potential of these truncated forms of TRIM5, CRFK cells stably expressing spider (SpM) or tamarin (Tam) monkey TRIM5{alpha} (CRFK-SpM and CRFK-Tam, respectively) were further transduced with either empty vector or vectors expressing a truncated form of the cognate TRIM5. These cells were then tested for their sensitivity to infection with VSV-G pseudotyped SIV, which is sensitive to TRIM5{alpha} from both of these species. Infectivity was assessed using a two-color flow cytometric assay employed previously by Bock et al. (8, 65). In this assay, the percentage of TRIM5 dominant-negative/YFP-positive cells infected with the GFP-expressing challenge virus was quantified and compared to the percentage of untransduced/YFP-negative cells infected with the GFP-expressing challenge virus. As shown in Fig. 6B, transduction of CRFK-SpM cells with the vector expressing a truncated form of spider monkey TRIM5 resulted in a 250-fold increase in SIV infection, and CRFK-Tam cells expressing the truncated form of tamarin TRIM5 were 30-fold more sensitive to SIV infection compared to untransduced cells. No differences were observed in SIV sensitivity when cells were transduced with the empty vector. These results clearly demonstrate that expression of the truncated forms of New World monkey TRIM5 can interfere with TRIM5{alpha} function.

The cells were also probed for their sensitivity to VSV-G pseudotyped M-PMV infection. As shown in Fig. 6C, expression of the dominant-negative form of tamarin monkey TRIM5 resulted in a 7.8-fold increase in M-PMV infectivity, to a level similar to that observed for parental CRFK cells. Expression of the dominant-negative spider monkey TRIM5 protein did not affect M-PMV infectivity in CRFK-SpM cells, which are as permissive as parental CRFK cells to M-PMV infection. This is consistent with additional control experiments, where expression of truncated TRIM5 proteins in CRFK cells lacking exogenous TRIM5{alpha} expression had no effect on the infectivity of any virus tested (data not shown). Together, these data demonstrate that the TRIM5 dominant-negative proteins function specifically to inhibit TRIM5{alpha} activity.

(ii) Expression of dominant-negative TRIM5 in spider monkey fibroblasts does not increase M-PMV infectivity in these cells. Spider and tamarin monkey fibroblasts were transduced with the lentivirus vectors described above to determine whether expression of the dominant-negative proteins could overcome the block to M-PMV infection. Total protein extracts isolated from these cells were subjected to Western blot analysis (Fig. 7A), which showed that the truncated form of TRIM5 was expressed in both fibroblast lines. While transduction with the empty vector resulted in detectable levels of YFP expression, it was undetectable in cells transduced with the TRIM5 dominant-negative-expressing vectors. Thus, it appears that in these New World monkey cells, the EMCV IRES utilized to produce YFP failed to efficiently promote internal ribosomal entry. Due to this, YFP was quantified but not used as a marker of lentiviral transduction in all further experiments with these cells.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 7. Expression of dominant-negative spider monkey TRIM5 does not enhance M-PMV infectivity in spider monkey fibroblasts. Spider and tamarin monkey fibroblasts were each transduced with TRIM5 dominant-negative expressing lentivirus vectors or empty (NL-CXIYW{Delta}) vector or were mock transduced. (A) Total protein from these cells was subjected to Western blot analysis for the HA epitope (upper panel), YFP (middle panel), or β-actin (lower panel). (B) These cells were then exposed to VSV-G pseudotyped SIV/GFP{Delta}env overnight at an MOI of approximately 1, and GFP expression was analyzed 60 h later. Changes in SIV infectivity were calculated using average infectivity in mock-transduced cells as the control. (C) These cells were exposed to VSV-G pseudotyped M-PMV-EGFP overnight at an MOI of approximately 1, and GFP expression was analyzed 60 h later. Changes in M-PMV infectivity were calculated using average infectivity in mock-transduced cells as the control. All data represent the means ± standard errors of the means with an n = 3. *, P value calculated to be less than 0.05, using Tukey's test. D/N, dominant-negative.

Transduced fibroblasts were first challenged with the potently restricted SIV to examine TRIM5 dominant-negative efficacy in these cells. As seen in Fig. 7B, expression of dominant-negative TRIM5 proteins in spider or tamarin monkey cells results in much greater sensitivity to SIV infection. A 500-fold increase in SIV infectivity was seen when dominant-negative spider monkey TRIM5 was expressed in spider monkey fibroblasts, and a 90-fold increase was noted when tamarin monkey fibroblasts were transduced with dominant-negative tamarin monkey TRIM5. In contrast, no increase in SIV sensitivity was seen when these cells were transduced with the empty vector. Thus, while these are heterogeneous populations of transduced and untransduced cells, it is clear that expression of dominant-negative forms of the cognate TRIM5 protein results in strong suppression of TRIM5{alpha} antiviral activity.

The lentivirus-transduced cells were further assessed for their susceptibility to M-PMV infection. When challenged with VSV-G pseudotyped M-PMV, the expression of dominant-negative tamarin TRIM5 in tamarin monkey fibroblasts resulted in a 4.2-fold increase in M-PMV infectivity (Fig. 7C), which was calculated to be statistically significant (P < 0.05) using Tukey's test. This confirms that TRIM5{alpha} is involved in the postentry block to M-PMV infection in tamarin monkey fibroblasts. However, it should be noted that this represents a rather modest increase in infectivity considering the >90-fold increase observed with SIV. Thus, it is likely that additional determinants of restriction exist in these cells.

In contrast to the results in tamarin fibroblasts, there was no significant difference in M-PMV infectivity in spider monkey fibroblasts transduced with the TRIM5 dominant-negative expression vector or the empty vector (Fig. 7C), even though SIV infection was enhanced 500-fold in the presence of the dominant-negative TRIM5 protein. Thus, the results suggest that TRIM5 is not involved in the postentry restriction observed for spider monkey cells.


arrow
DISCUSSION
 
Previous reports have shown that TRIM5{alpha} proteins from various species can restrict infection by members of the gammaretrovirus, lentivirus, and spumavirus genera of retroviruses (15, 21, 38, 50, 53, 64, 65). Lee and Bieniasz (23) have investigated TRIM5{alpha}-mediated restriction of the human endogenous betaretrovirus HERV-K(HML-2) (2, 3, 18, 60) but found that this virus was insensitive to human TRIM5{alpha} activity. Here, we demonstrate that the TRIM5{alpha} proteins from squirrel and tamarin monkeys are able to inhibit infection with M-PMV, a prototypical betaretrovirus. In CRFK cells exogenously expressing the TRIM5{alpha} protein carried by the tamarin monkey, we observed a high level of restriction (>50-fold inhibition), and the block was demonstrated to be at an early point in the infection cycle, prior to the completion of RT. This is analogous to the results reported for the TRIM5{alpha} inhibition of primate lentiviruses in Old World monkey cells (12, 53). Moreover, inhibition of TRIM5{alpha} function in tamarin monkey fibroblasts significantly enhanced M-PMV infectivity, confirming that endogenous TRIM5{alpha} plays a role in restricting primate betaretrovirus infection in these cells. Thus, our data provide additional evidence that TRIM5{alpha} has evolved as an antiretroviral protein (20, 42, 43, 50) with the potential to block infection by a broad range of retroviruses (reviewed in reference 33).

To exert its antiviral activity, TRIM5{alpha} is hypothesized to target the CA core of an incoming retrovirus, since substitutions in this Gag domain of HIV by that of SIV can modulate susceptibility to TRIM5{alpha} (16, 37), and even single amino acid changes can perturb this interaction (36). Similarly, substitution of one or more amino acids in the SPRY domain of TRIM5{alpha} can alter the viral specificity (55, 66). The CA proteins from SIVmac239 and M-PMV share less than 20% identity and yet infection with both viruses is restricted by the TRIM5{alpha} proteins from both squirrel and tamarin monkeys. Given the exquisite specificity of this interaction, it is remarkable that a single TRIM5{alpha} protein can restrict multiple retroviruses of different genera with such highly divergent CA proteins (Table 2) (33). Moreover, the ability to recognize diverse CA molecules lends credence to the hypothesis that TRIM5{alpha} trimers interact with complex topological structures of threefold pseudosymmetry present on the surface of the retroviral CA cores (31). With such a model, similar topological features may be presented on the surface of CA cores irrespective of the primary sequence differences of the CA proteins themselves.

Three retroviruses have been isolated from New World monkey species: an endogenous betaretrovirus was found in squirrel monkeys (11, 17), an infectious gammaretrovirus was isolated from woolly monkeys (57, 62), and an endogenous gammaretrovirus was discovered in owl monkeys (58). The squirrel monkey retrovirus is believed to be a recent addition to the squirrel monkey genome, based on the fact that it is activated following treatment with the DNA-damaging agent 5-iododeoxyuridine (17) and viral RNA does not significantly hybridize to DNA isolated from the closely related capuchins (Fig. 1A) (11). The demonstration that TRIM5{alpha} proteins of squirrel and tamarin monkeys are able to specifically block M-PMV infection may reflect prior selective pressure imposed by the relatively recent exposure of these species to members of the betaretrovirus genus. Interestingly, Lee and Bieniasz (23) found that HERV-K(HML-2) showed >10-fold reduction in infectivity in squirrel monkey cells compared to that of CRFK cells, raising the possibility that squirrel monkey TRIM5{alpha} is also able to restrict HERV-K(HML-2) infection.

The inability of TRIM5{alpha} from titi, woolly, and spider monkeys to block M-PMV infection may reflect an evolutionary history shaped by gammaretroviral infection, evidenced by the isolation of at least one infectious gammaretrovirus from woolly monkeys (62). Based on the fixation of a peculiar retrotransposition of cyclophilin A into the owl monkey TRIM5 locus (34, 44), which results in the production of a TRIM5-cyclophilin A fusion protein (TRIM-Cyp), it is clear there have been virus-specific events in New World monkeys that have shaped the evolution of their extant virus resistance genes. This is an unexpected evolutionary adaptation, since cyclophilin A has only been shown to bind to lentivirus capsids, and yet to date, no members of the lentivirus genus have been isolated from any species of New World monkeys. In this case, it is possible that the endogenous retrovirus isolated from owl monkeys may have played a role in selecting for this TRIM-Cyp protein, although it is equally likely that this virus exploited an inability to be recognized by the owl monkey TRIM-Cyp to establish itself in the owl monkey genome. However, given the general dearth of information regarding retroviral infection in New World primates and the possibility that the virus responsible for exerting selective pressure was unable to establish germ line transmission, correlating TRIM5{alpha} activity in these species with specific retroviruses remains a difficult endeavor.

In addition to the TRIM5{alpha}-associated restriction of M-PMV infection seen with squirrel and tamarin monkeys, we show that there is an M-PMV-specific postentry block to infection in spider monkey fibroblasts. This block could not be relieved by expression of a dominant-negative TRIM5 protein, even though expression of the same protein enhanced susceptibility to SIV infection in these cells more than 500-fold. Based on qPCR data, this block appears to be at a similar stage of infection to that observed for squirrel and tamarin monkey fibroblasts. However, because the block in spider monkey fibroblasts could not be ascribed to TRIM5{alpha}, we believe that these cells express a novel restriction factor capable of resisting M-PMV infection. Furthermore, it is possible that a similar factor may contribute to the high level of resistance observed for tamarin monkey fibroblasts, since expression of dominant-negative TRIM5 in these cells incompletely reversed the block to M-PMV infection. This TRIM5{alpha}-independent restriction of M-PMV, therefore, represents an opportunity to identify and more fully understand additional host-virus interactions during the early stages of retrovirus infection.


arrow
ACKNOWLEDGMENTS
 
We thank John Altman, Paul Bieniasz, Jakob Reiser, and Byeongwoon Song for providing reagents used in this study, Joe Cubells for access to and Kristie Mercer for training in the use of the ABI7900HT real-time machine, Agnieszka Bialkowska for assistance with Western blotting and critical reading of the manuscript, and Cindy Derdeyn for helpful discussions and critical reading of the manuscript.

This work was supported by NIH grant CA27834 to E.H. S.M.K. was supported by a National Science Foundation predoctoral fellowship.

Flow cytometry was performed at the Emory Vaccine Center Flow Cytometry Core, which is supported by the Emory Center for AIDS Research (P30 AI050409) and the Georgia Research Alliance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 954 Gatewood Rd. N.E., Atlanta, GA 30329. Phone: (404) 727-8487. Fax: (404) 727-9316. E-mail: eric.hunter2{at}emory.edu Back

{triangledown} Published ahead of print on 17 September 2008. Back

{dagger} Present address: New England Primate Research Center, Harvard University, One Pine Hill Drive, P.O. Box 9102, Southborough, MA 01772. Back

{ddagger} Present address: Institute for Systems Biology, Seattle, WA 98103. Back


arrow
REFERENCES
 
    1
  1. Anderson, J. L., E. M. Campbell, X. Wu, N. Vandegraaff, A. Engelman, and T. J. Hope. 2006. Proteasome inhibition reveals that a functional preintegration complex intermediate can be generated during restriction by diverse TRIM5 proteins. J. Virol. 80:9754-9760.[Abstract/Free Full Text]
    2. 2
  2. Barbulescu, M., G. Turner, M. I. Seaman, A. S. Deinard, K. K. Kidd, and J. Lenz. 1999. Many human endogenous retrovirus K (HERV-K) proviruses are unique to humans. Curr. Biol. 9:861-868.[CrossRef][Medline]
    3. 3
  3. Belshaw, R., A. L. Dawson, J. Woolven-Allen, J. Redding, A. Burt, and M. Tristem. 2005. Genomewide screening reveals high levels of insertional polymorphism in the human endogenous retrovirus family HERV-K(HML2): implications for present-day activity. J. Virol. 79:12507-12514.[Abstract/Free Full Text]
    4. 4
  4. Benveniste, R. E., M. M. Lieber, D. M. Livingston, C. J. Sherr, G. J. Todaro, and S. S. Kalter. 1974. Infectious C-type virus isolated from a baboon placenta. Nature 248:17-20.[CrossRef][Medline]
    5. 5
  5. Bergold, G. H., O. M. Suarez, and K. Munz. 1968. Multiplication in and transmission by Aedes aegypti of vesicular stomatitis virus. J. Invertebr. Pathol. 11:406-428.[CrossRef][Medline]
    6. 6
  6. Bininda-Emonds, O. R., M. Cardillo, K. E. Jones, R. D. MacPhee, R. M. Beck, R. Grenyer, S. A. Price, R. A. Vos, J. L. Gittleman, and A. Purvis. 2007. The delayed rise of present-day mammals. Nature 446:507-512.[CrossRef][Medline]
    7. 7
  7. Bittner, J. J. 1936. Some possible effects of nursing on the mammary gland tumor incidence in mice. Science 84:162.[Free Full Text]
    8. 8
  8. Bock, M., K. N. Bishop, G. Towers, and J. P. Stoye. 2000. Use of a transient assay for studying the genetic determinants of Fv1 restriction. J. Virol. 74:7422-7430.[Abstract/Free Full Text]
    9. 9
  9. Burns, J. C., T. Friedmann, W. Driever, M. Burrascano, and J. K. Yee. 1993. Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. USA 90:8033-8037.[Abstract/Free Full Text]
    10. 10
  10. Chopra, H. C., and M. M. Mason. 1970. A new virus in a spontaneous mammary tumor of a rhesus monkey. Cancer Res. 30:2081-2086.[Abstract/Free Full Text]
    11. 11
  11. Colcher, D., R. L. Heberling, S. S. Kalter, and J. Schlom. 1977. Squirrel monkey retrovirus: an endogenous virus of a new world primate. J. Virol. 23:294-301.[Abstract/Free Full Text]
    12. 12
  12. Cowan, S., T. Hatziioannou, T. Cunningham, M. A. Muesing, H. G. Gottlinger, and P. D. Bieniasz. 2002. Cellular inhibitors with Fv1-like activity restrict human and simian immunodeficiency virus tropism. Proc. Natl. Acad. Sci. USA 99:11914-11919.[Abstract/Free Full Text]
    13. 13
  13. Field, J., J. Nikawa, D. Broek, B. MacDonald, L. Rodgers, I. A. Wilson, R. A. Lerner, and M. Wigler. 1988. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165.[Abstract/Free Full Text]
    14. 14
  14. Hanson, R. P. 1952. The natural history of vesicular stomatitis. Bacteriol. Rev. 16:179-204.[Free Full Text]
    15. 15
  15. Hatziioannou, T., D. Perez-Caballero, A. Yang, S. Cowan, and P. D. Bieniasz. 2004. Retrovirus resistance factors Ref1 and Lv1 are species-specific variants of TRIM5alpha. Proc. Natl. Acad. Sci. USA 101:10774-10779.[Abstract/Free Full Text]
    16. 16
  16. Hatziioannou, T., M. Princiotta, M. Piatak, Jr., F. Yuan, F. Zhang, J. D. Lifson, and P. D. Bieniasz. 2006. Generation of simian-tropic HIV-1 by restriction factor evasion. Science 314:95.[Abstract/Free Full Text]
    17. 17
  17. Heberling, R. L., S. T. Barker, S. S. Kalter, G. C. Smith, and R. J. Helmke. 1977. Oncornavirus: isolation from a squirrel monkey (Saimiri sciureus) lung culture. Science 195:289-292.[Abstract/Free Full Text]
    18. 18
  18. Hughes, J. F., and J. M. Coffin. 2004. Human endogenous retrovirus K solo-LTR formation and insertional polymorphisms: implications for human and viral evolution. Proc. Natl. Acad. Sci. USA 101:1668-1672.[Abstract/Free Full Text]
    19. 19
  19. Jern, P., G. O. Sperber, and J. Blomberg. 2006. Divergent patterns of recent retroviral integrations in the human and chimpanzee genomes: probable transmissions between other primates and chimpanzees. J. Virol. 80:1367-1375.[Abstract/Free Full Text]
    20. 20
  20. Kaiser, S. M., H. S. Malik, and M. Emerman. 2007. Restriction of an extinct retrovirus by the human TRIM5alpha antiviral protein. Science 316:1756-1758.[Abstract/Free Full Text]
    21. 21
  21. Keckesova, Z., L. M. Ylinen, and G. J. Towers. 2004. The human and African green monkey TRIM5alpha genes encode Ref1 and Lv1 retroviral restriction factor activities. Proc. Natl. Acad. Sci. USA 101:10780-10785.[Abstract/Free Full Text]
    22. 22
  22. Kozak, M. 1987. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15:8125-8148.[Abstract/Free Full Text]
    23. 23
  23. Lee, Y. N., and P. D. Bieniasz. 2007. Reconstitution of an infectious human endogenous retrovirus. PLoS Pathog. 3:e10.[CrossRef][Medline]
    24. 24
  24. Lin, S., N. Gaiano, P. Culp, J. C. Burns, T. Friedmann, J. K. Yee, and N. Hopkins. 1994. Integration and germ-line transmission of a pseudotyped retroviral vector in zebrafish. Science 265:666-669.[Abstract/Free Full Text]
    25. 25
  25. Lin, T. Y., and M. Emerman. 2006. Cyclophilin A interacts with diverse lentiviral capsids. Retrovirology 3:70.[CrossRef][Medline]
    26. 26
  26. Maegawa, H., E. E. Nakayama, A. Kuroishi, and T. Shioda. 2008. Silencing of tripartite motif protein (TRIM) 5alpha mediated anti-HIV-1 activity by truncated mutant of TRIM5alpha. J. Virol. Methods 151:249-256.[CrossRef][Medline]
    27. 27
  27. Marino, M. P., M. J. Luce, and J. Reiser. 2003. Small- to large-scale production of lentivirus vectors. Methods Mol. Biol. 229:43-55.[Medline]
    28. 28
  28. Marx, P. A., D. H. Maul, K. G. Osborn, N. W. Lerche, P. Moody, L. J. Lowenstine, R. V. Henrickson, L. O. Arthur, R. V. Gilden, M. Gravell, et al. 1984. Simian AIDS: isolation of a type D retrovirus and transmission of the disease. Science 223:1083-1086.[Abstract/Free Full Text]
    29. 29
  29. McAllister, R. M., M. Nicolson, M. B. Gardner, R. W. Rongey, S. Rasheed, P. S. Sarma, R. J. Huebner, M. Hatanaka, S. Oroszlan, R. V. Gilden, A. Kabigting, and L. Vernon. 1972. C-type virus released from cultured human rhabdomyosarcoma cells. Nat. New Biol. 235:3-6.[Medline]
    30. 30
  30. Michalides, R., and J. Schlom. 1975. Relationship in nucleic acid sequences between mouse mammary tumor virus variants. Proc. Natl. Acad. Sci. USA 72:4635-4639.[Abstract/Free Full Text]
    31. 31
  31. Mische, C. C., H. Javanbakht, B. Song, F. Diaz-Griffero, M. Stremlau, B. Strack, Z. Si, and J. Sodroski. 2005. Retroviral restriction factor TRIM5{alpha} is a trimer. J. Virol. 79:14446-14450.[Abstract/Free Full Text]
    32. 32
  32. Newman, R. M., L. Hall, M. Connole, G. L. Chen, S. Sato, E. Yuste, W. Diehl, E. Hunter, A. Kaur, G. M. Miller, and W. E. Johnson. 2006. Balancing selection and the evolution of functional polymorphism in Old World monkey TRIM5alpha. Proc. Natl. Acad. Sci. USA 103:19134-19139.[Abstract/Free Full Text]
    33. 33
  33. Newman, R. M., and W. E. Johnson. 2007. A brief history of TRIM5alpha. AIDS Rev. 9:114-125.[Medline]
    34. 34
  34. Nisole, S., C. Lynch, J. P. Stoye, and M. W. Yap. 2004. A Trim5-cyclophilin A fusion protein found in owl monkey kidney cells can restrict HIV-1. Proc. Natl. Acad. Sci. USA 101:13324-13328.[Abstract/Free Full Text]
    35. 35
  35. Ohkura, S., M. W. Yap, T. Sheldon, and J. P. Stoye. 2006. All three variable regions of the TRIM5{alpha} B30.2 domain can contribute to the specificity of retrovirus restriction. J. Virol. 80:8554-8565.[Abstract/Free Full Text]
    36. 36
  36. Owens, C. M., B. Song, M. J. Perron, P. C. Yang, M. Stremlau, and J. Sodroski. 2004. Binding and susceptibility to postentry restriction factors in monkey cells are specified by distinct regions of the human immunodeficiency virus type 1 capsid. J. Virol. 78:5423-5437.[Abstract/Free Full Text]
    37. 37
  37. Owens, C. M., P. C. Yang, H. Gottlinger, and J. Sodroski. 2003. Human and simian immunodeficiency virus capsid proteins are major viral determinants of early, postentry replication blocks in simian cells. J. Virol. 77:726-731.[CrossRef][Medline]
    38. 38
  38. Perron, M. J., M. Stremlau, B. Song, W. Ulm, R. C. Mulligan, and J. Sodroski. 2004. TRIM5alpha mediates the postentry block to N-tropic murine leukemia viruses in human cells. Proc. Natl. Acad. Sci. USA 101:11827-11832.[Abstract/Free Full Text]
    39. 39
  39. Reiser, J. 2000. Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene Ther. 7:910-913.[CrossRef][Medline]
    40. 40
  40. Reiser, J., G. Harmison, S. Kluepfel-Stahl, R. O. Brady, S. Karlsson, and M. Schubert. 1996. Transduction of nondividing cells using pseudotyped defective high-titer HIV type 1 particles. Proc. Natl. Acad. Sci. USA 93:15266-15271.[Abstract/Free Full Text]
    41. 41
  41. Reiser, J., Z. Lai, X. Y. Zhang, and R. O. Brady. 2000. Development of multigene and regulated lentivirus vectors. J. Virol. 74:10589-10599.[Abstract/Free Full Text]
    42. 42
  42. Sawyer, S. L., M. Emerman, and H. S. Malik. 2007. Discordant evolution of the adjacent antiretroviral genes TRIM22 and TRIM5 in mammals. PLoS Pathog. 3:e197.[CrossRef][Medline]
    43. 43
  43. Sawyer, S. L., L. I. Wu, M. Emerman, and H. S. Malik. 2005. Positive selection of primate TRIM5alpha identifies a critical species-specific retroviral restriction domain. Proc. Natl. Acad. Sci. USA 102:2832-2837.[Abstract/Free Full Text]
    44. 44
  44. Sayah, D. M., E. Sokolskaja, L. Berthoux, and J. Luban. 2004. Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1. Nature 430:569-573.[CrossRef][Medline]
    45. 45
  45. Sebastian, S., and J. Luban. 2005. TRIM5alpha selectively binds a restriction-sensitive retroviral capsid. Retrovirology 2:40.[CrossRef][Medline]
    46. 46
  46. Sharp, J. M., and A. J. Herring. 1983. Sheep pulmonary adenomatosis: demonstration of a protein which cross-reacts with the major core proteins of Mason-Pfizer monkey virus and mouse mammary tumour virus. J. Gen. Virol. 64:2323-2327.[Abstract/Free Full Text]
    47. 47
  47. Shibata, R., H. Sakai, M. Kawamura, K. Tokunaga, and A. Adachi. 1995. Early replication block of human immunodeficiency virus type 1 in monkey cells. J. Gen. Virol. 76:2723-2730.[Abstract/Free Full Text]
    48. 48
  48. Song, B., F. Diaz-Griffero, D. H. Park, T. Rogers, M. Stremlau, and J. Sodroski. 2005. TRIM5alpha association with cytoplasmic bodies is not required for antiretroviral activity. Virology 343:201-211.[CrossRef][Medline]
    49. 49
  49. Song, B., B. Gold, C. O'Huigin, H. Javanbakht, X. Li, M. Stremlau, C. Winkler, M. Dean, and J. Sodroski. 2005. The B30.2(SPRY) domain of the retroviral restriction factor TRIM5{alpha} exhibits lineage-specific length and sequence variation in primates. J. Virol. 79:6111-6121.[Abstract/Free Full Text]
    50. 50
  50. Song, B., H. Javanbakht, M. Perron, D. H. Park, M. Stremlau, and J. Sodroski. 2005. Retrovirus restriction by TRIM5{alpha} variants from Old World and New World primates. J. Virol. 79:3930-3937.[Abstract/Free Full Text]
    51. 51
  51. Sperber, G. O., T. Airola, P. Jern, and J. Blomberg. 2007. Automated recognition of retroviral sequences in genomic data: RetroTector. Nucleic Acids Res. 35:4964-4976.[Abstract/Free Full Text]
    52. 52
  52. Stansell, E., R. Apkarian, S. Haubova, W. E. Diehl, E. M. Tytler, and E. Hunter. 2007. Basic residues in the Mason-Pfizer monkey virus gag matrix domain regulate intracellular trafficking and capsid-membrane interactions. J. Virol. 81:8977-8988.[Abstract/Free Full Text]
    53. 53
  53. Stremlau, M., C. M. Owens, M. J. Perron, M. Kiessling, P. Autissier, and J. Sodroski. 2004. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 427:848-853.[CrossRef][Medline]
    54. 54
  54. Stremlau, M., M. Perron, M. Lee, Y. Li, B. Song, H. Javanbakht, F. Diaz-Griffero, D. J. Anderson, W. I. Sundquist, and J. Sodroski. 2006. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc. Natl. Acad. Sci. USA 103:5514-5519.[Abstract/Free Full Text]
    55. 55
  55. Stremlau, M., M. Perron, S. Welikala, and J. Sodroski. 2005. Species-specific variation in the B30.2(SPRY) domain of TRIM5{alpha} determines the potency of human immunodeficiency virus restriction. J. Virol. 79:3139-3145.[Abstract/Free Full Text]
    56. 56
  56. Takada, A., C. Robison, H. Goto, A. Sanchez, K. G. Murti, M. A. Whitt, and Y. Kawaoka. 1997. A system for functional analysis of Ebola virus glycoprotein. Proc. Natl. Acad. Sci. USA 94:14764-14769.[Abstract/Free Full Text]
    57. 57
  57. Theilen, G. H., D. Gould, M. Fowler, and D. L. Dungworth. 1971. C-type virus in tumor tissue of a woolly monkey (Lagothrix spp.) with fibrosarcoma. J. Natl. Cancer Inst. 47:881-889.[Medline]
    58. 58
  58. Todaro, G. J., R. E. Benveniste, C. J. Sherr, J. Schlom, G. Schidlovsky, and J. R. Stephenson. 1978. Isolation and characterization of a new type D retrovirus from the Asian primate, Presbytis obscurus (spectacled langur). Virology 84:189-194.[CrossRef][Medline]
    59. 59
  59. Todaro, G. J., C. J. Sherr, A. Sen, N. King, M. D. Daniel, and B. Fleckenstein. 1978. Endogenous New World primate type C viruses isolated from owl monkey (Aotus trivirgatus) kidney cell line. Proc. Natl. Acad. Sci. USA 75:1004-1008.[Abstract/Free Full Text]
    60. 60
  60. Turner, G., M. Barbulescu, M. Su, M. I. Jensen-Seaman, K. K. Kidd, and J. Lenz. 2001. Insertional polymorphisms of full-length endogenous retroviruses in humans. Curr. Biol. 11:1531-1535.[CrossRef][Medline]
    61. 61
  61. Wallis, C., and J. L. Melnick. 1968. Stabilization of enveloped viruses by dimethyl sulfoxide. J. Virol. 2:953-954.[Free Full Text]
    62. 62
  62. Wolfe, L. G., F. Deinhardt, G. H. Theilen, H. Rabin, T. Kawakami, and L. K. Bustad. 1971. Induction of tumors in marmoset monkeys by simian sarcoma virus, type 1 (Lagothrix): a preliminary report. J. Natl. Cancer Inst. 47:1115-1120.[Medline]
    63. 63
  63. Yamashita, M., and M. Emerman. 2004. Capsid is a dominant determinant of retrovirus infectivity in nondividing cells. J. Virol. 78:5670-5678.[Abstract/Free Full Text]
    64. 64
  64. Yap, M. W., D. Lindemann, N. Stanke, J. Reh, D. Westphal, H. Hanenberg, S. Ohkura, and J. P. Stoye. 2008. Restriction of foamy viruses by primate Trim5{alpha}. J. Virol. 82:5429-5439.[Abstract/Free Full Text]
    65. 65
  65. Yap, M. W., S. Nisole, C. Lynch, and J. P. Stoye. 2004. Trim5alpha protein restricts both HIV-1 and murine leukemia virus. Proc. Natl. Acad. Sci. USA 101:10786-10791.[Abstract/Free Full Text]
    66. 66
  66. Yap, M. W., S. Nisole, and J. P. Stoye. 2005. A single amino acid change in the SPRY domain of human Trim5alpha leads to HIV-1 restriction. Curr. Biol. 15:73-78.[CrossRef][Medline]
    67. 67
  67. Ylinen, L. M., Z. Keckesova, S. J. Wilson, S. Ranasinghe, and G. J. Towers. 2005. Differential restriction of human immunodeficiency virus type 2 and simian immunodeficiency virus SIVmac by TRIM5{alpha} alleles. J. Virol. 79:11580-11587.[Abstract/Free Full Text]
    68. 68
  68. Yohn, C. T., Z. Jiang, S. D. McGrath, K. E. Hayden, P. Khaitovich, M. E. Johnson, M. Y. Eichler, J. D. McPherson, S. Zhao, S. Paabo, and E. E. Eichler. 2005. Lineage-specific expansions of retroviral insertions within the genomes of African great apes but not humans and orangutans. PLoS Biol. 3:e110.[CrossRef][Medline]
    69. 69
  69. Zhang, X. Y., V. F. La Russa, L. Bao, J. Kolls, P. Schwarzenberger, and J. Reiser. 2002. Lentiviral vectors for sustained transgene expression in human bone marrow-derived stromal cells. Mol. Ther. 5:555-565.[CrossRef][Medline]

Journal of Virology, November 2008, p. 11140-11151, Vol. 82, No. 22
0022-538X/08/$08.00+0     doi:10.1128/JVI.00269-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Diehl, W. E.
Right arrow Articles by Hunter, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diehl, W. E.
Right arrow Articles by Hunter, E.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»