This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hass, M.
Right arrow Articles by Günther, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hass, M.
Right arrow Articles by Günther, S.

 Previous Article  |  Next Article 

Journal of Virology, October 2008, p. 10207-10217, Vol. 82, No. 20
0022-538X/08/$08.00+0     doi:10.1128/JVI.00220-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Mutational Evidence for a Structural Model of the Lassa Virus RNA Polymerase Domain and Identification of Two Residues, Gly1394 and Asp1395, That Are Critical for Transcription but Not Replication of the Genome{triangledown}

Meike Hass,{dagger} Michaela Lelke,{dagger} Carola Busch, Beate Becker-Ziaja, and Stephan Günther*

Department of Virology, Bernhard-Nocht-Institute for Tropical Medicine, 20359 Hamburg, Germany

Received 31 January 2008/ Accepted 23 June 2008


arrow
ABSTRACT
 
The RNA-dependent RNA polymerase (RdRp) of arenaviruses is an integral part of the L protein, a 200-kDa multifunctional and multidomain protein. In view of the paucity of structural data, we recently proposed a model for the RdRp domain of arenaviruses based on the folding of RdRps of plus-strand viruses (S. Vieth et al., Virology 318:153-168, 2004). In the present study, we have chosen a large-scale mutagenesis approach to gain insight into the structure and function of the Lassa virus RdRp domain. A total of 180 different mutants of the domain were generated by using a novel PCR-based mutagenesis technique and tested in the context of the Lassa virus replicon system. Nearly all residues, which were essential for function, clustered in the center of the three-dimensional model including the catalytic site, while residues that were less important for function mapped to the periphery of the model. The combined bioinformatics and mutagenesis data allowed deducing candidate residues for ligand interaction. Mutation of two adjacent residues in the putative palm-thumb subdomain junction, G1394 and D1395 (strain AV), led to a defect in mRNA synthesis but did not affect antigenomic RNA synthesis. In conclusion, the data provide circumstantial evidence for the existence of an RdRp domain between residues 1040 and 1540 of the Lassa virus L protein and the folding model of the domain. A functional element within the RdRp was identified, which is important for transcription but not replication of the genome.


arrow
INTRODUCTION
 
Lassa virus is a segmented negative-strand RNA virus of the family Arenaviridae. It belongs to the Old World complex of the arenaviruses, which also includes the prototype virus of the family, lymphocytic choriomeningitis virus (LCMV). Lassa virus is endemic in large areas of West Africa, where its natural reservoir host, the rodent Mastomys natalensis (23, 37), is prevalent. Transmission of the virus to humans causes Lassa fever, a hemorrhagic fever that is estimated to affect some 100,000 people annually (35). Human-to-human transmission may give rise to nosocomial epidemics with high case fatality rates (11). Currently, no vaccine exists for use in humans. Specific treatment is limited to ribavirin, a broad-spectrum nucleoside analogue, which is mainly effective during the first days of illness (34).

The arenavirus genome consists of two single-stranded RNA segments, each containing two genes in opposite directions, a coding strategy called ambisense (3). The S RNA segment encodes the nucleoprotein (NP) and the glycoprotein precursor. The L RNA encodes the small matrix protein Z (41, 46) and the 200-kDa L protein (44). The minimal viral trans-acting factors required for replication and transcription of the genome are NP and L protein (19, 24, 27). They form, together with virus RNA, the ribonucleoprotein (RNP) complex. Although the L protein is believed to play a central role in RNA synthesis, little is known about the enzymatic function(s) of this large protein. It is most likely the source of the RNA-dependent RNA polymerase (RdRp) activity associated with purified RNPs (12, 15). This hypothesis is supported by sequence homology data predicting an RdRp domain between residues 1040 and 1540 of L protein (30, 49), as well as by mutational analysis of three putative catalytic residues within this domain using the LCMV replicon system (43). Structural data for the L protein are not available. Although there exist a large number of crystal structures of RdRps of plus-strand viruses (1, 6, 8, 9, 13, 18, 25, 29, 32, 33, 39, 40, 53), not a single structure of an RdRp domain from a negative-strand virus, including arenaviruses, has been solved thus far.

In view of the paucity of structural data, we recently proposed a model for the RdRp domain of arenaviruses based on the folding of RdRps of plus-strand viruses (49). Modeling was guided by secondary structure predictions for the Lassa virus RdRp domain, as well as by sequence homology to conserved motifs of RNA-dependent polymerases, called pre-A, A, B, C, D, and E (38, 42). The model displayed one structural peculiarity, a hypothetical alpha-helical subdomain not present in the known RdRp structures.

Aim of the present study was the detailed functional characterization of the RdRp domain of Lassa virus using the minireplicon system (19). Large-scale mutagenesis was performed in order to provide experimental evidence for the structural model and to gain insights into the relevance of individual residues for L-protein function.


arrow
MATERIALS AND METHODS
 
Lassa virus replicon system. Plasmids pCITE-NP, pCITE-L, and pCITE-L_C-flag expressing Lassa virus NP and L protein under the control of a T7 RNA polymerase promoter have been described previously (19). Minigenome (MG) plasmid pLAS-MG contains the T7 promoter followed by a single additional G residue, the 5' noncoding region, chloramphenicol acetyltransferase gene, intergenic region, Renilla luciferase (Ren-Luc) gene in reverse orientation, and 3' noncoding region (20). For transfection, the MG, including the T7 promoter, was amplified for 25 cycles with Phusion DNA polymerase (Finnzymes), 3 ng of linearized pLAS-MG as a template, and the vector-specific primer pUC-fwd and primer LVS-3400 (CGCACAGTGGATCCTAGGCTATTGGA) to generate a functional 3' end. Amplified MG was purified by using PCR purification kit (Macherey & Nagel) and quantified spectrophotometrically.

Mutagenesis of L gene. The functional cassette of pCITE-L (T7 RNA polymerase promoter, internal ribosome entry site, and L gene) was amplified by mutagenic PCR, and the resulting PCR products were used for transfection without prior cloning. The experimental strategy is based on a classical two-step PCR mutagenesis protocol (21) and is schematically outlined in Fig. 1A. PCR was performed with Phusion DNA polymerase (Finnzymes). First, two fragments were amplified for 30 cycles by using 10 ng of linearized pCITE-L (or pCITE-L_C-flag for FLAG-tagged L proteins) as a template and primer combination pUC-fwd/L-mut and L-mut+/pUC-rev, respectively (L-mut was reverse complementary to the corresponding L-mut+ primer) (Fig. 1B, left). The sequences of L-mut and L-mut+ primers (n = 360) can be obtained on request. PCR products were gel purified and fused together in a second PCR containing aliquots of both fragments as a template and primers pUC-fwd/pUC-rev (Fig. 1B right). For generation of hemagglutinin (HA)-tagged L-gene PCR product, the pUC-rev primer was replaced by primer L-HA-rev, adding a C-terminal HA tag to the L gene. Mutant L-gene constructs were purified by using a PCR purification kit (Macherey & Nagel) and quantified spectrophotometrically. The presence of the artificial mutation was ascertained by sequencing the final PCR product. In each mutagenesis PCR, wild-type L gene was amplified in parallel using unmodified primers binding to the L gene around amino acid position 1334. The wild-type PCR product served as a positive control for the transfection experiment.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 1. PCR-based mutagenesis of Lassa virus L protein. (A) Generation of L-protein mutants using pCITE-L (T7 RNA polymerase promoter, internal ribosome entry site, and L gene) or pCITE-L_C-flag (L gene with a C-terminal FLAG sequence) as a template for PCR-based mutagenesis. Arrows indicate primers for PCR. A cross indicates artificial mutation. The following primer combinations were used for generation of mutants: PCR-a, pUC-fwd (a+) and mutagenic primer L-mut (a–); PCR-b, mutagenic primer L-mut+ (b+) and pUC-rev (b–); and PCR-c, pUC-fwd (a+) and pUC-rev (b–). Primers L-mut (a–) and L-mut+ (b+) are reverse complementary to each other, facilitating fusion of PCR-a and PCR-b fragments during PCR-c. (B) Agarose gel analysis of PCR fragments generated by the two-step PCR protocol. A set of five representative examples is shown. The fragments shown in the right panel were used for transfection. (C) Immunoblot analysis of FLAG-tagged L-protein mutants. BHK-21 cells were infected with MVA-T7 and transfected with PCR product generated as shown in panels A and B, using pCITE-L_C-flag as a template for mutagenesis. L protein in cytoplasmic lysate was separated by SDS-PAGE, blotted, and detected with anti-FLAG M2 monoclonal antibody. Control cells were infected with MVA-T7 but not transfected. The activity of the mutant in replicon assay is shown below the blot. (D) Immunoblot analysis of HA-tagged L-protein mutants. BSR T7/5 cells were infected with MVA-T7 and transfected with PCR product generated with primer L-HA-rev instead of pUC-rev to add a C-terminal HA tag to the L gene. L protein in cytoplasmic lysate was separated by SDS-PAGE, blotted, and detected with anti-HA antibody. Control cells were infected with MVA-T7 but not transfected. (E) Log activity of the replicon system depending on the amount of transfected PCR product for expression of wild-type L protein. Transfection of replicon components and calculation of log activity was performed as described in Materials and Methods.

Cells and transfections. BSR T7/5 cells (7) stably expressing T7 RNA polymerase and BHK-21 cells were grown in Glasgow modified Eagle medium (MEM; Gibco) supplemented with 5% fetal calf serum (FCS). Every second passage, 1 mg of Geneticin (Gibco) per ml of medium was added to BSR T7/5 cells. One day before transfection, cells were seeded at a density of 5 x 105 cells or 1 x 105 cells per well of a 6-well or a 24-well plate, respectively. Transfections were performed with Lipofectamine 2000 (Invitrogen) at 3 µl/µg of DNA in Glasgow MEM without FCS. Medium was replaced 4 h after transfection by fresh medium complemented with FCS.

BSR T7/5 cells in a well of a 24-well plate were transfected with 250 ng of MG, 250 ng of L-gene PCR product, 250 ng of pCITE-NP, and 10 ng of pCITE-FF-luc (expression construct for firefly luciferase) as a transfection control. One day after transfection, cells were lysed in 100 µl of passive lysis buffer (Promega) per well, and 20 µl of the lysate was assayed for firefly luciferase and Ren-Luc activity using the dual-luciferase reporter assay system (Promega) as described by the manufacturer. Ren-Luc levels were first corrected with the firefly luciferase levels (resulting in standardized relative light units [sRLU]) to compensate for differences in transfection efficiency or cell density. In order to consider the full activity range of the replicon system, which covers 2 to 3 log units (19), the sRLU values were log transformed and then normalized with respect to wild-type and negative controls as follows: relative log activity = (log[sRLUmutant] – log[sRLUnc])/(log[sRLUwt] – log[sRLUnc]), where "nc" stands for negative controls and "wt" stands for wild type.

All mutants were transfected in duplicate, and for 40% of the mutants two to four independent transfection experiments were performed. The interexperimental variability of the method was calculated by using the relative log activity data from all repeat experiments (n = 205 independent transfections for 76 mutants). The mean standard deviation for repeat experiments was 8% relative log units.

Immunoblot analysis of L protein. BSR T7/5 or BHK-21 cells were inoculated with modified vaccinia virus Ankara expressing T7 RNA polymerase (MVA-T7) (47) at a multiplicity of infection of 5 for 1 h before transfection. Cells in a well of a six-well plate were transfected with 750 ng of mutant or wild-type L gene tagged with a Flag or HA sequence. Cells were harvested 24 h after transfection and lysed in cytoplasmic lysis buffer. Nuclei were pelleted by centrifugation, and the cytoplasmic lysate was mixed with 2x sodium dodecyl sulfate (SDS) lysis buffer (100 mM Tris-HCl [pH 6.8], 20% glycerol, 2% SDS, 0.1% bromophenol blue, 0.1 M dithiothreitol). Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE), transferred to nitrocellulose membrane (Schleicher & Schuell), and visualized by staining with Fast Green FCF (Roth) for 5 min. Membranes were blocked with 1x Roti-Block (Roth) overnight at room temperature and then incubated with anti-Flag M2 monoclonal antibody (1 µg/ml; Sigma-Aldrich) or anti-HA (1:10,000, H-6908; Sigma-Aldrich) in Tris-buffered saline-0.2x Roti-Block for 1 h at room temperature. After a washing step, blots were incubated with horseradish peroxidase-coupled secondary antibodies (Dianova) for 1 h at room temperature. Protein bands were visualized by chemiluminescence using SuperSignal West Pico or Femto substrate (Pierce) and X-ray film (Kodak).

Northern blot analysis. Total RNA of transfected BSR T7/5 cells was purified by using an RNeasy kit (Qiagen). RNA (2 to 5 µg) was separated in a 1.5% agarose-formaldehyde gel and transferred onto a Hybond N+ membrane (Amersham Pharmacia Biotech). Blots were prehybridized in 50% deionized formamide-0.5% SDS-5x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-5x Denhardt solution for 1 h at 68°C. Hybridization was done in the same buffer with an antisense 32P-labeled riboprobe of the Ren-Luc gene at 68°C for 16 h. Filters were washed several times, and RNA bands were visualized by autoradiography using a PhosphorImager Typhoon 9210 (Amersham Biosciences). Signals were quantified by using TINA software (Raytest, Straubenhardt, Germany).

Bioinformatics analysis. Amino acid sequences of the L gene were aligned by the program CLUSTAL W implemented into MacVector 7.0 software (Oxford Molecular). Drawings of structural models were generated with Swiss-PdbViewer 3.7 (16).


arrow
RESULTS
 
Functional analysis of the putative RdRp domain of Lassa virus L protein by large-scale mutagenesis. Initially, we attempted to perform large-scale mutagenesis of the RdRp domain using classical, plasmid-based in vitro mutagenesis of the L gene. However, this approach failed due to the extremely low efficiency of various Escherichia coli strains to propagate the pCITE-L plasmid. Therefore, a PCR-based mutagenesis technique was established that completely circumvents cloning (see Materials and Methods for details) (Fig. 1) and facilitates the generation of a large number of mutant L genes. Immunoblot analysis of selected mutants indicates that the L protein is expressed in full-length by this technique (Fig. 1C and D).

In total, 180 different mutants of the Lassa virus RdRp domain were generated and tested in the context of the replicon system. Because the replicon has a measurement range of 2- to 3-log units, the raw data (sRLU values) were log transformed and normalized with respect to the wild type (100%) and the negative control (0%). This simple data processing facilitated clear discrimination between inactive mutants and mutants with reduced activity and enhanced interexperimental comparability. Details on the interrelationship between sRLU values and the log activity values are provided in Fig. 2. Depending on their log activity level, the mutants were grouped into three classes: inactive mutants labeled with a red color code or "-" in Fig. 1 to 4 and Table 1; mutants with clearly detectable but reduced activity labeled with an orange color code or "+" and mutants with wild-type activity labeled with green color code or "++" (Fig. 2). Variation in the amount of transfected PCR product had little influence on the log-activity as tested with wild-type L protein (Fig. 1E).


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 2. Histogram of log activity values of 180 L-protein mutants tested in the study. Ren-Luc activity was corrected with the firefly luciferase levels (indicated as sRLU values). The sRLU values were log transformed and normalized with respect to the wild type (100%) and negative controls (0%). For calculation of log activity values, see Materials and Methods. Mutants were divided into three classes: inactive mutants with log-activity below 30%, mutants showing clearly detectable but reduced activity with log-activity values between 30 and 80%, and mutants showing wild-type activity with log-activity values above 80%. Below the graph, the number of mutants in each class and the corresponding activity code used in text, figures, and tables are indicated. In addition, the mean and range (minimum and maximum) of the original sRLU values of all mutants falling within a class are shown to demonstrate the interrelationship between original and log-transformed data. The sRLU values are given as a percentage of the corresponding wild-type value.


Figure 4
View larger version (71K):
[in this window]
[in a new window]

 
FIG. 4. Influence of L-protein mutations on transcription and replication. (A) Functional elements of the minireplicon and expressed RNA species (CAT, chloramphenicol acetyltransferase gene; Ren-Luc, Renilla luciferase gene). The mRNA terminates in the intergenic region, while the antigenome terminates at the 5' end of genomic RNA. (B to E) Northern blot analysis of RNA synthesized by selected L-protein mutants in the context of the replicon system. Antigenomic RNA and Ren-Luc mRNA were detected using a riboprobe hybridizing to the Ren-Luc gene. Mutations in L protein are indicated above the blot. The corresponding activity of the mutant in the luciferase assay is indicated below the blot (–, inactive mutant; +, mutant with reduced activity; and ++, mutant with wild-type activity). Negative control cells expressed minigenome and NP but lacked L protein. The methylene blue-stained 28S rRNA is shown below the blots as a marker for gel loading and RNA transfer. Due to differences in background intensity, some lanes were individually adjusted for brightness and contrast (marked with an asterisk). (F) The signals on the Northern blots were quantified and the ratio between Ren-Luc mRNA and antigenomic RNA was calculated. In order to make the mRNA-antigenomic RNA ratios from different experiments comparable, the ratio obtained with wild-type L protein was set as 1.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Detailed mutational analysis of residues in conserved polymerase motifs and putative homologous sites in HCV and FMDVa

In the first set of experiments, the RdRp model (49) was challenged by alanine scanning mutagenesis. This technique essentially probes the relevance of side chains for protein function. About 20% of the whole sequence, namely, 93 residues, of the Lassa virus RdRp domain were individually changed to alanine (Fig. 3A). On the one hand, mutagenesis was focused on residues in the motifs pre-A, A, B, C, D, and E. Core residues that are likely to play a role in the catalytic process, as well as randomly selected, mainly charged residues that are conserved among arenaviruses were mutated within the motifs. On the other hand, predominantly charged residues outside of the motifs were randomly selected for mutagenesis. Due to high sequence variability in these regions, the selected residues were often only partially conserved among arenaviruses. Particular attention was paid to motif E and downstream residues due to the findings described below.


Figure 3
View larger version (61K):
[in this window]
[in a new window]

 
FIG. 3. Large-scale mutagenesis of the RdRp domain of Lassa virus L protein. (A) Alignment of the RdRp domain of representative Old World and New World arenaviruses. Residues are numbered according to the position in the L protein of Lassa virus strain AV. The predicted secondary structure (49) and the conserved RdRp motifs are shown below and above the alignment, respectively. Residue-to-alanine mutations are indicated by filled rectangles, and Gly-Gly insertions are indicated by triangles. The color of the rectangle or triangle indicates the activity of the corresponding mutant (red for inactive mutants, orange for mutants with reduced activity, and green for mutants with wild-type activity). (B) Front view of the folding model for the RdRp domain of arenaviruses (49). The hypothetical alpha-helical subdomain not present in known RdRp structures is encircled. Positions of Gly-Gly insertions, which did not render the L protein inactive, are indicated by triangles. The color of the triangle indicates the activity of the corresponding mutant. Arrows mark the positions of G1394 and D1395 at the junction of palm and thumb subdomain. (C) Labeling of residues in the model according to the activity of the corresponding alanine mutants. Front and top views of the model are shown on the left and right, respectively. The color of a residue indicates the activity of the corresponding mutant (red for inactive mutants, orange for mutants with reduced activity, and green for mutants with wild-type activity).

A total of 40% of the alanine mutants were inactive (Fig. 3, red color code), 27% showed clearly detectable but reduced activity (orange color code), and 33% showed activity comparable to that of wild-type L protein (green color code). There was a clear correlation between position of a mutation and replicon activity. Of mutations that rendered the L protein inactive, 81% clustered in motifs pre-A, A, B, C, D, and E (Fig. 3A). Mutations associated with reduced L-protein activity were equally distributed within and outside of the conserved motifs, whereas 74% of mutations, which do not significantly interfere with L-protein function, were located outside of the motifs (Fig. 3). In order to visualize the correlation between the position of a residue and its relevance for protein function in the context of the three-dimensional model, the residues in the model were labeled according to the activity of the corresponding alanine mutant (Fig. 3C). The front and top view of the RdRp model demonstrate that nearly all residues that are essential for function cluster in the center of the molecule forming the catalytic site, while residues that are less important for function are located at the periphery of the molecule. Only two of the residues, which were found to be essential for activity, namely, E1105 and R1446, are not in proximity to the catalytic center of the RdRp (Fig. 3C). Immunoblot analysis was performed for 34 inactive alanine mutants and 5 mutants with reduced activity (Fig. 1C and D). All mutants were expressed in amounts comparable to the wild-type L protein.

In a second set of experiments, we sought to provide additional evidence for the overall structure of the RdRp domain. To this end, more drastic changes were made to the molecule by inserting two glycine residues in predicted alpha helices (13 mutants), as well as in predicted loop regions (15 mutants) (Fig. 3A). As expected, Gly-Gly insertion into predicted helices was not compatible with L-protein function, while one-third of the mutants with insertions into loop sequences remained partially or fully active (positions 1164, 1221, 1265, 1283, and 1324) (Fig. 3B). Notably, the finding that mutants with insertions at positions 1254 and 1275 were inactive, while those with insertions at positions 1265 and 1283 remained functional, is consistent with the prediction of a helix-loop-helix-loop structure between positions 1244 and 1287 of Lassa virus L protein (49) (Fig. 3B, encircled). This hypothetical structure has thus far no counterpart in crystal structures of plus-strand virus RdRps.

In the third set of mutagenesis experiments, we focused on 22 residues that are likely to play a role in the enzymatic function of the RdRp. These residues were selected because they are highly conserved among segmented negative-strand RNA viruses, and/or have identifiable homologous residues in crystal structures of RdRp of plus-strand RNA viruses. Subtle changes were made to these residues to elucidate structural requirements for catalysis at the level of the side chain (Table 1). The prime candidates for coordinating the Mg2+ ion in the center of the Lassa virus RdRp are D1193 in motif A, as well as D1334 and D1335 in motif D. Even subtle changes to glutamate or asparagine were not tolerated at these positions. Further positions, which tolerate neither alanine nor chemically related side chains, include K1127, R1134, and K1144 in motif pre-A and K1376 in motif D. The three basic residues in motif pre-A probably interact with the incoming NTP and the template strand. The central glycine residue of motif B (G1298), which is completely conserved among RNA-dependent polymerases (42), seems to be invariable, too. Other residues, which did not tolerate an exchange to alanine, including L1136, R1148, E1151, W1197, E1385, F1386, and F1390, could be changed to chemically related amino acids without (complete) loss of function, indicating some flexibility with respect to the side chains at these positions. The observation that three residues of motif A, namely, S1195, K1196, and G1198, could be replaced by alanine without affecting replicon activity was unexpected since these residues are conserved among all arenavirus species, although structural considerations are in agreement with this finding (see Discussion).

In conclusion, data of all three sets of experiments provide circumstantial evidence for the existence of an RdRp domain between residues 1040 and 1540 of the Lassa virus L protein and the folding model as shown in Fig. 3.

Selective impact of mutations on transcription and replication. The Lassa virus L protein mediates the synthesis of two RNA species: (i) capped mRNA terminating within the intergenic region and (ii) antigenomic RNA being a full-length copy of the genomic RNA template (14, 36). This dual role in RNA synthesis is reproduced in the minireplicon system (Fig. 4A). In analogy to natural infection, Ren-Luc mRNA and antigenomic RNA are synthesized roughly in a 1:1 ratio. Since the mode of initiation of transcription for both species is probably different—primer-dependent for mRNA and de novo for antigenome—we hypothesized that it might be possible to separate both processes by mutagenesis. Initially, 26 L-protein mutants were selected for screening. The selection included mutants with a broad range of activity, as tested by Ren-Luc assay. The mutant L proteins were expressed in the context of the replicon system, and total cellular RNA was prepared and subjected to Northern blotting (Fig. 4B). The signal intensities on the Northern blot were measured and used to calculate the steady-state level of Ren-Luc mRNA in relation to that of antigenomic RNA (Fig. 4F).

Mutation of important residues as listed in Table 1 led to the complete loss of RNA synthesis (Fig. 4B; K1127R, D1193E, E1151A, G1298A, D1334N, D1335N, and K1376R). The same was observed for other mutants that were negative in the Ren-Luc assay. Mutants with wild-type-like or reduced Ren-Luc activity expressed Ren-Luc mRNA and antigenome in a ratio comparable to that of the wild type (Fig. 4B; E1080A, K1180A, F1206W, K1258A, K1265A, F1386Y, P1416A, and T1401A). However, one mutant, D1395A, was found that showed clearly reduced Ren-Luc mRNA level, a finding consistent with reduced Ren-Luc activity, whereas the antigenome RNA level was comparable to wild type. Position 1395 is located in the junction between palm and thumb subdomain of the RdRp model, at the C-terminal end of motif E (Fig. 3). To elucidate whether mutation of other residues in this region leads to a similar phenotype, all residues between positions 1386 and 1400 were exchanged individually, and the respective mutants were analyzed by Northern blotting (Fig. 4C and D). One additional mutant, G1394A, showed selective reduction in Ren-Luc mRNA level. Thus, mutation of two adjacent residues in the putative palm-thumb junction, G1394 and D1395, led to selective defect in mRNA synthesis. To substantiate and extend these data, G1394 was changed to Ala, Val, Leu, Ile, Tyr, Pro, Asp, Lys, and Ser, and D1395 was changed to Ala, Gly, Tyr, Pro, Lys, Gln, and Glu (Fig. 4D, E, and F). All G1394 mutants showed the mRNA-defective phenotype. The exchange with Asp, Leu, Ile, Pro, or Lys led to complete loss of Ren-Luc activity. The less-pronounced phenotype of the G1394S mutant (Fig. 4F) might be explained by the natural occurrence of Ser at this position in some New World arenaviruses (Fig. 3A, Pichinde and Pirital virus). Exchange of D1395 with Gly, Tyr, Lys, and Gln also induced the mRNA defective phenotype, with Lys, Gly, and Tyr completely blocking Ren-Luc activity. Mutation D1395P inhibited transcription of both mRNA and antigenomic RNA, whereas D1395E had no effect at all. The latter is consistent with the fact that Glu is naturally found in several arenavirus species at position 1395 (Fig. 3A, LCMV, and Junin virus). Taken together, these experiments indicate that residues G1394 and D1395 represent a functional element that plays an important role in expression of mRNA but not antigenomic RNA.

Characterization of dominant-negative mutants. RdRp monomers of several RNA viruses interact with each other (22, 45, 51). Recently, it has been shown that also L protein of LCMV forms oligomers and that defective L-protein mutants with exchanges of the catalytic residues in motifs A and C show a dominant-negative effect (43). We wondered whether any defective mutant can exert a dominant-negative effect or whether this is confined to specific mutants. A total of 68 inactive RdRp mutants were transfected in a ratio of 1:1 with wild-type L protein (Fig. 5A). As a control, 21 mutants with reduced or wild-type Ren-Luc activity were transfected (Fig. 5B). Controls and inactive mutants with exchanges outside of the polymerase motifs generally did not show a dominant-negative effect, except for two inactive mutants, K1402A and G1434A, with a borderline effect. Clear dominant-negative effects were only seen with mutants affecting residues in motifs pre-A (K1127, R1134, E1135, L1136, D1140, and K1144), A (D1193), B (G1298), C (S1333, D1334, and D1335), and D (K1376). According to the structural model, most, if not all, of these residues play a key role in the catalytic process (see Table 1). In some cases, the effect was dependent on the specific exchange at a given position (e.g., K1376). There was hardly any effect with mutants with exchanges in motif E and the adjacent palm-thumb junction. These data suggest that only a subset of defective mutants exerts a dominant-negative effect, in particular those affecting enzymatically critical residues in motifs pre-A, A, B, C, and D.


Figure 5
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 5. Dominant-negative effect of L-protein mutants. (A) Inactive mutants were transfected in a ratio of 1:1 with wild-type L protein. As a control, a PCR fragment of the L gene lacking the upstream T7 RNA polymerase promoter was transfected 1:1 with the complete PCR fragment for the expression of wild-type L protein. Open boxes mark conserved polymerase motifs. The means and ranges of duplicate experiments are shown. (B) Mutants with reduced or wild-type Ren-Luc activity were transfected in a ratio of 1:1 with wild-type L protein.


arrow
DISCUSSION
 
This study provides experimental evidence for the structural model of the Lassa virus RdRp domain and identifies functionally important residues. In addition, it was demonstrated that two residues, G1394 and D1395, in the junction between palm and thumb subdomain are important for mRNA but not antigenome synthesis.

Our knowledge on the RdRp of negative-strand viruses is rather poor compared to plus-strand viruses. Attempts to solve L-protein structures of negative-strand viruses have thus far not been successful, except for the C-terminal domain of influenza virus PB2 (48). A major obstacle to both structural and functional analysis of the RdRps of negative-strand viruses is the fact that the enzymes are an integral part of large multifunctional and multidomain proteins (except for the Orthomyxoviridae), which are difficult to express or crystallize. We have chosen an extensive mutagenesis approach to gain insights into structure and function of the Lassa virus RdRp domain. However, when starting the work we noticed that modifying the plasmid-integrated L gene by classical mutagenesis techniques is difficult, probably due to extreme instability or toxicity of the plasmid. For this reason we designed a mutagenesis strategy that is solely based on PCR. Different thermostable DNA polymerases were tested, but only Phusion polymerase, a Pyrococcus DNA polymerase-like enzyme fused with a double-stranded DNA-binding domain (52), had sufficient processivity. The enzyme readily amplified large amounts of up to 8-kb fragments during the two-step mutagenesis process (Fig. 1B). Most importantly, this enzyme also shows a high fidelity with an error rate of 5 x 10–7 per position (26). Even after a millionfold amplification of the L gene during the procedure (which is an overestimation since it would imply the synthesis of about 10 mg of PCR product from 10 ng of template), 96% of the PCR products would be free of errors (17). Thus, the integrity of the genetic information is maintained during the PCR mutagenesis. This is crucial since experiments with hepatitis B virus have indicated that random introduction of more than one nucleotide change per genome tends to interfere with replication competence (17). Eventually, this technique allowed us to generate and test in cell culture 180 different mutants with single nucleotide exchanges or Gly-Gly insertions. We hope that this technique will facilitate similar large-scale mutagenesis projects in the future, in particular if the DNA is difficult to maintain in bacteria.

Although large-scale mutagenesis cannot replace true structure determination, it appears feasible to gain structural information if a model is available. Indeed, we found it surprising how precisely the experimental data matched with the predictions of the model. Mutation of nearly all residues located at the periphery of the model had no or only partial effect on protein function, while mutation of residues that are predicted to form the core of the molecule, including the catalytic center, was usually detrimental. Immunoblot analysis of inactive alanine mutants indicates that the detrimental effect is caused at the level of the side chain rather than due to reduced protein expression or stability. The combined bioinformatics and mutagenesis data even allow deducing putative RdRp-ligand binding sites, using the foot-and-mouth disease virus RdRp structure in complex with template-primer RNA and NTP (9), and the hepatitis C virus (HCV) RdRp structure superimposed with template-primer RNA/NTP coordinates (6) as a guide. Most reliable predictions for binding sites in Lassa virus RdRp are listed in Table 1. In agreement with previous experiments on the RdRp domain of LCMV (43), D1193 in motif A and D1334 and D1335 in motif C are likely to coordinate the Mg2+ ion. Interaction with the incoming NTP might include R1119, K1121, K1127, and R1134 in motif pre-A. Candidates for binding to the template strand are D1116, L1136, I1138, D1140, K1144, R1148, and E1155 in motif pre-A and Q1297, G1298, L1300, and S1304 in motif B. Interaction with the primer strand could involve K1387, S1388, and R1389 in motif E, as well as K1402 in the first helix of the thumb subdomain. Most of the remaining essential residues appear to be involved in intradomain interactions. For example, the conserved residues W1197 and F1206 may contribute to the hydrophobic core of the molecule. The G1434 residue in the loop between the second and third helix of the thumb subdomain might be required for keeping this region flexible.

There are only very few essential residues that do not appear to be involved in intradomain interactions or interactions with RNA or NTP. Notably, E1105 and R1446 were found to be important for activity, although they are not located in proximity to the catalytic center of the model (Fig. 3C). Both residues are close to N and C terminus of the domain, respectively, and it might be that the model is not precise in these distal regions. Alternatively, the residues might be involved in essential interdomain or L-protein-L-protein interactions.

A virtual discrepancy between bioinformatics and mutagenesis data was seen with residues S1195 and K1196 in motif A. Both could be changed to alanine without significant loss of L-protein activity, although they are conserved among segmented negative-strand viruses (Table 1). A Ser-Lys/Arg-Trp stretch is also found in motif A of different caliciviruses, for which crystal structures of the RdRp are available (13, 39, 40). In these structures, Ser and Lys are directed toward the surface of the molecule, whereas Trp is directed toward the inner core. It is tempting to speculate that a similar arrangement exists in Lassa virus RdRp, which would be consistent with the mutagenesis data indicating that S1195 and K1196 are not important for protein function, while W1197 is essential. However, the reason for evolutionary conservation of the Ser and Lys residues remains elusive.

Based on bioinformatics analysis, we previously predicted the existence of an additional helical subdomain between positions 1244 and 1287 of the Lassa virus L protein (49). This prediction was substantiated by experimental data. In particular, the Gly-Gly insertions provided evidence for a helix-loop-helix-loop structure. In addition, none of the four charged-to-alanine mutants in this region was defective, suggesting that this substructure does not contribute to the catalytic center.

Direct physical interaction between RdRp monomers and dominant-negative effects of RdRp mutants have been observed with various viruses, including LCMV (22, 43, 45, 51). The molecular mechanism underlying the dominant-negative effect is not known. Our data show that defective mutants do not generally exert a dominant-negative effect. For example, L-protein mutants with Gly-Gly insertion did not suppress wild-type L-protein activity, probably because they are misfolded and thus not able to interact with the wild-type protein. On the other hand, several mutants with exchanges of enzymatically important residues in motifs pre-A, A, B, C, and D showed a strong dominant-negative effect, suggesting that structural integrity in conjunction with inability to bind NTP, template, or Mg2+ are prerequisites for the effect.

The most interesting finding of the study is the identification of a novel functional element in Lassa virus RdRp that is important for mRNA synthesis but less relevant for antigenomic and probably genomic RNA synthesis. The element, consisting of G1394 and D1395, is located in the region connecting palm and thumb subdomain. This region is predicted to form a beta strand (motif E), followed by the loop Trp-Gly(1394)-Asp(1395)-Glu-Val with Gly and Asp being located at the tip of the loop. This prediction is further supported by the folding of the homologous sequence Trp-Gly-Asp-Glu-Ile in crystal structure 2NNZ (residues 48 to 52). These residues are located at the end of a beta strand and form a 180° turn with Gly-Asp at the tip of the loop. In agreement with our model, the side chain of aspartate is oriented toward the surface of the structure, raising the possibility that this residue makes contact with other parts of the L protein. How the Gly-Asp element functions in regulating mRNA synthesis is speculative. We assume that it represents a hinge between palm and thumb subdomain and is important for flexibility of the thumb relative to palm subdomain. There are several examples in the literature demonstrating flexibility of the palm-thumb junction. For the RdRp of rabbit hemorrhagic disease virus, so-called "open" and "closed" conformations, in which the thumb is moved relative to the palm, have been found in the crystal (39). The hinge region for this movement is located within the palm-thumb connection. In human immunodeficiency virus type 1 reverse transcriptase and HCV RdRp, a conformational change of the thumb relative to the palm was induced upon binding of allosteric inhibitors, and it has been speculated that the inhibitors act by restricting the mobility of the thumb subdomain (4, 5, 28, 50).

Lassa virus RdRp synthesizes two RNA species, capped mRNA that contains four to five nontemplated nucleotides at the 5' end, and genomic or antigenomic RNA that lacks a cap and contains only a single additional guanosine at 5' end (14, 36). It is believed that the four to five nontemplated nucleotides together with the cap structure are cleaved off from cellular mRNAs by a virus-encoded endonuclease and serve as primer for viral mRNA synthesis. The synthesis of genomic or antigenomic RNA is probably the result of de novo initiation. Since mutation of G1394 or D1395 did not affect antigenomic RNA synthesis, these residues are apparently not critical for de novo initiation and elongation. The selective effect on mRNA synthesis suggests that primer-dependent initiation of transcription is blocked. In view of the predicted location of G1394 and D1395 in the hinge region between palm and thumb subdomain, it is tempting to speculate that the degree of structural flexibility required for primer-dependent versus de novo initiation is different. In fact, a primer consisting of cap and four to five nucleotides has to be translocated to the catalytic site, most likely from front or top of the molecule, requiring movement of the thumb subdomain (Fig. 6). A front-loading mechanism has also been proposed for the protein-primer of picornavirus RdRps (2, 10). In contrast, de novo initiation and elongation solely depend on NTP influx through the NTP tunnel at the back of the RdRp. Taken together, we speculate that exchange of residues G1394 and D1395 reduces the mobility of the thumb subdomain, preventing primer translocation to the catalytic site, while leaving sufficient flexibility for de novo initiation or elongation. In addition, D1395 could make important contacts to other domains or virus proteins, which play a role in initiation of mRNA synthesis, as has been described for the interaction of poliovirus RdRp with viral protein 3AB via residues adjacent to motif E (31).


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 6. Hypothetical function of residues G1394 and D1395 in initiation of transcription. The Lassa virus RdRp initially forms a complex with the template RNA (left). To initiate mRNA synthesis, a primer consisting of a cap structure and four to five nucleotides has to be translocated to the catalytic site from the front or top. This probably requires a conformational change of the thumb subdomain relative to the other subdomains (middle). G1394 and D1395 may represent the hinge between palm and thumb subdomain and are therefore important for mobility of the thumb. After formation of the primer-template complex, mRNA synthesis starts (right).


arrow
ACKNOWLEDGMENTS
 
This study was supported by grant E/B41G/1G309/1A403 from the Bundesamt für Wehrtechnik und Beschaffung and VIZIER integrated project grant LSHG-CT-2004-511960 of the European Union 6th Framework. The Bernhard-Nocht-Institut is supported by the Bundesministerium für Gesundheit and the Freie und Hansestadt Hamburg.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Bernhard-Nocht-Institute of Tropical Medicine, Bernhard-Nocht-Strasse 74, D-20359 Hamburg, Germany. Phone: (49) 40 42818 421. Fax: (49) 40 42818 378. E-mail: guenther{at}bni.uni-hamburg.de Back

{triangledown} Published ahead of print on 30 July 2008. Back

{dagger} M.H. and M.L. contributed equally to this study. Back


arrow
REFERENCES
 
    1
  1. Ago, H., T. Adachi, A. Yoshida, M. Yamamoto, N. Habuka, K. Yatsunami, and M. Miyano. 1999. Crystal structure of the RNA-dependent RNA polymerase of hepatitis C virus. Structure 7:1417-1426.[Medline]
  2. 2
  3. Appleby, T. C., H. Luecke, J. H. Shim, J. Z. Wu, I. W. Cheney, W. Zhong, L. Vogeley, Z. Hong, and N. Yao. 2005. Crystal structure of complete rhinovirus RNA polymerase suggests front loading of protein primer. J. Virol. 79:277-288.[Abstract/Free Full Text]
  4. 3
  5. Auperin, D. D., V. Romanowski, M. Galinski, and D. H. Bishop. 1984. Sequencing studies of Pichinde arenavirus S RNA indicate a novel coding strategy, an ambisense viral S RNA. J. Virol. 52:897-904.[Abstract/Free Full Text]
  6. 4
  7. Bahar, I., B. Erman, R. L. Jernigan, A. R. Atilgan, and D. G. Covell. 1999. Collective motions in HIV-1 reverse transcriptase: examination of flexibility and enzyme function. J. Mol. Biol. 285:1023-1037.[CrossRef][Medline]
  8. 5
  9. Biswal, B. K., M. M. Cherney, M. Wang, L. Chan, C. G. Yannopoulos, D. Bilimoria, O. Nicolas, J. Bedard, and M. N. James. 2005. Crystal structures of the RNA-dependent RNA polymerase genotype 2a of hepatitis C virus reveal two conformations and suggest mechanisms of inhibition by non-nucleoside inhibitors. J. Biol. Chem. 280:18202-18210.[Abstract/Free Full Text]
  10. 6
  11. Bressanelli, S., L. Tomei, A. Roussel, I. Incitti, R. L. Vitale, M. Mathieu, R. De Francesco, and F. A. Rey. 1999. Crystal structure of the RNA-dependent RNA polymerase of hepatitis C virus. Proc. Natl. Acad. Sci. USA 96:13034-13039.[Abstract/Free Full Text]
  12. 7
  13. Buchholz, U. J., S. Finke, and K. K. Conzelmann. 1999. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 73:251-259.[Abstract/Free Full Text]
  14. 8
  15. Choi, K. H., J. M. Groarke, D. C. Young, R. J. Kuhn, J. L. Smith, D. C. Pevear, and M. G. Rossmann. 2004. The structure of the RNA-dependent RNA polymerase from bovine viral diarrhea virus establishes the role of GTP in de novo initiation. Proc. Natl. Acad. Sci. USA 101:4425-4430.[Abstract/Free Full Text]
  16. 9
  17. Ferrer-Orta, C., A. Arias, R. Perez-Luque, C. Escarmis, E. Domingo, and N. Verdaguer. 2004. Structure of foot-and-mouth disease virus RNA-dependent RNA polymerase and its complex with a template-primer RNA. J. Biol. Chem. 279:47212-47221.[Abstract/Free Full Text]
  18. 10
  19. Ferrer-Orta, C., A. Arias, R. Agudo, R. Perez-Luque, C. Escarmis, E. Domingo, and N. Verdaguer. 2006. The structure of a protein primer-polymerase complex in the initiation of genome replication. EMBO J. 25:880-888.[CrossRef][Medline]
  20. 11
  21. Fisher-Hoch, S. P., O. Tomori, A. Nasidi, G. I. Perez-Oronoz, Y. Fakile, L. Hutwagner, and J. B. McCormick. 1995. Review of cases of nosocomial Lassa fever in Nigeria: the high price of poor medical practice. BMJ. 311:857-859.[Abstract/Free Full Text]
  22. 12
  23. Fuller-Pace, F. V., and P. J. Southern. 1989. Detection of virus-specific RNA-dependent RNA polymerase activity in extracts from cells infected with lymphocytic choriomeningitis virus: in vitro synthesis of full-length viral RNA species. J. Virol. 63:1938-1944.[Abstract/Free Full Text]
  24. 13
  25. Fullerton, S. W., M. Blaschke, B. Coutard, J. Gebhardt, A. Gorbalenya, B. Canard, P. A. Tucker, and J. Rohayem. 2007. Structural and functional characterization of sapovirus RNA-dependent RNA polymerase. J. Virol. 81:1858-1871.[Abstract/Free Full Text]
  26. 14
  27. Garcin, D., and D. Kolakofsky. 1990. A novel mechanism for the initiation of Tacaribe arenavirus genome replication. J. Virol. 64:6196-6203.[Abstract/Free Full Text]
  28. 15
  29. Garcin, D., and D. Kolakofsky. 1992. Tacaribe arenavirus RNA synthesis in vitro is primer dependent and suggests an unusual model for the initiation of genome replication. J. Virol. 66:1370-1376.[Abstract/Free Full Text]
  30. 16
  31. Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723.[CrossRef][Medline]
  32. 17
  33. Gunther, S., G. Sommer, F. Von Breunig, A. Iwanska, T. Kalinina, M. Sterneck, and H. Will. 1998. Amplification of full-length hepatitis B virus genomes from samples from patients with low levels of viremia: frequency and functional consequences of PCR-introduced mutations. J. Clin. Microbiol. 36:531-538.[Abstract/Free Full Text]
  34. 18
  35. Hansen, J. L., A. M. Long, and S. C. Schultz. 1997. Structure of the RNA-dependent RNA polymerase of poliovirus. Structure 5:1109-1122.[Medline]
  36. 19
  37. Hass, M., U. Golnitz, S. Muller, B. Becker-Ziaja, and S. Gunther. 2004. Replicon system for Lassa virus. J. Virol. 78:13793-13803.[Abstract/Free Full Text]
  38. 20
  39. Hass, M., M. Westerkofsky, S. Müller, B. Becker-Ziaja, C. Busch, and S. Günther. 2006. Mutational analysis of the Lassa virus promoter. J. Virol. 80:12414-12419.[Abstract/Free Full Text]
  40. 21
  41. Higuchi, R., B. Krummel, and R. K. Saiki. 1988. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16:7351-7367.[Abstract/Free Full Text]
  42. 22
  43. Hobson, S. D., E. S. Rosenblum, O. C. Richards, K. Richmond, K. Kirkegaard, and S. C. Schultz. 2001. Oligomeric structures of poliovirus polymerase are important for function. EMBO J. 20:1153-1163.[CrossRef][Medline]
  44. 23
  45. Lecompte, E., E. Fichet-Calvet, S. Daffis, K. Koulemou, O. Sylla, F. Kourouma, A. Dore, B. Soropogui, V. Aniskin, B. Allali, S. Kouassi Kan, A. Lalis, L. Koivogui, S. Gunther, C. Denys, and J. ter Meulen. 2006. Mastomys natalensis and Lassa fever, West Africa. Emerg. Infect. Dis. 12:1971-1974.[Medline]
  46. 24
  47. Lee, K. J., I. S. Novella, M. N. Teng, M. B. Oldstone, and J. C. de La Torre. 2000. NP and L proteins of lymphocytic choriomeningitis virus (LCMV) are sufficient for efficient transcription and replication of LCMV genomic RNA analogs. J. Virol. 74:3470-3477.[Abstract/Free Full Text]
  48. 25
  49. Lesburg, C. A., M. B. Cable, E. Ferrari, Z. Hong, A. F. Mannarino, and P. C. Weber. 1999. Crystal structure of the RNA-dependent RNA polymerase from hepatitis C virus reveals a fully encircled active site. Nat. Struct. Biol. 6:937-943.[CrossRef][Medline]
  50. 26
  51. Li, M., F. Diehl, D. Dressman, B. Vogelstein, and K. W. Kinzler. 2006. BEAMing up for detection and quantification of rare sequence variants. Nat. Methods 3:95-97.[CrossRef][Medline]
  52. 27
  53. Lopez, N., R. Jacamo, and M. T. Franze-Fernandez. 2001. Transcription and RNA replication of tacaribe virus genome and antigenome analogs require N and L proteins: Z protein is an inhibitor of these processes. J. Virol. 75:12241-12251.[Abstract/Free Full Text]
  54. 28
  55. Love, R. A., H. E. Parge, X. Yu, M. J. Hickey, W. Diehl, J. Gao, H. Wriggers, A. Ekker, L. Wang, J. A. Thomson, P. S. Dragovich, and S. A. Fuhrman. 2003. Crystallographic identification of a noncompetitive inhibitor binding site on the hepatitis C virus NS5B RNA polymerase enzyme. J. Virol. 77:7575-7581.[Abstract/Free Full Text]
  56. 29
  57. Love, R. A., K. A. Maegley, X. Yu, R. A. Ferre, L. K. Lingardo, W. Diehl, H. E. Parge, P. S. Dragovich, and S. A. Fuhrman. 2004. The crystal structure of the RNA-dependent RNA polymerase from human rhinovirus: a dual function target for common cold antiviral therapy. Structure 12:1533-1544.[Medline]
  58. 30
  59. Lukashevich, I. S., M. Djavani, K. Shapiro, A. Sanchez, E. Ravkov, S. T. Nichol, and M. S. Salvato. 1997. The Lassa fever virus L gene: nucleotide sequence, comparison, and precipitation of a predicted 250-kDa protein with monospecific antiserum. J. Gen. Virol. 78(Pt. 3):547-551.[Abstract]
  60. 31
  61. Lyle, J. M., A. Clewell, K. Richmond, O. C. Richards, D. A. Hope, S. C. Schultz, and K. Kirkegaard. 2002. Similar structural basis for membrane localization and protein priming by an RNA-dependent RNA polymerase. J. Biol. Chem. 277:16324-16331.[Abstract/Free Full Text]
  62. 32
  63. Malet, H., M. P. Egloff, B. Selisko, R. E. Butcher, P. J. Wright, M. Roberts, A. Gruez, G. Sulzenbacher, C. Vonrhein, G. Bricogne, J. M. Mackenzie, A. A. Khromykh, A. D. Davidson, and B. Canard. 2007. Crystal structure of the RNA polymerase domain of the West Nile virus non-structural protein 5. J. Biol. Chem. 282:10678-10689.[Abstract/Free Full Text]
  64. 33
  65. Marcotte, L. L., A. B. Wass, D. W. Gohara, H. B. Pathak, J. J. Arnold, D. J. Filman, C. E. Cameron, and J. M. Hogle. 2007. Crystal structure of poliovirus 3CD protein: virally encoded protease and precursor to the RNA-dependent RNA polymerase. J. Virol. 81:3583-3596.[Abstract/Free Full Text]
  66. 34
  67. McCormick, J. B., I. J. King, P. A. Webb, C. L. Scribner, R. B. Craven, K. M. Johnson, L. H. Elliott, and R. Belmont-Williams. 1986. Lassa fever. Effective therapy with ribavirin. N. Engl. J. Med. 314:20-26.[Abstract]
  68. 35
  69. McCormick, J. B., I. J. King, P. A. Webb, K. M. Johnson, R. O'Sullivan, E. S. Smith, S. Trippel, and T. C. Tong. 1987. A case-control study of the clinical diagnosis and course of Lassa fever. J. Infect. Dis. 155:445-455.[Medline]
  70. 36
  71. Meyer, B. J., and P. J. Southern. 1993. Concurrent sequence analysis of 5' and 3' RNA termini by intramolecular circularization reveals 5' nontemplated bases and 3' terminal heterogeneity for lymphocytic choriomeningitis virus mRNAs. J. Virol. 67:2621-2627.[Abstract/Free Full Text]
  72. 37
  73. Monath, T. P., V. F. Newhouse, G. E. Kemp, H. W. Setzer, and A. Cacciapuoti. 1974. Lassa virus isolation from Mastomys natalensis rodents during an epidemic in Sierra Leone. Science 185:263-265.[Abstract/Free Full Text]
  74. 38
  75. Muller, R., O. Poch, M. Delarue, D. H. Bishop, and M. Bouloy. 1994. Rift Valley fever virus L segment: correction of the sequence and possible functional role of newly identified regions conserved in RNA-dependent polymerases. J. Gen. Virol. 75:1345-1352.[Abstract/Free Full Text]
  76. 39
  77. Ng, K. K., M. M. Cherney, A. L. Vazquez, A. Machin, J. M. Alonso, F. Parra, and M. N. James. 2002. Crystal structures of active and inactive conformations of a caliciviral RNA-dependent RNA polymerase. J. Biol. Chem. 277:1381-1387.[Abstract/Free Full Text]
  78. 40
  79. Ng, K. K., N. Pendas-Franco, J. Rojo, J. A. Boga, A. Machin, J. M. Alonso, and F. Parra. 2004. Crystal structure of Norwalk virus polymerase reveals the carboxyl terminus in the active site cleft. J. Biol. Chem. 279:16638-16645.[Abstract/Free Full Text]
  80. 41
  81. Perez, M., R. C. Craven, and J. C. de la Torre. 2003. The small RING finger protein Z drives arenavirus budding: implications for antiviral strategies. Proc. Natl. Acad. Sci. USA 100:12978-12983.[Abstract/Free Full Text]
  82. 42
  83. Poch, O., I. Sauvaget, M. Delarue, and N. Tordo. 1989. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J. 8:3867-3874.[Medline]
  84. 43
  85. Sanchez, A. B., and J. C. de la Torre. 2005. Genetic and biochemical evidence for an oligomeric structure of the functional L polymerase of the prototypic arenavirus lymphocytic choriomeningitis virus. J. Virol. 79:7262-7268.[Abstract/Free Full Text]
  86. 44
  87. Singh, M. K., F. V. Fuller-Pace, M. J. Buchmeier, and P. J. Southern. 1987. Analysis of the genomic L RNA segment from lymphocytic choriomeningitis virus. Virology 161:448-456.[CrossRef][Medline]
  88. 45
  89. Smallwood, S., B. Cevik, and S. A. Moyer. 2002. Intragenic complementation and oligomerization of the L subunit of the Sendai virus RNA polymerase. Virology 304:235-245.[CrossRef][Medline]
  90. 46
  91. Strecker, T., R. Eichler, J. Meulen, W. Weissenhorn, H. Dieter Klenk, W. Garten, and O. Lenz. 2003. Lassa virus Z protein is a matrix protein sufficient for the release of virus-like particles. J. Virol. 77:10700-10705.[Abstract/Free Full Text]
  92. 47
  93. Sutter, G., M. Ohlmann, and V. Erfle. 1995. Non-replicating vaccinia vector efficiently expresses bacteriophage T7 RNA polymerase. FEBS Lett. 371:9-12.[CrossRef][Medline]
  94. 48
  95. Tarendeau, F., J. Boudet, D. Guilligay, P. J. Mas, C. M. Bougault, S. Boulo, F. Baudin, R. W. Ruigrok, N. Daigle, J. Ellenberg, S. Cusack, J. P. Simorre, and D. J. Hart. 2007. Structure and nuclear import function of the C-terminal domain of influenza virus polymerase PB2 subunit. Nat. Struct. Mol. Biol. 14:229-233.[CrossRef][Medline]
  96. 49
  97. Vieth, S., A. E. Torda, M. Asper, H. Schmitz, and S. Gunther. 2004. Sequence analysis of L RNA of Lassa virus. Virology 318:153-168.[CrossRef][Medline]
  98. 50
  99. Wang, M., K. K. Ng, M. M. Cherney, L. Chan, C. G. Yannopoulos, J. Bedard, N. Morin, N. Nguyen-Ba, M. H. Alaoui-Ismaili, R. C. Bethell, and M. N. James. 2003. Non-nucleoside analogue inhibitors bind to an allosteric site on HCV NS5B polymerase: crystal structures and mechanism of inhibition. J. Biol. Chem. 278:9489-9495.[Abstract/Free Full Text]
  100. 51
  101. Wang, Q. M., M. A. Hockman, K. Staschke, R. B. Johnson, K. A. Case, J. Lu, S. Parsons, F. Zhang, R. Rathnachalam, K. Kirkegaard, and J. M. Colacino. 2002. Oligomerization and cooperative RNA synthesis activity of hepatitis C virus RNA-dependent RNA polymerase. J. Virol. 76:3865-3872.[Abstract/Free Full Text]
  102. 52
  103. Wang, Y., D. E. Prosen, L. Mei, J. C. Sullivan, M. Finney, and P. B. Vander Horn. 2004. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32:1197-1207.[Abstract/Free Full Text]
  104. 53
  105. Yap, T. L., T. Xu, Y. L. Chen, H. Malet, M. P. Egloff, B. Canard, S. G. Vasudevan, and J. Lescar. 2007. Crystal structure of the dengue virus RNA-dependent RNA polymerase catalytic domain at 1.85-Å resolution. J. Virol. 81:4753-4765.[Abstract/Free Full Text]


Journal of Virology, October 2008, p. 10207-10217, Vol. 82, No. 20
0022-538X/08/$08.00+0     doi:10.1128/JVI.00220-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Zamoto-Niikura, A., Terasaki, K., Ikegami, T., Peters, C. J., Makino, S. (2009). Rift Valley Fever Virus L Protein Forms a Biologically Active Oligomer. J. Virol. 83: 12779-12789 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hass, M.
Right arrow Articles by Günther, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hass, M.
Right arrow Articles by Günther, S.