Previous Article | Next Article ![]()
Journal of Virology, January 2008, p. 849-858, Vol. 82, No. 2
0022-538X/08/$08.00+0 doi:10.1128/JVI.01593-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Division of Virology, Aichi Cancer Center Research Institute, 1-1, Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan,1 Department of Microbiology, Carver College of Medicine, University of Iowa, Iowa, City, Iowa 522422
Received 20 July 2007/ Accepted 23 October 2007
|
|
|---|
|
|
|---|
The viral genes have been divided into three temporally regulated classes designated IE, early, and late. Two IE transcripts, designated IE1 (UL123) and IE2 (UL122), are transcribed, and the viral gene products, pIE72 and pIE86, respectively, play a key role in determining the efficiency of viral replication. The IE72 protein contributes to efficient viral replication at a low multiplicity of infection (MOI) (9, 13). The IE86 protein is essential for early viral gene expression (31). We previously demonstrated a correlation between MIE gene transcription, the level of infectious virus replication, and the extent of the proximal enhancer (22). Deletion of the enhancer from –636 to –39 resulted in a replication defective virus in human foreskin fibroblasts (HFFs) (22). Recombinant virus with a deletion to –67 has a functional Sp1 transcription factor binding site that represents a minimal enhancer element for recombinant virus replication in human fibroblast cells (22). In the proximal enhancer of HCMV, there are two Sp1/Sp3 binding sites (GC boxes) at approximately positions –55 and –75 relative to the transcription start site (+1), and deletion of both Sp1 and Sp3 binding sites prevented viral gene expression and replication (20).
The MIE promoter contains a TATA box between –28 and –22, a cis-repression sequence (crs) between positions –13 and +1, and an initiator-like sequence (Inr) between positions +1 and +7 (29). The IE86 protein negatively autoregulates the MIE promoter in a DNA sequence- and position-dependent manner by binding to the crs (3, 28, 36). The crs does not function when placed upstream of the TATA box or 31 nucleotides downstream of the transcription start site (28). The AT-rich crs (5'-CGTTTAGTGAACC-3') is required for IE86 protein binding and repression of transcription from the MIE promoter (28). The IE86 protein binds to the crs as a dimer using minor groove contacts of the DNA template (25, 46).
An unknown human cellular protein of approximately 150 kDa also binds to the crs sequence (29). In situ footprinting analysis demonstrated binding sites that overlap the transcription start site. The IE86 protein footprint was between positions –15 and +2 relative to the transcription start site, and the unknown cellular protein binding was between positions –15 and +7 (29). To determine the role of the region immediately upstream of the transcription start site in HCMV multistep replication, we constructed recombinant viruses with the crs replaced with other sequences. We showed that immediately upstream of the transcription start site there is a cis-acting element between positions –14 and –1 that plays an essential role in promoting the initial MIE gene transcription and RNA splicing at an early stage after infection. After accumulation, the IE86 protein binds to the crs and represses transcription from the MIE promoter.
|
|
|---|
Enzymes. Restriction endonucleases were purchased from New England Biolabs, Inc. (Beverly, MA). High-fidelity and expanded high-fidelity Taq DNA polymerases were purchased from Invitrogen and Roche, respectively (Carlsbad, CA, and Mannheim, Germany), and RNasin and RNase-free DNase purchased from Promega (Madison, WI). The enzymes were used according to the manufacturers instructions.
Plasmid construction. The plasmid of pCAT wild-type (wt) crs is the same as pCATTATA+Sp1(–55)+Sp1(–75) as described previously (20). The plasmid pCAT murine crs, pCAT mut2 crs, and pCAT mut3 crs were constructed to mutate the crs sequence of the pCAT wt crs. The mutagenesis was carried out by QuikChange site-directed mutagenesis according to the manufacturer's instructions (Stratagene, La Jolla, CA). The primer pairs for the mutagenesis were as follows: IE1EMmurinecrsF (5'- CGGTGGGAGGTCTATATAAGCAGAGCccagcgtcggtaccGTCAGATCGCCTGGAGACGCCATCCACGC-3') and IE1EmmurinecrsR (5'-GCGTGGATGGCGTCTCCAGGCGATCTGACtggccgggtaggctGCTCTGCTTATATAGACCTCCCACCG-3'), IE1EMmut2crsF (5'-CGGTGGGAGGTCTATATAAGCAGAGCTCGTTgtcgGtACCGTCAGATCG CCTGGAGACGCCATCCACGC-3') and IE1EMmut2crsR (5'-GCGTGGATGGCGTCTCCAGGCGATCTGACGGTaCcgacgcCGAGCTCTGCTTATATA GACCTCCCACCG-3'), and IE1EMmut3crsF (5'-CGGTGGGAGGTCTATATAAGCAGAGCTCGTTTtcTGtACCGTCAGATCGCCTGGAGACGCCATCCACGC-3') and IE1EMmut3crsR (5'-GCGTGGATGGCGTCTCCAGGCGATCTGACGGTaCAgaAAACGAGCTCTGCTTATATAGACCTCCCAC CG-3'). Lowercase letters indicate mutated bases. The amplified and mutated products were confirmed by DNA sequencing (Aichi Cancer Center Research Institute Central Facility).
Mutagenesis of HCMV BAC DNA. A rapid homologous recombination system in Escherichia coli expressing the bacteriophage lambda recombination proteins Exo, Beta, and Gam (provided by D. Court, National Institutes of Health, Bethesda, MD) was used as described previously (6). BAC-DNA of human CMV Towne was obtained from F. Liu (University of California, Berkeley, CA) (4). Double-stranded DNAs for recombination contained a kanamycin-resistant gene flanked by the 34-bp minimal FRT sites (5'-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3') (14) or kanamycin-resistant and streptomycin-sensitive genes (RpsLneo, purchased from Gene Bridges, Dresden, Germany) and 70 bp of homologous viral DNA sequence. To generate mutations of the crs sequence, the following primer pairs were used: BACcrs+FRTR (5'-GCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGAGAA GTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTGCCAGTG TTACAACCA-3'), BACsimiancrs+FRTR (5'- TATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCCCTAAACGAGCTCT GCTTATATAGAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTA ATGCTCTGCCAGTGTTACAACCA-3'), BACmurinecrs+FRTR (5'-TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTACCGACGCTGGGCTCTGCTTATATAGAGAAGTTCCTATACTTTC TAGAGAATAGGAACTTCTAATGCTCTGCCAGTGTTACAACCA-3'), BACcrsmut+FRTR (5'-TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACTGGCCGGGTAGGCTGCTCTGCTTATATA GAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTG CCAGTGTTACAACCA-3'), BACcrs+FRTF (5'-TCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACTGGCCGGGTAGG CTGCTCTGCTTATATAGAGAAGTTCCTATACTTTCTAGAGAATAGGA ACTTCTAATGCTCTGCCAGTGTTACAACCA-3'), BACcrsneo+StF (5'-GTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGG TGGGAGGTCTATATAAGCAGAGCGGCCTGGTGATGATGGCGGGAT C-3'), and BACcrsneo+StR (5'-AGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACTCA GAAGAACTCGTCAAGAAGG-3'). Amplification of the kanamycin-resistant gene (KanR) with 50 bp of homologous viral DNA sequence onto either end of the KanR by PCR was performed as described previously (20-22). To amplify the RpsLneo gene by PCR, pRpsL-neo (Gene Bridges) was used as a template. To remove residual template DNA, the PCR products were digested with DpnI at 37°C for l.5 h. Approximately 100 ng of each DNA fragment was subjected to electroporation into competent E. coli DY380 containing human CMV Towne-BAC DNA. Electroporation was performed as described previously (22).
Excision of KanR. To delete KanR, the recombinant human CMV BAC DNA was transformed into E. coli DH10B. Plasmid pCP20 (14), which expresses the recombinase, was transformed into DH10B containing the recombinant human CMV BAC DNA. Human CMV BAC DNA without kanamycin was selected on LB plates containing ampicillin and chloramphenicol.
HCMV BAC DNA with wt or mutated cis-acting element. To generate the recombinant BAC DNA with wt or mutated cis-acting element, the reverse procedure was also used as described previously (48). Briefly, 500 ng of single-stranded DNA for recombination containing 50 bp of homologous viral DNA sequence on either end of the mutated crs sequence were introduced into HCMV BAC DNA with the RpsLneo gene in the crs sequence as described previously (48). Since RpsL is streptomycin-sensitive gene, the mutated BAC DNA was selected on the basis of increased streptomycin resistance using a Counter Selection modification kit (Gene Bridges) as described previously (48). The following single-stranded DNAs were used for recombination: wtcrsoligoforBAC (5'-ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCtcgtttagtgaaccGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGA-3'), mut1crsoligoforBAC (5'-ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC tcggcgtcggtaccGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGAC CTCCATAGAAGA-3'), mut2crsoligoforBAC (5'-ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCtcgttgtcggtaccGTC AGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAG A-3'), and mut3crsoligoforBAC (5'-ACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCtcgttttctgtaccGTCAGATCGCCTG GAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGA-3').
Recombinant virus isolation. HFF cells were transfected with either 5 or 10 µg of each recombinant BAC in the presence of 2 µg of plasmid pSVpp71 by the calcium phosphate precipitation method of Graham and van der Eb (12). After 10 days, viral plaques appeared. After 7 days of 100% cytopathic effect, the extracellular fluid was collected and either undiluted or diluted 1:10 for infection of HFF cells. After 5 to 7 days of 100% cytopathic effect, the extracellular fluid containing virus was stored at –80°C in 50% newborn calf serum until used.
PCR analysis. PCR analysis was performed with the primer pair HCMVF (5'-CCCGGTGTCTTCTATGGAGGT-3') and HCMVUL127R (5'-GGTTATATAGCATAAATCAATATTGGCTATTGG-3'), as described previously (22). The PCR cycling program was 1 cycle of denaturation at 94°C for 2 min; 30 cycles of 94°C for 15 s, annealing at 55°C for 30 s, and elongation at 72°C for 1 min 30 s; and 1 cycle of elongation at 72°C for 7 min. A PCR product was cloned into a TA cloning vector and sequenced to confirm the recombination and excision (Aichi Cancer Center Research Institute Central Facility).
Viral DNA replication assay. After infection at a multiplicity of infection (MOI) of approximately 1 or 0.3, cells were collected at 2, 3, and 4 days p.i. Cells in 35-mm plates in triplicate were suspended in lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1% SDS, and 20 µg of RNase A/ml) containing 50 µg of proteinase K/ml. The replicated viral DNA was quantitated by real-time PCR using HCMV gB primers and probes as described previously (20-22). Real-time PCRs with 18S primers and probe purchased from Applied Biosystems (Foster City, CA) were also performed to serve as an internal control for input DNA. The data are averages of three independent experiments.
Southern blot analysis. Recombinant BAC DNAs were purified using a NucleoBond kit (Macherey-Nagel, Duren, Germany), digested with restriction endonucleases BlpI and XhoI, and subjected to 1.0% agarose gel electrophoresis as described previously (22). Southern blot analysis was performed as described previously (33). For the probes, DNA fragments (EagI-SpeI) of pKS –583/+78 (19) (see Fig. 1a) were labeled using the MegaPrime DNA labeling system (Amersham, Piscataway, NJ) and [32P]dCTP (Amersham) as described previously (19).
![]() View larger version (36K): [in a new window] |
FIG. 1. Structures of recombinant HCMV BAC DNAs. (a) Schematic arrangement of the recombination of the recombinant BAC DNAs of Rwt. The region between positions –48 to +1 from the transcription start site of +1 including the crs was replaced with the substituted sequence and the kanamycin resistance gene (KanR), and then KanR was excised by FLP-mediated recombination. The substituted sequence is either the simian or murine crs or the completely mutated crs (mut crs), as illustrated. Lowercase letters in the sequences indicate mutated bases. (b) Southern blot analysis of the parental, wt crs, mut crs, simian crs, and murine crs plus FRT sequence with or without KanR. BAC DNAs were digested with BlpI and XhoI. A standard molecular size marker is indicated in base pairs. BAC DNAs are identified at the top of the blot.
|
RNase protection assay. Antisense actin and IE1 riboprobes have been described previously (17, 28, 33). Cytoplasmic RNA was harvested at 6 h after infection at an MOI of approximately 0.3 PFU/cell as described previously (45). Twenty micrograms of RNA was hybridized to 32P-labeled antisense actin and IE1 probes at 37°C overnight before digestion with RNase T1 (100 U) as described previously (26). The protected RNA fragments were subjected to electrophoresis in denaturing 6% polyacrylamide gels, followed by autoradiography on Fuji medical X-ray film (Fujifilm, Tokyo, Japan).
Western blot analysis. Cells were harvested at the indicated times p.i., washed with phosphate-buffered saline, and treated with lysis buffer as described previously (20, 22). Aliquots (20 µg) of proteins were loaded into each lane for SDS-10% polyacrylamide gel electrophoresis and then transferred to polyvinylidene difluoride membranes. To detect the pIE72 and pIE86 proteins encoded by IE1 and IE2, respectively, or the p52 protein encoded by UL44, monoclonal antibodies NEA-9221 (Perkin-Elmer, Boston, MA) and M0854 (Dako, Carpinteria, CA) were used, respectively. To detect cellular GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as a loading control, monoclonal antibody MAB376 (Chemicon, Temucula, CA) was used. Enhanced chemiluminescence detection reagents (Amersham) and the secondary horseradish peroxidase-labeled anti-mouse immunoglobulin G antibody (Zymed, San Francisco, CA) were used according to the manufacturer's instructions. The signal intensity was quantitated with an Image Guider (BAS 2500; Fujifilm).
Real-time PCR and RT-PCR analysis. For detection of low levels of MIE RNA, whole-cell RNA was purified at the times indicated using TRI reagent (Molecular Research Center), treated with DNase I (Promega), and then converted to cDNA with reverse transcriptase (RT). Protein synthesis was inhibited with 200 µg of cycloheximide (Sigma)/ml added to the medium 2 h before infection and maintained throughout the infection. RT (Roche) was used according to the manufacturer's directions to generate first-strand cDNA from 2 µg of RNA and 250 ng of random primer (Roche) in a final volume of 20 µl. Samples were heat inactivated at 70°C for 15 min. The no-RT control failed to detect any input viral DNA and was similar to the mock control. A RT reaction was performed as described previously (22). For detection of viral DNA, cells in 60-mm plates were harvested at 4 h p.i. in triplicate with PCR lysis buffer containing 50 µg of proteinase K/ml. Amplifications were performed in a final volume of 25 µl containing Platinum Quantitative PCR Supermix-UDG cocktail (Invitrogen). Each reaction mixture contained 2 µg of the first-strand cDNA or DNA, 5 mM MgCl2, 500 nM concentrations of each primer, and 250 nM concentrations of each probe. MIE or gB primers and probe were designed as described previously (19, 32). The MIE primer sequences 5'-GCATTGGAACGCGGATTC-3' and 5'-CAGGATTATCAGGGTCCATCTTTC-3' (Life Technologies) are located in MIE exons 1 (forward) and 2 (reverse), respectively, which are separated by the 827-bp intron A. The MIE reporter probe, 5'-FAM-AGTGACTCACCGTCCTTGACACGATGG-tetramethyl rhodamine (TAMRA)-3' (IDT, Coralville, Iowa), straddles the junction of MIE exons 1 and 2. The HCMV UL37 exon 1 forward and reverse primers and reporter probes were designed by using PrimerExpress (Applied Biosystems): UL37x1-102F (5'-CCCGCCTTGGTTAAGAAAGAA-3'), UL37x1-164R (5'-CGTAACCGGTGCCGAGAA-3'), and UL37x1-124 probe (5'-AAAGCATGTGCGCTCACCCGG-3') (Nihon Gene Research Laboratories, Inc., Sendai, Japan). The thermal cycling conditions were an initial 50°C for 2 min and 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Quantitation of relative MIE RNA or gB DNA was accomplished according to a standard curve analysis as described previously (19, 32). Real-time PCRs with glucose 6-phosphate dehydrogenase (G6PD) primers and probe as described previously (47) or 18S primers and probe purchased from Applied Biosystems were also performed to serve as an internal control for input RNA or DNA, respectively. The data are averages of three independent experiments.
RT-PCR was also performed in a final volume of 10 µl of the PCR mixture containing 0.5 µM concentrations of the primers, 0.2 mM deoxynucleoside triphosphates, 1.5 mM MgCl2, and 0.5 U of Taq polymerase (AmpliTaq Gold; Roche). The primers to detect the spliced RNA between exons 2 and 3 and between exons 3 and 4 were designed as follows: exons 1 and 2, ex2-3F (5'-GAGAAAGATGGACCCTGATAATCCT-3') and ex2-3R2 (5'-AGGAACGTCGTGGCCTTGGT-3'); and exons 3 and 4, ex3-4F2 (5'-CAACGAGAACCCCGAGAAA-3', and ex3-4R2 (5'-CCATGTCCACTCGAACCTTAA-3'). Thermal cycling conditions were an initial 95°C for 15 min, followed by 35 cycles of 95°C for 15 s and 60°C for 1 min. Then, 5 µl of the RT-PCR product was subjected to electrophoresis in a 12% polyacrylamide gel. The signal intensity was quantitated with an Image Guider. The RT-PCR products also were cloned into a TA cloning vector separately and sequenced (Aichi Cancer Center Research Institute Central Facility).
In vitro transcription assay. pCAT wt crs, pCAT murine crs, pCAT mut2 crs, and pCAT mut3 crs were digested with PvuII as a template, and the final concentrations of these templates were estimated by UV absorbance spectroscopy. The mean of three independent estimates was used to determine the template concentration. The concentration of the template was also confirmed by agarose gel electrophoresis. Transcription mixtures, which contained approximately100 ng of template DNA, 200 µg of HeLa cell nuclear extract from Promega (in vitro transcription grade), 3 mM MgCl2, and 10 µCi of [32P]UTP were as described previously (29). Reaction mixtures were incubated at 30°C for 20 min. After incubation, DNA templates were degraded with RNase-free DNase I (Promega) at 30°C for 30 min. The runoff reaction was terminated by the addition of 300 mM Tris (pH 7.5), containing 300 mM sodium acetate, 0.5% SDS, 2 mM EDTA, and 3 mg of calf thymus tRNA, and the runoff product was extracted by phenol-chloroform-isoamyl alcohol. To inhibit eukaryotic RNA polymerase-dependent transcription, 2.5 µg of alpha-amanitin (Sigma)/ml was added to the reaction mixture. The radiolabeled RNAs were precipitated with 3 volumes of 95% ethyl alcohol. RNA pellets were dissolved in diethyl pyrocarbonate-treated distilled H2O and fractionated in 6% polyacrylamide-7 M urea gels. The gels were dried and exposed to Kodak X-Omat AR. The signal intensity was quantitated with an Image Guider. Transcription assays were repeated three times independently, and the signal intensity represents the average of these three experiments.
|
|
|---|
To excise the KanR gene, we used FLP-mediated recombination, which left a 34-bp FRT sequence (Fig. 1a). To avoid an effect of the FRT when comparing MIE transcription and viral replication, we also constructed a recombinant virus with the wt crs sequence plus FRT at the same position as the other recombinant viruses. Restriction enzyme digestion of the recombinant BAC DNAs with BlpI and XhoI verified that no large deletions or rearrangements of the HCMV genome occurred during recombination (data not shown) and generated the expected sizes of DNA fragments (Fig. 1b). PCR analysis with the primer pairs of UL127R and HCMVF (see Fig. 1a) was performed, and the amplified DNA fragments were sequenced to confirm the correct recombination and excision (data not shown). HFF cells were transfected with the recombinant HCMV BAC DNAs designated Rwt, Rsimian, Rmurine, and Rmut. Two independent isolates for each mutation were separately prepared and characterized. There was no difference in the phenotype between the two independent recombinant virus isolates. Rescue of mutations in the crs are described in Fig. 6.
![]() View larger version (64K): [in a new window] |
FIG. 6. Effect of mutation of the crs on MIE gene transcription and splicing at the early stage of infection. (a) HFF cells were infected with rescued wt virus (wt-R) and recombinant viruses with a mutated crs at an MOI of approximately 0.3 and analyzed for levels of IE gene transcripts by real-time PCR as described in Materials and Methods. Each RT-PCR was performed in triplicate and standardized to threshold cycle values for MIE (a) or UL37 exon1 (b). RNA was collected from HFF cells infected with wt-R at the 7 h p.i. in the absence or presence of cycloheximide (CHX). RNAs were normalized to the cellular G6PD RNA. (c) RNase protection analysis was performed to compare the levels of cytoplasmic IE1 RNAs. HFF cells were infected at an MOI of approximately 0.3, and cytoplasmic RNAs were harvested at 6 h after infection at an MOI of approximately 0.3. Twenty micrograms of RNA was hybridized to 32P-labeled antisense UL4IE1 and actin probe at 37°C overnight before digestion with RNase T1. The protected RNA fragments were subjected to electrophoresis in denaturing 6% polyacrylamide gels. Actin mRNA was used as a loading control. Probe used in lanes 1 and 2 lacked RNase T1. (d) Analysis of splicing efficiency of the MIE gene transcript. HFF cells were infected at an MOI of approximately 0.3 and harvested at 6 h p.i. Total cellular RNAs were purified and MIE RNAs were analyzed by RT-PCR using the primer pairs specific for mRNA between exons 2 and 3 or between exons 3 and 4. Upper and lower bands indicated by arrows represent unspliced and spliced MIE RNAs, respectively.
|
![]() View larger version (29K): [in a new window] |
FIG. 3. Effect of crs substitution on viral DNA and protein synthesis. (a) Analysis of viral DNA synthesis after infection with Rwt, Rsimian, or Rmurine at an MOI of approximately 1 and harvested 2, 3, and 4 days p.i. Viral DNAs were quantified by real-time PCR with gB primers and probe as described in Materials and Methods. Each value, relative to the level of the Rwt DNA at 4 h p.i., was calculated and plotted. The data are averages of three independent experiments. Real-time PCR with 18S primers and probe were also performed as a control for equal input DNA (bottom panel). (b) Western blot analysis of IE and early gene expressions. HFF cells were infected with the recombinant viruses at an MOI of approximately 1 and harvested at the indicated days p.i. Monoclonal antibody NEA-9221 detects IE72 and IE86 proteins, while M0854 detects p52 early protein. pGAPDH (p36) served as a protein loading control.
|
![]() View larger version (53K): [in a new window] |
FIG. 2. Effect of crs substitution on MIE gene transcription and RNA splicing. (a) HFF cells were infected with the recombinant viruses at an MOI of approximately 1 and analyzed for levels of IE gene transcripts by real-time PCR as described in Materials and Methods. Each RT-PCR was performed in triplicate and standardized to threshold cycle values for MIE RNA collected from HFF cells infected with Rwt 7 h p.i. RNAs were normalized to the cellular G6PD RNA. (b) Northern blot analysis was performed to compare levels of cytoplasmic IE1 RNAs. HFF cells were infected at an MOI of approximately 0.1, and total cellular RNA was harvested at 6 h p.i. Ethidium bromide-stained bands of 28S and 18S RNA show equal loading. (c) Analysis of splicing efficiency of the MIE gene transcript. HFF cells were infected at an MOI of approximately 0.1 and harvested at 6 h p.i. Total cellular RNAs were purified, and MIE RNAs were analyzed by RT-PCR using the primer pairs specific for mRNA between exons 2 and 3 or between exons 3 and 4. Upper and lower bands indicated by arrows represent unspliced and spliced MIE RNAs, respectively.
|
The crs sequence affects the splicing efficiency of the MIE gene transcripts. The mRNA processing reactions are coordinated during transcription (37). Since the crs facilitates the transcription from the MIE promoter, the crs sequence may have an effect on the processing of the pre-mRNA. To detect spliced RNAs, RT-PCR was performed by using primer pairs between exons 2 and 3 and between exons 3 and 4. HFF cells were infected at an MOI of approximately 0.1, and RNAs were purified from the infected cells at 6 and 24 h p.i. The spliced forms between exons 2 and 3, as well as exons 3 and 4, were as much as 3-fold higher with Rwt than with Rmurine in cells infected at 6 h p.i. When cells were infected with Rmurine, as much as 3-fold more unspliced forms than spliced form between exons 2 and 3, as well as between exon 3 and 4, were detected at 6 h p.i. than with Rwt (Fig. 2c). The unspliced forms between exons 2 and 3 and between exons 3 and 4 were lower in relative amount at 24 h p.i. Theses data indicate that the crs also affects the splicing of the pre-mRNA during transcription.
Effect of crs substitutions on viral DNA synthesis and gene expression.
Real-time PCR using gB primers was performed to determine viral DNA levels at 2, 3, and 4 days p.i. Real-time PCR assays with 18S primers and probe were performed to control for equal DNA input (Fig. 3a, bottom panel). Each value, relative to the level of the Rwt DNA at 4 h p.i., was calculated and plotted. The data are averages of three independent experiments. Recombinant virus with the simian crs replicated to the same level as Rwt. In contrast, recombinant virus with the murine crs replicated less efficiently. There was an
20-fold difference in the levels of viral DNA between Rwt and Rmurine at 2, 3, and 4 days p.i. (Fig. 3a, upper panel). We conclude that viral DNA replication of Rmurine was less efficient than that of Rwt.
To determine whether the slow rate of viral DNA replication with Rmurine was due to a lower level of viral gene expression, HFF cells were infected with the recombinant viruses at an MOI of approximately 1. Western blot analysis was performed with monoclonal antibodies against either viral proteins pIE72 (UL123), pIE86 (UL122), and p52 (UL44) or cellular p36 GAPDH as a loading control. Equal amounts of protein were applied for SDS-PAGE. The protein levels of pIE72, pIE86, and p52 of the recombinant virus with simian crs were similar to those of Rwt throughout infection (Fig. 3b). In contrast, the protein level of pIE72 with Rmurine-infected cells was 1.9-fold lower than that of Rwt at 1 day p.i. In addition, the levels of pIE86 and p52 proteins were 2.8- and 3.2-fold and 5.9- and 3.6-fold lower, respectively, at days 2 and 4 p.i. We conclude that the crs is a positive cis-acting element.
Mutations in the HCMV crs. Previous in vitro analyses indicated that the nucleotides in the crs are important for the binding of IE86 or an unknown cellular protein (29). We constructed mutations in the crs as diagrammed in Fig. 4. To rescue wt crs or introduce site-specific mutations, we reversed the recombinant virus selection procedure. Using a rapid homologous recombination system in E. coli as described above, we replaced the marker cassette with the RpsL gene (Gene Bridges), conferring increased sensitivity to streptomycin. Intermediate BAC clones were isolated based on resistance to kanamycin. The integrity of these clones was checked by digestion with HindIII, and insertion of the marker cassette in the correct location was confirmed by PCR using the primer pairs of UL127R and HCMVF (data not shown). In a second round of homologous recombination, the entire marker cassette was replaced with the wt, mut1, mut2, or mut3 crs sequence by counterselection using single-stranded DNA as described in Materials and Methods. Recombinant constructs were isolated based on increased resistance to streptomycin as described previously (48). The crs was amplified by PCR using the primer pairs of UL127R and HCMV and sequenced to determine the correct recombination (data not shown). The integrity of the mutant BACs was checked by digestion with HindIII (data not shown). A rescued BAC with wt crs was used for the following experiments and was designated wt-R. There were no differences detected in transcription from the MIE promoter between wt and wt-R.
![]() View larger version (27K): [in a new window] |
FIG. 4. Structure of recombinant viruses with wt crs or site-specific mutations in the crs. To construct these mutants, a counterselection replaced the wt crs with a marker cassette containing the RpsL gene, conferring increased sensitivity to streptomycin, and the neomycin resistance marker to provide kanamycin resistance. Intermediate BAC clones were isolated based on resistance to kanamycin. In a second round of homologous recombination, the entire marker cassette was replaced with the wt, mut1, mut2, or mut3 crs sequence by counterselection using single-stranded DNA. Recombinant constructs were isolated based on increased resistance to streptomycin. The crs was amplified by PCR using the primer pair of UL127R and HCMV and sequenced to determine that the correct recombination was generated. The substituted sequence is either the mut1, mut2, or mut3 crs, as illustrated. Lowercase letters in the sequences indicate substituted bases.
|
2-fold decrease relative to wt (50.1, 46.2, and 52.1%, respectively) (Fig. 5b). Similar results were obtained with mut1 (data not shown). The promoter with the simian crs produced RNA transcripts, as well as wt (data not shown). These results are consistent with a previous report using different mutations in the crs where a 50% reduction in in vitro transcription was detected (29). Since the reduction of in vitro transcription was only 50%, the results suggested that the viral proteins in the HCMV-infected cell could significantly modulate MIE transcription.
![]() View larger version (39K): [in a new window] |
FIG. 5. Effect of the absence of other viral proteins and mutation of the crs on transcription in vitro. (a) Schematic representation of the structures of the template for in vitro transcription. (b) Representative in vitro transcription efficiencies from wt and mutant promoter templates containing the HCMV TATA element, as well as the two Sp1/3 binding sites in the proximal enhancer. Two hundred micrograms of crude HeLa cell nuclear extracts (Promega) was used to transcribe approximately 100 ng of the truncated templates; the wt-R; and the mutant templates murine, mut2, and mut3 in the presence of 10 µCi of [32P]UTP. Lanes: 1, molecular weight markers (MWM); 2, murine; 3, mut2; 4, mut3; 5 and 6, wt-R; 1 to 5, in the absence of alpha-amanitin (2.5 µg/µl); 6, wt in the presence of alpha-amanitin (2.5 µg/µl). Transcription products were analyzed as described in Materials and Methods. The position of the 420-nucleotide runoff transcript from the wt and mutant constructs is indicated on the left. (c) Quantification of the runoff transcripts generated by in vitro transcription (by Fuji BAS 2500) yielded the data presented in the bar graph (n = 3). Transcription from the wt promoter was set as equal to 1.
|
7-fold reduction in MIE RNA. The level of MIE RNAs from the recombinant virus with a mutated crs was approximately 100- to 500-fold less than with wt-R (Fig. 6a, left panel). To determine approximately equal recombinant virus infections, we measured UL37 exon 1 transcription. The difference in the relative amount of UL37 mRNA between the recombinant viruses and the wt was
2-fold or less in the presence of cycloheximide (Fig. 6b). To further confirm the level of MIE gene transcript, an RNase protection assay was also performed with antisense IE1 riboprobe. After infection with wt-R, mut1, or mut3 at an MOI of approximately 0.3, cells were harvested at 6 h p.i. A total of 20 µg of RNA was hybridized to 32P-labeled antisense RNA probe at 37°C overnight before digestion with RNase T1 (100 U) as described in Materials and Methods. As shown in Fig. 6c, steady-state cytoplasmic IE1 mRNA transcribed from the MIE promoter containing mut1 or mut3 crs was dramatically reduced at 6 h p.i. (Fig. 6c, compare lanes 3 and 5). Recombinant virus mut2 gave similar results (data not shown). To detect spliced RNAs, RT-PCR was performed with primer pairs between exons 2 and 3, as well as between exons 3 and 4. The spliced forms between exons 2 and 3, as well as between exons 3 and 4, were higher in relative amount in HFF cells infected with the wt-R at 6 h p.i. In contrast, HFF cells infected with mut1 or mut3 had higher levels of unspliced forms than cells infected with wt-R (Fig. 6c). Recombinant virus mut2 gave similar results (data not shown). From these results, we conclude that the crs and de novo protein synthesis has a significant effect on MIE transcription in the virus-infected cell.
The nucleotides at positions –10 to –9 of the HCMV crs are critical for efficient viral gene expression. To determine which region within the crs is critical for MIE gene expression, HFF cells were infected with wt-R or recombinant viruses mut1, mut2, or mut3 at an MOI of approximately 0.3. Equal infection was determined by measuring UL37 exon 1 transcription as shown in Fig. 6. Real-time PCR using gB primers was performed to determine viral DNA levels at days 2, 3, and 4 p.i. Real-time PCR assays with 18S primers and probe were performed to control for equal DNA input. Each value, relative to the level of the Rwt DNA at 4 days p.i., was calculated and plotted. The data are averages of three independent experiments. As shown in Fig. 7a, viral DNA replication of the recombinant virus with mut1 or mut2 was 10 to 100 times lower than with wt-R at 2, 3, and 4 days p.i. There was less difference between wt-R and mut3.
![]() View larger version (37K): [in a new window] |
FIG. 7. Effect of mutation of nucleotides at –10 and –9. (a) Analysis of viral DNA synthesis after infection with the wt-R or the recombinant virus with mut1, mut2, or mut3 crs at an MOI of approximately 0.3 and harvested 2, 3, and 4 days p.i. Viral DNAs were quantified by real-time PCR with gB primers and probe as described in Materials and Methods. Each value, relative to the level of the wt-R crs DNA at 4 days p.i., was calculated and plotted. The data are averages of three independent experiments. Real-time PCR with 18S primers and probe were also performed as a control for equal input DNA. (b) Western blot analysis of IE and early gene expressions. HFF cells were infected with the recombinant viruses at an MOI of approximately 0.3 and harvested at the indicated days p.i. Monoclonal antibody NEA-9221 detects IE72 and IE86 proteins, while M0854 detects p52 early protein. pGAPDH (p36) served as a protein loading control.
|
|
|
|---|
It has been reported that residues directly upstream of the simian virus 40 early TATA box affects alternative splicing of viral mRNA (10). There may be a common mechanism(s) in the regulation of viral transcription and pre-mRNA splicing between simian virus 40 and HCMV. The effect of HCMV on the infected cell could be related to activation of signal transduction pathways by viral glycoproteins gB and gH binding to cellular receptors activating signal transduction pathways that result in phosphorylation of transcription factors (50). In addition, viral and cellular proteins could be phosphorylated by the tegument-associated casein kinase (34). We have shown that the HCMV crs affects the efficiency of MIE transcription and splicing at early stages of infection. Nucleotide positions –10 and –9 are critical for efficient viral gene expression. Our data indicate that the crs is a positive element for MIE transcription and mRNA splicing. In addition, de novo protein synthesis influences the efficiency of MIE gene transcription in the HCMV-infected cell. The crs may act as a critical bridge between the core promoter and the proximal enhancer of the MIE genes at an early stage of infection in the multistep growth condition. When the crs was extensively mutated (see Fig. 1, mut crs), we were unable to isolate infectious virus, which implies that the crs is critical for expression of the HCMV IE72 and IE86 proteins at an early stage of infection. However, continuous expression of the wt IE86 protein at later stages of infection is deleterious to the host cell. As the viral IE86 protein accumulates and binds to the crs, the cis-acting element has a negative effect on MIE transcription. Reeves et al. demonstrated that binding of the IE86 protein to the crs at late times after infection attracts histone deacetylase to the MIE promoter, which contributes to repression of MIE transcription (38). Therefore, the crs is an essential cis-acting control element for the MIE promoter that promotes MIE transcription at early times after infection and represses transcription through the IE86 protein and histone deacetylase at late times.
Published ahead of print on 7 November 2007. ![]()
|
|
|---|
gene expression via a short target sequence near the transcription start site. J. Virol. 65:887-896.
B, I
B
. J. Virol. 81:5305-5314.
B during infection. J. Virol. 71:5051-5059.[Abstract]This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»