This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Isegawa, Y.
Right arrow Articles by Sugimoto, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Isegawa, Y.
Right arrow Articles by Sugimoto, N.

 Previous Article  |  Next Article 

Journal of Virology, January 2008, p. 710-718, Vol. 82, No. 2
0022-538X/08/$08.00+0     doi:10.1128/JVI.00736-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Characterization of the Human Herpesvirus 6 U69 Gene Product and Identification of Its Nuclear Localization Signal{triangledown}

Yuji Isegawa,1* Yoichi Miyamoto,2 Yoshinari Yasuda,2 Katsunori Semi,1,5 Kenji Tsujimura,1,5 Rikiro Fukunaga,3 Atsushi Ohshima,5 Yasuhiro Horiguchi,4 Yoshihiro Yoneda,2 and Nakaba Sugimoto1

Department of Infectious Disease Control, G-5, Graduate School of Medicine,1 Biomolecular Dynamics Group,2 Laboratory of Genetics, Graduate School of Frontier Biosciences,3 Division of Toxicology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan,4 Gene Engineering Laboratory, Genomics Program, Nagahamabio Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829, Japan5

Received 5 April 2007/ Accepted 31 October 2007


arrow
ABSTRACT
 
To elucidate the function of the U69 protein kinase of human herpesvirus 6 (HHV-6) in vivo, we first analyzed its subcellular localization in HHV-6-infected Molt 3 cells by using polyclonal antibodies against the U69 protein. Immunofluorescence studies showed that the U69 signal localized to the nucleus in a mesh-like pattern in both HHV-6-infected and HHV6-transfected cells. A computer program predicted two overlapping classic nuclear localization signals (NLSs) in the N-terminal region of the protein; this NLS motif is highly conserved in the N-terminal region of most of the herpesvirus protein kinases examined to date. An N-terminal deletion mutant form of the protein failed to enter the nucleus, whereas a fusion protein of green fluorescent protein (GFP) and/or glutathione S-transferase (GST) and the U69 N-terminal region was transported into the nucleus, demonstrating that the predicted N-terminal NLSs of the protein actually function as NLSs. The nuclear transport of the GST-GFP fusion protein containing the N-terminal NLS of U69 was inhibited by wheat germ agglutinin and by the Q69L Ran-GTP mutant, indicating that the U69 protein is transported into the nucleus from the cytoplasm via classic nuclear transport machinery. A cell-free import assay showed that the nuclear transport of the U69 protein was mediated by importin {alpha}/β in conjunction with the small GTPase Ran. When the import assay was performed with a low concentration of each importin-{alpha} subtype, NPI2/importin-{alpha}7 elicited more efficient transport activity than did Rch1/importin-{alpha}1 or Qip1/importin-{alpha}3. These results suggest a relationship between the localization of NPI2/importin-{alpha}7 and the cell tropism of HHV-6.


arrow
INTRODUCTION
 
Human herpesvirus 6 (HHV-6) was first isolated in 1986 from the peripheral blood of patients with lymphoproliferative disorders (45). Sequence analyses of HHV-6 strains (U1102, Z29, and HST) (10, 13, 16) revealed that the overall arrangement of the HHV-6 genes is similar to that of human cytomegalovirus (HCMV), with which it shares 66% sequence identity (28); therefore, HHV-6 has been classified as a betaherpesvirus. HHV-6 can be further subdivided into two distinct groups, variants A and B (16). In infants, primary HHV-6B infection causes febrile illnesses, including exanthema subitum (53). The epidemiology and clinical consequences of HHV-6A infection are not as well understood. Members of the betaherpesviruses, specifically, HCMV and HHV-6, are well-known opportunistic pathogens in immunocompromised individuals, such as recipients of organ transplants (8, 11, 34). HCMV can cause severe disease in this setting and thus has been extensively studied. HHV-6 reactivation and infection have also been recognized as complications in recipients of organ transplants (8; Y. Isegawa et al., unpublished data) but remain largely uncharacterized.

Both HHV-6 and HCMV are amenable to therapy with ganciclovir (GCV), an acyclovir derivative. GCV is a nucleoside analogue that is phosphorylated to its monophosphate form by a virus-encoded protein kinase before being further phosphorylated by host cellular kinases to its active, triphosphate form. GCV triphosphate works as a competitor of dGTP and inhibits the viral DNA polymerase (Pol) (8, 11, 48). The U69 gene of HHV-6 belongs to a family of protein kinase genes encoded by all herpesviruses, and its product catalyzes the phosphorylation of GCV in HHV-6-infected cells (2, 7, 29).

The precise biological function performed by the herpesvirus-encoded kinases in the virus life cycle remains to be elucidated, but numerous studies have suggested that they play important roles in viral replication. For example, the UL13 gene product of herpes simplex virus type 1 (HSV-1), which is a phosphorylated component of the virion, appears to phosphorylate not only viral proteins such as glycoprotein E, ICP22, ICP0, and UL13 itself (5, 22, 35, 36, 37, 39, 42) but also cellular proteins, including eukaryotic elongation factor 1{delta} (EF-1{delta}) and the cyclin-dependent kinase Cdk1 (cdc2) (1, 22, 24). The HCMV-encoded protein kinase UL97, which is required for highly efficient viral replication (41), has also been suggested to phosphorylate EF-1{delta} (23, 36). Similarly, the HHV-6 U69 protein functions as a protein-serine/threonine kinase that is autophosphorylated on serine and threonine residues and phosphorylates exogenous substrates such as histone and casein (2). A significant portion of the reported GCV-resistant clinical isolates of HCMV carry mutations in the UL97 gene (11), and the majority of the reported GCV-resistant clinical isolates of HHV-6 demonstrate reduced GCV anabolism (29; Isegawa et al., unpublished). Therefore, the characterization of the molecular and physiological functions of the U69 protein kinase is important for understanding the GCV resistance that develops in HHV-6 in the context of transplantation therapies.

Although the U69 protein of HHV-6 is reported to localize to the nuclei of infected cells (7), the molecular mechanism and biological significance of its nuclear localization have remained unknown. Although the nuclear localization of the UL97 protein in the HCMV-infected cells and its nuclear transport signal (NLS) have been reported (31) and UL97 was found to be associated with the nuclear egress of the virus (27), the molecular mechanism of its nuclear localization has remained unknown. The current understanding is that karyophilic proteins containing a classic NLS consisting of an arginine- and lysine-rich protein sequence are imported into the nucleus via the NLS in a manner mediated by importin-{alpha}/β and Ran. In mammals such as humans, the importin-{alpha}-encoding multigene family can be divided into three distinct subgroups, Rch1/importin-{alpha}1, NPI1/importin-{alpha}5;NPI2/importin-{alpha}7, and Qip1/importin-{alpha}3;Qip2/importin-{alpha}4, and a specific or selective importin-{alpha} subtype is responsible for the nuclear import of at least some nuclear proteins (54).

In this report, we confirmed the subcellular localization of the HHV-6 protein kinase U69 in infected cells and identified a classic basic NLS in the N-terminal region of the protein. By using microinjection experiments and an in vitro transport system, we provide unequivocal evidence that the identified NLS functions in the importin-mediated Ran-dependent nuclear localization of the U69 protein kinase.


arrow
MATERIALS AND METHODS
 
Cells and viruses. Umbilical cord blood mononuclear cells were separated on a Ficoll-Conray gradient, transferred to RPMI 1640 medium containing 10% fetal calf serum (FCS), and stimulated with 5 µg/ml phytohemagglutinin for 2 or 3 days. HHV-6 strain HST, which was isolated from a patient with exanthema subitum and belongs to the HHV-6B group, was propagated in fresh human peripheral blood mononuclear cells (53). To prepare virus stocks, virus was propagated in stimulated umbilical cord blood mononuclear cells. When more than 80% of the cells showed cytopathic effects, the culture of infected cells was frozen and thawed twice and spun at 1,500 x g for 10 min and the supernatant was stored at –80°C as a cell-free virus stock.

Human Molt3 #19 cells, which HHV-6 infects with a higher efficiency than the original Molt3 cells (18), were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated FCS at 37°C in a 5% CO2 atmosphere.

HeLa and HEK293 cells were maintained in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% FCS at 37°C in a 5% CO2 atmosphere.

RNA isolation and reverse transcriptase PCR (RT-PCR) assay. Cycloheximide (CHX) and phosphonoformic acid (PFA) were used as inhibitors of protein synthesis and viral DNA replication, respectively. Molt3 #19 cells were infected with HHV-6 (strain HST) and cultured for 24 h in the presence of 50 µg/ml CHX or 200 µg/ml PFA. In the case of PFA treatment, the cells were pretreated with PFA for 1 h prior to infection. Total cellular RNA from virus-infected or mock-infected Molt3 #19 cells was prepared with the RNeasy Mini kit (Qiagen, Hilden, Germany).

RT reactions to synthesize cDNAs from the transcripts of the HHV-6 U12, U38 (DNA Pol), U69, U86 (immediate-early 1 [IE-1]), and U95 genes and the cellular EF-1{alpha} gene were performed as described previously (17, 51). PCR was carried out with EX Taq DNA Pol. The following pairs of primers were used: to generate a 304-bp fragment of U12, U12-F (5' ATGAAGAGTTCAAAGACAACGCT) and U12-R (5' GCATGATAGATGAAGTAAACTAAC); for a 308-bp fragment of U38, U38-F (5' TGCTAATTCATAGTTATGCGTCT) and U38-R (5' TTCTCACATGACGCAAACACAGT); for a 308-bp fragment of U69, U69-F (5' CTGTGACATGTTTAATCCTGGAT) and U69-R (5' ACACTACATGCTCAGCCAATACT); for a 312-bp fragment of U86, U86-F (5' GTTCATGTGTGTTAGATGGACT) and U86-R (5' ATCAGCACTCCAGAACTAGATC); and for a 307-bp fragment of U95, U95-F (5' TGTGTGAAAATAAATGGGTGCTTC) and U95-R (5' CCAATTCAGGATTGCAGATATGT). The sequences of the primer set for EF-1{alpha} were described previously (17).

Construction of HHV-6 U69 expression plasmids. From the total DNA extracted from HHV-6 (strain HST)-infected cells, the U69 open reading frame (ORF) was PCR amplified with Z-Taq Pol (Takara Bio Inc., Otsu, Shiga, Japan). The reaction conditions were as follows: first, denaturation at 95°C for 5 min and then PCR (30 cycles), each cycle consisting of denaturation at 95°C for 30 s, primer annealing at 55°C for 30 s, and chain elongation with Pol at 72°C for 1.5 min, and finally elongation at 72°C for 5 min. The primers for the full-length U69 protein (U69-Met-NcoI, 5' GTCCATGGACAACGGTGTGGAGAC; U69-Ter-NotI, 5' GCGGCCGCTCACATCTGAAAGAGAGAT) and the primers for the U69 protein with the N-terminal NLS deleted (U69-NLSC2-NcoI, 5' TGCCATGGATAGTTCTCCGTTAAAGAAACAGAT; U69-Ter-NotI) were designed to generate PCR amplicons with an NcoI site at the 5' position and an NotI site at the 3' position. The PCR products were digested with NcoI and NotI and used for the subsequent construction. The cDNA sequences were confirmed by sequencing as described above.

To construct a mammalian expression plasmid (pEF-BOS-U69-FLAG) for the C-terminally FLAG epitope-tagged U69 protein, a DNA fragment encoding the FLAG sequence (EFDYKDDDDK [the FLAG sequence is in italics]) was ligated to the 3' end of the U69 ORF fragment and inserted into the pEF-BOS-EX vector as previously described (52). To construct an expression plasmid (pEF-BOS-HA3-U69-GFP) for the N-terminally triple-hemagglutinin (HA) epitope-tagged U69 protein, a DNA fragment encoding the triple-HA sequence (MVYPYDVPDYAGVYPYDVPDYAGVYPYDVPDYAGVD[the triple-HA sequence is in italics]) was ligated to the 5' end of the U69 ORF fragment, and for the C-terminally green fluorescent protein (GFP) epitope-tagged U69 protein, a DNA fragment encoding enhanced GFP was ligated to the 3' end of the U69 ORF fragment and inserted into the pEF-BOS-EX vector. In addition, the U69 ORF fragment encoding the residues between amino acids 19 and 26 (C19-26), 19 and 39 (C19-39), 21 and 39 (C21-39), 19 and 552 (C19-552), or 43 and 552 (C43-552) was amplified by PCR and inserted into the expression vector via the SalI and BamHI sites (C19-26, C19-39, and C21-39) or the SalI and BglII sites (C19-552 and C43-552).

Expression and purification of glutathione S-transferase (GST) fusion proteins. The GST- and GFP-fused U69(21-39) and U69(19-26) proteins were generated as follows. pEF-BOS-U69(21-39)-GFP or pEF-BOS-U69(19-26)-GFP was digested with SalI and NotI, and the resulting DNA fragment containing the U69 and GFP sequences was inserted between the SalI and NotI sites of pGEX6P-3 (Pharmacia). Escherichia coli strain BL21(DE3) was transformed with the expression vector, and the cells were grown in Luria-Bertani medium containing 50 µg/ml ampicillin. The expression and lysis of the bacteria and purification of the fusion protein were performed as described previously (15). The purified proteins are referred to as GST-U69(21-39)-GFP and GST-U69(19-26)-GFP. Recombinant untagged and GFP-fused forms of importin-{alpha}, importin-β1, wild-type Ran, and Q69L Ran were expressed and purified as described previously (32).

Construction of recombinant baculoviruses. To construct recombinant baculoviruses expressing the U69 gene, sequence-confirmed pGEM clones (wild type and mutants) were digested with NcoI and NotI and cloned into baculovirus transfer vector pAcH6, which was constructed from pAcG2T (BD PharMingen) by introducing an N-terminal hexahistidine tag sequence and multiple cloning sites into the original cloning site. The pAcH6 plasmids containing the wild-type or mutant U69 gene were individually transfected into Sf-21 insect cells together with linearized Autographa californica multiple nucleopolyhedrosis virus DNA (BaculoGold; BD PharMingen), and the recombinant baculoviruses were expanded into high-titer virus stocks by following the manufacturer's instructions. The insertion of the U69 gene into the baculovirus genome was confirmed by PCR analysis. To express and purify the U69 fusion protein, Sf-21 cells infected with the recombinant baculovirus were incubated for 3 days and then harvested and lysed by sonication for 3 min in buffer C containing 50 mM Tris-HCl (pH 7.6), 100 mM NaCl, 5 mM MgCl2, 0.1% NP-40, 10% glycerol, and protease inhibitor cocktail (BD PharMingen).

Antibodies. BALB/c mice (6 weeks old) were immunized as previously described (38), with purified HHV-6-U69 protein with an N-terminal His tag. This protein had been expressed by the baculovirus expression system in SF-21 cells as described above and purified with Ni-resin (2). The resulting sera were used as murine anti-U69 antisera. Anti-lamin B and anti-{alpha}-tubulin monoclonal antibodies were purchased from Acris Antibodies (Hiddenhausen, Germany) and Calbiochem (Darmstadt, Germany), respectively. Horseradish peroxidase-conjugated goat anti-mouse immunoglobulin antibody and fluorescein isothiocyanate-conjugated F(ab')2 fragments of rabbit anti-mouse immunoglobulin G were purchased from Dako (Kyoto, Japan).

Immunofluorescence microscopy. Molt3 #19 cells infected with HHV-6 or HEK293 cells transfected with pEF-BOS-U69-FLAG were fixed with acetone or acetone-methanol (1:1) at –20°C on glass slides or IWAKI glass bottom dishes, respectively. The fixed cells were incubated with murine anti-U69 antiserum or murine anti-FLAG monoclonal antibody (M2; Sigma) for 30 min at 37°C and then for 30 min with the fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin F(ab')2 fragment. The cells were observed with a Bio-Rad Radiance 2100 confocal laser scanning microscope.

HEK293 cells transfected with the GFP fusion plasmid were observed directly with a Radiance 2100 confocal laser scanning microscope.

Western blot analysis. Protein samples were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrophoretically transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA). The membrane was incubated in blocking buffer (0.05% Tween 20, 5% skim milk in TBS) for 1 h with shaking at room temperature to block nonspecific binding sites. Incubation with primary antibody was carried out for 1 h at room temperature in antibody dilution buffer (0.05% Tween 20, 3% skim milk in TBS) with murine anti-U69 antisera (1:500 dilution). After the membrane was washed with TBS containing 0.05% Tween 20 three times for 10 min each time, it was incubated for 1 h at room temperature in antibody dilution buffer (0.05% Tween 20, 3% skim milk in TBS) with horseradish peroxidase-conjugated goat anti-mouse antibody (1:2,000 dilution; Dako). After another wash as described above, the enzyme-labeled antibody was detected by enhanced chemiluminescence (GE, Amersham Bioscience) according to the manufacturer's instructions.

Preparation of nuclear and cytoplasmic fractions. Nuclear and cytoplasmic fractions were prepared as described previously (47). Briefly, HHV-6-infected Molt3 #19 cells were washed with phosphate-buffered saline and resuspended in ice-cold buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol), and then Nonidet P-40 (final concentration, 0.1%) was added. After incubation for 15 min on ice, the nuclear fraction was pelleted by centrifugation at 12,000 x g for 30 s. The supernatant was used as the cytoplasmic fraction.

Microinjection. Either GST-GFP or GST-U69(21-39)-GFP (1 mg/ml) was injected through a glass capillary into the cytoplasm of HeLa cells grown on coverslips in a 35-mm dish. After incubation for 30 min at 37°C, the cells were fixed with 3.7% formaldehyde in phosphate-buffered saline at room temperature.

Cell-free import assay. HeLa cells grown on eight-well glass microslides (Matsunami Glass) were permeabilized with 40 µg/ml digitonin (Nacalai Tesque, Inc.) in transport buffer (TB; 20 mM HEPES [pH 7.3], 110 mM potassium acetate, 2 mM magnesium acetate, 5 mM sodium acetate, 0.5 mM EGTA, 2 mM dithiothreitol, 1 µg/ml each aprotinin, leupeptin, and pepstatin) for 5 min at 4°C. To decrease the factors remaining in the cytoplasm after permeabilization, the cells were incubated for 10 min at 4°C and washed twice with TB. The cells were then incubated at 30°C for 30 min with the testing solution, which was TB containing 2% bovine serum albumin, GST-U69(21-39)-GFP (10 pmol), each importin-{alpha} (10 pmol or as indicated in the figure legends), importin-β (10 pmol), Ran-GDP (40 pmol), NTF2 (5 pmol), and an ATP regeneration system (1 mM ATP, 20 U of creatine kinase, 5 mM phosphocreatine), with or without Q69L Ran-GTP (40 pmol), in a 10-µl sample volume, as described previously (14). After the incubation, the cells were washed twice with TB and fixed with 3.7% formaldehyde in TB at room temperature. In this study, the cDNAs of mouse importin-{alpha}s, Rch1/mouse importin-{alpha}2, Qip1/mouse importin-{alpha}4, and NPI2/mouse importin-{alpha}6 were used for protein expression as described previously (32).

In vitro binding assay. One hundred picomoles of GST-U69(21-39)-GFP immobilized on glutathione-Sepharose was mixed with recombinant GFP (mock treatment), the GFP-tagged form of each importin-{alpha} as indicated in the figure legends (100 or 300 pmol), and 1% bovine serum albumin, and the total reaction volume was adjusted to 100 µl with TB as previously described (20). After incubation for 1 h at 4°C, the beads were washed with TB and the material bound to the immobilized proteins was eluted with 0.2% SDS in TB. The eluted proteins were analyzed by SDS-PAGE on a 4 to 20% gradient polyacrylamide gel (Daiichi Pure Chemicals), followed by Coomassie brilliant blue staining.


arrow
RESULTS
 
Expression of the U69 gene in the early phase of HHV-6 infection. To characterize the molecular size and expression of the U69 protein, human Molt3 #19 cells were infected with HHV-6 (HST strain) and the cell lysates were analyzed by Western blotting with a polyclonal antibody that was raised against the recombinant U69 protein. As shown in Fig. 1A, a polypeptide with an apparent molecular mass of 64 kDa was clearly detected in the HHV-6-infected cells 24 h after infection. The size of this protein was in agreement with the predicted size (63,885 Da) of the protein encoded by the U69 ORF of 563 amino acids. The U69 protein was first detectable at 12 h postinfection with enhanced-chemiluminescence reagents and a long film exposure time (data not shown) and reached a peak at 24 h. A main band (arrowhead in Fig. 1A) appeared that was the same size as purified U69 protein expressed in baculovirus in a Western blotting assay (data not shown). Figure 1A also shows two minor bands (one bigger and one smaller than the main band). These bands may have been modification and/or degradation products of U69 but were not nonspecific signals derived from cellular proteins because they only appeared when the main band was present.


Figure 1
View larger version (88K):
[in this window]
[in a new window]

 
FIG. 1. (A) Western blot analysis of HHV-6-infected cells with anti-U69-mouse polyclonal antibodies. Time course of HHV-6 U69 protein synthesis. Molt3 #19 cells (5 x 105) were infected with 106 50% tissue culture infective doses of HHV-6 and collected at 0, 12, 24, 36, 48, and 72 h postinfection (pi). Total cell lysates were analyzed by Western blotting with murine anti-U69 antiserum. The values on the left are molecular sizes in kilodaltons. The arrowhead indicates a band that is the same size as purified U69 protein. (B) RT-PCR assay of transcripts in HST-infected cells treated with CHX or PFA. Total RNAs were purified from mock-infected (Mock) and HST-infected (CHX, PFA, and None) Molt3 #19 cells, which were treated with CHX for 24 h (CHX) or PFA for 24 h (PFA) or left untreated (None) and incubated with (+ lanes) or without (– lanes) RT. The reaction products were used for PCR amplification of sequences representing members of the HHV-6 gene families (IE genes U95 and IE-1 [U89], E gene Pol [U38], and L genes U12 and U69) and EF-1{alpha} as described in Materials and Methods. Lane M contains molecular size markers ({phi}X174 x HaeIII).

To study the synthesis of the U69 RNA with respect to the replicative cycle of HHV-6, virus-infected Molt3 #19 cells were cultured in the absence or presence of a specific inhibitor of protein synthesis or viral DNA replication, CHX or PFA, respectively, and the expression of viral RNAs was examined by RT-PCR analysis of total RNA from the infected cells. Expression of the IE-1 and U95 genes was detected in the presence of CHX, but expression of the Pol and U12 genes was not (Fig. 1B), as reported previously (17, 51). U69 gene expression was not detected either under these conditions. On the other hand, the expression of U69 was detectable in the presence of PFA, similar to that of Pol. The expression of the host cellular RNA, EF-1{alpha}, was not affected by treatment with CHX or PFA. These results indicate that the expression of the U69 gene is independent of viral DNA synthesis, meaning that the U69 gene is one of the early genes, like the Pol (U38) gene.

Localization of the U69 protein in HHV-6-infected or -transfected cells. To determine the intracellular distribution of U69 protein, HHV-6-infected Molt3 #19 cells were lysed, separated into nuclear and cytoplasmic fractions, and analyzed by Western blotting with anti-U69 antibodies. As shown in Fig. 2A and B, lamin B protein was detected only in the nuclear fraction, whereas tubulin was mostly present in the cytoplasmic fraction, confirming the successful separation of the nuclear and cytoplasmic fractions. The U69 protein was detected exclusively in the virus-infected nuclear fraction (Fig. 2C, lanes 2 and 3), suggesting that the U69 product is predominantly localized to the nuclei of virus-infected cells.


Figure 2
View larger version (71K):
[in this window]
[in a new window]

 
FIG. 2. Western blot analysis of nuclear and cytoplasmic fractions of HHV-6-infected Molt3 #19 cells with an anti-lamin B monoclonal antibody (A), anti-{alpha}-tubulin monoclonal antibody (B), and anti-U69 mouse polyclonal antibodies (C). (A, B, and C) Nuc, nuclear fraction of HHV-6-infected cells; Cyt, cytoplasmic fraction of HHV-6-infected cells. (C) Moc, mock-infected cells; Inf, HHV-6-infected cells. The arrowheads indicate purified bands that are the same sizes as lamin B (A), {alpha}-tubulin (B), and U69 (C) proteins.

The subcellular localization of the U69 protein was further investigated by an indirect immunofluorescence experiment. As shown in Fig. 3A, staining with anti-U69 antiserum revealed a strong mesh-like pattern in the nuclei of HHV-6-infected Molt3 #19 cells (Fig. 3A, part b), which largely overlapped the Hoechst 33342 staining pattern (Fig. 3A, part a). Similarly, in HEK293 cells that transiently expressed Flag-tagged U69, the anti-FLAG monoclonal antibody showed staining of the nucleus with a similar mesh-like pattern (Fig. 3B, part f). These results, together with the biochemical fractionation, indicate that U69 is a nuclear protein, which is consistent with the predicted role of U69 in viral DNA replication.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
FIG. 3. (A) Immunofluorescence assay of HHV-6-infected cells with anti-U69 mouse polyclonal antibodies. HHV-6-infected Molt3 cells (parts a to d) were stained with anti-U69 mouse polyclonal antibodies (part b). In part a, the same cells were stained with Hoechst 33342. Part d is the merged image of parts a and b. The image in part c was obtained with a phase microscope. (B) Intracellular localization of the HHV-6 U69 protein in transfected cells. HEK293 cells were transfected with pEF-BOS-U69-FLAG and cultured for 24 h in Dulbecco modified Eagle medium with 10% FCS. The localization of HHV-6 U69 protein was examined by immunofluorescence assay with anti-FLAG monoclonal antibody M2 (part f). In part e, the same cells were stained with Hoechst 33342. Part h is the merged image of parts e and f. The image in part g was obtained with a phase microscope.

Computer-based search for NLSs in U69. To search for nuclear localization signals (NLSs) in the amino acid sequence of U69, we used the computer program PSORT II (http://psort.nibb.ac.jp/), which predicted two putative classic NLSs (type pat7) in the N-terminal region of the U69 protein (Fig. 4A). Such NLSs start with proline, which is followed within three residues by a basic segment in which three of the next four residues are lysine or arginine. The program indicated that there were two monopartite-type NLSs (residues 19 to 25 and 20 to 26) that completely overlapped, making it difficult to tell whether these NLSs were independent from each other. On the other hand, a bipartite-type NLS was also predicted in another overlapping set of residues (residues 22 to 38, RKRKRK; the underlined amino acids are defining features of a bipartite NLS). In addition, the amino acid sequence alignment of the HCMV, HHV-7, and HHV-6 protein kinase homologues showed that putative NLSs were conserved among these human betaherpesviruses (Fig. 4A). Furthermore, similar classic NLS motifs were found in the N-terminal regions of other herpesvirus protein kinases (Fig. 4B).


Figure 4
View larger version (70K):
[in this window]
[in a new window]

 
FIG. 4. (A) Amino acid sequence alignment of the HHV-6, HHV-7, and HCMV protein kinases (U69, U69, and UL97, respectively). Predicted NLSs are underlined. (B) Predicted NLS sites for herpesvirus protein kinase homologues. Predicted and determined NLSs are singly and doubly underlined, respectively. The accession numbers of the sequences for the following are given in parentheses: HSV-1 UL13 (M19121), HSV-2 UL13 (Z86099), EHV-4 gene 49 (AF030027), HCMV UL97 (X17403), HHV-6 U69 (AB021506), HHV-7 U69 (U43400), HHV-8 ORF36 (U75698), HVS2 (herpesvirus saimiri) ORF36 (X64346), and murine cytomegalovirus M97 (Y09060). aa, amino acids.

Mapping of the NLS activity of U69 protein. To determine if the putative NLSs of U69 were functional, we constructed a series of mammalian expression plasmids for U69-GFP fusion proteins in which various parts of U69 were inserted between the N-terminal triple-HA tag and the C-terminal GFP (Fig. 5A). The GFP fusion protein containing most of U69 (amino acids 19 to 552) was localized to the cell nucleus (Fig. 5B, parts A, B, and C), whereas GFP alone was observed in both the nucleus and the cytoplasm (Fig. 5B, parts D, E, and F). Thus, the addition of the GFP moiety did not alter the distribution of the partner protein in the transiently transfected cells. The U69(43-522) fusion protein, which lacked the putative NLS region, did not accumulate in the nucleus (Fig. 5B, parts G, H, and I), suggesting that the N-terminal region of U69 (residues 19 to 43) is required for its nuclear localization.


Figure 5
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 5. (A) Construction of expression plasmids for the in-frame fusion of HA3 and GFP with all or part of the ORF of HHV-6 U69. PCR products encoding full-length HHV-6 U69 and its N-terminal and C-terminal regions were cloned into expression vector pEF-BOS-HA3-EGFP as described in Materials and Methods. WT, wild type; aa, amino acids. (B) Mapping of the NLS activity of the U69 protein. HEK293 cells were transfected with pEF-BOS-U69(19-552)-GFP (parts A, B, and C), pEF-BOS-EGFP (parts D, E, and F), pEF-BOS-U69(43-552)-GFP (parts G, H, and I), pEF-BOS-U69(19-39)-GFP (parts J, K, and L), pEF-BOS-U69(19-26)-GFP (parts M, N, and O), or pEF-BOS-U69(21-39)-GFP (parts P, Q, and R). Twenty-four hours after transfection, the cells were stained with Hoechst 33342 and then examined by fluorescence microscopy. GFP (part E) and the GFP fusion proteins (parts B, H, K, N, and Q) were directly observed by fluorescence microscopy without staining. The images of nuclei stained with Hoechst are shown in parts A, D, G, J, M, and P. Parts C, F, I, L, O, and R are the merged images of parts A and B, D and E, G and H, J and K, M and N, and P and Q, respectively.

To determine whether this region alone was sufficient to function as the NLS for the heterologous protein, we constructed GFP fusion proteins containing short peptide sequences from this region and examined their localization in transfected cells. The GFP fusion protein containing the N-terminal region, U69(19-39), was completely localized to the nucleus (Fig. 5B, parts J, K, and L), indicating that the short region predicted by the computer search indeed acts as a functional NLS. Furthermore, U69(19-26)-GFP (Fig. 5B, parts M, N, and O) and U69(21-39)-GFP (Fig. 5B, parts P, Q, and R) were also localized to the nucleus. These data suggest that both of the overlapping NLS motifs function in the protein's nuclear localization.

Wheat germ agglutinin (WGA) inhibits in vitro nuclear transport mediated by the U69 NLS. To confirm the NLS activity of the U69 protein, we produced a GST-U69(21-39)-GFP fusion protein in E. coli and microinjected the purified protein into the cytoplasm of HeLa cells. A fusion protein consisting of only GST-GFP did not enter the nuclei of HeLa cells because it was too large to diffuse into the nuclei passively (Fig. 6a). On the other hand, GST-U69(21-39)-GFP entered the nuclei of the cells within 30 min after microinjection (Fig. 5B, part b), suggesting that the bipartite-type NLS sequence (amino acids 21 to 39) of U69 is a functional signal for nuclear translocation.


Figure 6
View larger version (59K):
[in this window]
[in a new window]

 
FIG. 6. U69 NLS activity is inhibited by WGA. HeLa cells were grown on coverslips, and either 1 mg/ml GST-GFP (a) or 1 mg/ml GST-U69(21-39)-GFP was injected into the cytoplasm without (b) or with (c) 1 mg/ml WGA. After incubation for 30 min, the cells were fixed and observed by fluorescence microscopy.

To exclude completely the possibility that the GST-GFP fusion protein with the U69 NLS entered the cell nucleus by passive diffusion, we examined whether WGA blocked its nuclear localization. WGA selectively inhibits the facilitated nuclear transport of proteins by binding to a component of the nuclear pore complex, but it does not block the translocation of small molecules into the nucleus by passive diffusion (12, 55). In the presence of WGA, microinjected GST-U69(21-39)-GFP did not enter the nucleus (Fig. 5B, part c), just like the GST-N17C74-GFP fusion protein constructed from the Vpr NLS of human immunodeficiency virus type 1 and the GST-NLS (simian virus 40 T antigen)-GFP fusion protein, which was used as a control (21; unpublished data). These results indicate that the GST-U69-GFP fusion protein was transported into the nucleus through the nuclear pore complex in a factor-dependent manner and confirm that the N-terminal region of the U69 protein is responsible for its nuclear localization.

The U69 NLS-dependent nuclear transport is mediated by importin-{alpha}/β in conjunction with the small GTPase Ran. The nuclear import of karyophilic proteins containing a classic NLS is mediated by importin-{alpha}/β and Ran (14, 33, 54). In addition, in mammals, importin-{alpha} constitutes a multigene family that can be divided into three distinct subgroups, and the nuclear import of some nuclear proteins is mediated by a specific or selective importin-{alpha} subtype (54). For example, the nuclear import of RNA helicase A and EBNA-1 is mediated by Qip1/importin-{alpha}3 and NPI1/importin-{alpha}5, respectively (3, 25). Therefore, first, to determine whether the U69 protein is transported by importin-{alpha}/β, we performed an in vitro nuclear import assay with digitonin-permeabilized cells. As shown in Fig. 7B, parts a, b, and c, the nuclear import of GST-U69(21-39)-GFP was mediated by Rch1, Qip1, or NPI2 in the presence of importin-β, Ran, NTF2, and an ATP regeneration system, indicating that the U69 protein is transported via the classical nuclear import pathway.


Figure 7
View larger version (72K):
[in this window]
[in a new window]

 
FIG. 7. NPI2 preferentially binds to the U69 NLS, which is transported into the nucleus in conjunction with Ran. (A) Pull-down assays were performed with GST-U69(21-39)-GFP (100 pmol) and either GFP alone (Mock, lanes 1 and 2), GFP-Rch1 (lanes 3 and 4), GFP-Qip1 (lanes 5 and 6), or GFP-NPI2 (lanes 7 and 8) coupled with glutathione-Sepharose beads. The amount of GFP or GFP-importin-{alpha} (Imp) added was 100 pmol for lanes 1, 3, 5, and 7 and 300 pmol for lanes 2, 4, 6, and 8 in a 100-µl reaction volume. After incubation for 1 h at 4°C, the beads were washed and the bound proteins were analyzed by SDS-PAGE. (B) GST-U69(21-39)-GFP (10 pmol) was applied to an in vitro reconstituted transport assay system supplemented with importin-β, Ran, NTF2, an ATP regeneration system, and either Rch1 (a, d, g), Qip1 (b, e, h), or NPI2 (c, f, i) in the absence (a to f) or presence (g to i) of Q69L Ran-GTP. The upper row (a to c) shows the results of assays in which an amount of importin-{alpha} (10 pmol) equivalent to that of GST-U69(21-39)-GFP was added, and in the middle row (d to f) the amount of importin-{alpha} was one-fifth (2 pmol) of that of the substrate, in a 10-µl reaction volume. In the lower row (g to i), 10 pmol of importin-{alpha} was added in a 10-µl reaction volume.

Next, to determine which importin-{alpha} subtypes interact most efficiently with the U69 NLS, in vitro pull-down assays of various GFP-importin-{alpha} fusion proteins were performed with GST-U69(21-39)-GFP bound to glutathione-Sepharose beads. As shown in Fig. 7A, U69(21-39) interacted with GFP-Rch1, Qip1, and NPI2 under conditions in which control GFP did not bind at all. Interestingly, pull-down experiments with two different concentrations of GFP-importins (1 µM and 3 µM) suggested that these importin-{alpha}s bound to the U69 NLS with distinct affinities; i.e., NPI2 showed the highest affinity for the NLS, whereas Qip1 showed the lowest.

To determine whether there was a correlation between binding affinity and transport activity, we performed in vitro reconstituted transport assays. When an amount of different importin-{alpha}s (10 pmol) equivalent to that of GST-U69(21-39)-GFP (10 pmol) was added to the transport assay system (Fig. 7B, parts a to c), the U69 NLS was efficiently transported to the nucleus, irrespective of the importin subtype. In contrast, in the presence of a substoichiometric amount of importin-{alpha}s (2 pmol, Fig. 7B, parts d to f), only NPI2 efficiently transported GST-U69(21-39)-GFP into the nucleus. These results suggest that NPI2, which has the highest binding affinity for the U69 NLS, also has the highest transport activity for a protein fused with the U69 NLS.

To confirm that Ran is required for nuclear transport of the U69 protein, we performed the transport assay in the presence of a mutated Ran protein, Q69L Ran-GTP, which is deficient in GTP hydrolysis (40). As shown in Fig. 7B, parts g, h, and i, the nuclear import of GST-U69(21-39)-GFP was strongly inhibited by Q69L Ran-GTP, confirming that the nuclear translocation mediated by the U69 NLS is critically dependent on Ran.

In summary, we found that HHV-6 U69 is a 64-kDa nuclear protein that is synthesized in the absence of viral DNA synthesis. We mapped the functional NLS of U69 to the N terminus of the protein and showed that its nuclear import is mediated by importin-{alpha} and Ran. Interestingly, NPI2, which has the highest binding affinity for the U69 NLS, appears to have the highest nuclear transport activity for it as well.


arrow
DISCUSSION
 
There is increasing evidence that HHV-6 is an important pathogen in individuals undergoing organ transplantation (8, 49), as is HCMV, which causes significant morbidity when it infects such individuals (11). HHV-6 infections are usually treated with GCV, which generally causes a rapid reduction of viremia, since HHV-6 replication can be controlled with GCV (8). However, the detailed molecular mechanism that governs the susceptibility of HHV-6 to this drug remains to be investigated. The U69 protein of HHV-6 directs the phosphorylation of GCV in HHV-6-infected cells (7) and functions as a protein kinase (2). The fact that U69 is one of the early genes (Fig. 1B) suggests that GCV might not inhibit the expression of U69 and the subsequent phosphorylation of proteins by the U69 gene product in HHV-6-infected cells. Although the physiological targets of the U69 kinase, whether viral or cellular, are not known, previous studies have suggested that the herpesvirus-encoded kinases play important roles in viral replication. In particular, the UL97 protein of HCMV is associated with viral replication via viral nuclear egress (27, 41). Although we do not know whether the U69 protein of HHV-6 is associated with viral nuclear egress or not, the inhibition of viral growth in U69 interfering RNA-expressing MT4 cells suggests that U69 plays a role in viral replication (data not shown). In addition, histone H2AX (serine-139) was phosphorylated in U69 gene-transfected cells (data not shown). The expression of U69 earlier in the infection than the expression of viral component proteins is consistent with its predicted role in viral DNA replication.

Although it was shown that UL97 of HCMV, an HHV-6 U69 homolog, is localized to the nucleus (31), the mechanism of nuclear localization has not been clear. In the present study, we performed molecular analyses of the nuclear localization of the U69 protein. The NLS amino acid sequences reported for different nuclear proteins are very diverse (9, 30, 44) and lack a strict consensus sequence but generally are short and characterized by a high proportion of positively charged residues (4, 9). Monopartite classical NLSs have a single cluster of basic residues (6). Many monopartite NLSs are seven to nine residues long and contain a helix-disrupting amino-terminal amino acid (proline or glycine), followed by at least three basic amino acids, and other NLSs contain basic amino acids flanking a proline residue. Lange and coworkers reported that a monopartite classical NLS requires a lysine in the P1 position, followed by basic residues in positions P2 and P4 to yield a loose consensus sequence of K(K/R)X(K/R). In the case of U69, a "classical" monopartite-type NLS was predicted to reside between residues 20 and 26 (PDRKRLR), although two overlapping NLSs were predicted to reside between residues 19 and 25 (PPRKRL) and between residues 20 and 26 by a computer program. The underlined residues are thought to be important for the function of a classical NLS. On the other hand, we also found a bipartite classical NLS (22RKRKRK38) with two interdependent basic domains and a mutation-tolerant spacer (9, 19, 43). The pair of underlined residues is thought to be an important feature of the bipartite classical NLS. The fluorescence from the fusion protein GST-U69(21-39)-GFP was detected in the nuclei of cells within only 30 min following microinjection (Fig. 6), although the fusion protein GST-U69(19-26)-GFP could not enter the nuclei of HeLa cells and remained in the cytoplasm even 3 h after microinjection (data not shown). This result suggests that the U69 protein uses the bipartite type of NLS in its N-terminal region and enters the nucleus via the classical pathway. However, we do not know why the microinjection data conflicted with the transfection results, which indicated that the monopartite NLS motifs were important for U69's nuclear location.

Mammalian importin-{alpha} is divided into three subtypes, represented by Rch1 (human importin-{alpha}1/mouse importin-{alpha}2), Qip1 (human importin-{alpha}3/mouse importin-{alpha}4), and NPI2 (human importin-{alpha}7/mouse importin-{alpha}6). Köhler and coworkers (26) reported that the total amount of importin-{alpha}, as well as the relative content of each importin-{alpha} subtype, varies among different cell types. Rch1/importin-{alpha}1 and Qip1/importin-{alpha}3 are ubiquitous in the human cells tested. Qip1/importin-{alpha}3 is more abundant in U937 cells, but other cells, like Raji, Jurkat, HEK293, and HepG2, are enriched in hSRP1, which belongs to the NPI2/importin-{alpha}7 subtype. Our results showed that NPI2/importin-{alpha}7 has the highest transport activity for the U69 NLS.

The target cells for HHV-6 replication are T cells (50), although the receptor for HHV-6 is ubiquitous in human cells (46). Our findings suggest that NPI2/importin-{alpha}7 may be critical for viral growth, since the U69 protein is needed for HHV-6 growth, similar to the UL13 protein of HSV-1 and the UL97 protein of HCMV. We propose that the cell tropism of HHV-6 might be related to the cell's expression of the NPI2/importin-{alpha}7 subtype, although more molecular biological and virological analyses are needed to examine this possibility.


arrow
ACKNOWLEDGMENTS
 
We are deeply grateful to S. Nagata of the Osaka University Graduate School of Medicine for providing expression vectors and helpful discussion of protein analysis and expression.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Infectious Disease Control, G-5, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-3301. Fax: 81-6-6879-3309. E-mail: isegawa{at}bact.med.osaka-u.ac.jp Back

{triangledown} Published ahead of print on 14 November 2007. Back


arrow
REFERENCES
 
    1
  1. Advani, S. J., R. Brandimarti, R. R. Weichselbaum, and B. Roizman. 2000. The disappearance of cyclins A and B and the increase in activity of the G2/M-phase cellular kinase cdc2 in herpes simplex virus 1-infected cells require expression of the {alpha}22/US1.5 and UL13 viral genes. J. Virol. 74:8-15.[Abstract/Free Full Text]
  2. 2
  3. Ansari, A., and V. C. Emery. 1999. The U69 gene of human herpesvirus 6 encodes a protein kinase which can confer ganciclovir sensitivity to baculoviruses. J. Virol. 73:3284-3291.[Abstract/Free Full Text]
  4. 3
  5. Aratani, S., T. Oishi, H. Fujita, M. Nakazawa, R. Fujii, N. Imamoto, Y. Yoneda, A. Fukamizu, and T. Nakajima. 2006. The nuclear import of RNA helicase A is mediated by importin-{alpha}3. Biochem. Biophys. Res. Commun. 340:125-133.[Medline]
  6. 4
  7. Conti, E. 2002. Structures of importins. Results Probl. Cell Differ. 35:93-113.[Medline]
  8. 5
  9. Cunningham, C., A. J. Davison, A. Dolan, M. C. Frame, D. J. McGeoch, D. M. Meredith, H. W. M. Moss, and A. C. Orr. 1992. The UL13 virion protein of herpes simplex virus type 1 is phosphorylated by a novel virus-induced protein kinase. J. Gen. Virol. 73:303-311.[Abstract/Free Full Text]
  10. 6
  11. Dang, C. V., and W. M. Lee. 1989. Nuclear and nucleolar targeting sequences of c-erb-A, c-myb, N-myc, p53, HSP70, and HIV tat proteins. J. Biol. Chem. 264:18019-18023.[Abstract/Free Full Text]
  12. 7
  13. de Bolle, L., D. Michel, T. Mertens, C. Manichanh, H. Agut, E. de Clercq, and L. Naesens. 2002. Role of the human herpesvirus 6 U69-encodes kinase in the phosphorylation of ganciclovir. Mol. Pharmacol. 62:714-721.[Abstract/Free Full Text]
  14. 8
  15. de Bolle, L., L. Naesens, and E. de Clercq. 2005. Update on human herpesvirus 6 biology, clinical features, and therapy. Clin. Microbiol. Rev. 18:217-245.[Abstract/Free Full Text]
  16. 9
  17. Dingwall, C., and R. A. Laskey. 1991. Nuclear targeting sequences—a consensus? Trends Biochem. Sci. 16:478-481.[CrossRef][Medline]
  18. 10
  19. Dominguez, G., T. R. Dambaugh, F. R. Stamey, S. Dewhurst, N. Inoue, and P. E. Pellett. 1999. Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. J. Virol. 73:8040-8052.[Abstract/Free Full Text]
  20. 11
  21. Erice, A. 1999. Resistance of human cytomegalovirus to antiviral drugs. Clin. Microbiol. Rev. 12:286-297.[Abstract/Free Full Text]
  22. 12
  23. Finlay, D. R., D. D. Newmeyer, T. M. Price, and D. J. Forbes. 1987. Inhibition of in vitro transport by a lectin that binds to nuclear pores. J. Cell Biol. 104:189-200.[Abstract/Free Full Text]
  24. 13
  25. Gompels, U. A., J. Nicholas, G. Lawrence, M. Jones, B. J. Thomson, M. E. Martin, S. Efstathiou, M. Craxton, and H. A. Macaulay. 1995. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209:29-51.[CrossRef][Medline]
  26. 14
  27. Hieda, M., T. Tachibana, M. Fukumoto, and Y. Yoneda. 2001. Nuclear import of the U1A splicesome protein is mediated by importin {alpha}/β and Ran in living mammalian cells. J. Biol. Chem. 276:16824-16832.[Abstract/Free Full Text]
  28. 15
  29. Imamoto, N., T. Shimamoto, T. Takao, T. Tachibana, S. Kose, M. Matsubae, T. Sekimoto, Y. Shimonishi, and Y. Yoneda. 1995. In vivo evidence for involvement of a 58 kDa component of nuclear pore-targeting complex in nuclear protein import. EMBO J. 14:3617-3626.[Medline]
  30. 16
  31. Isegawa, Y., T. Mukai, K., Nakano, M. Kagawa, J. Chen, Y. Mori, T. Sunagawa, K. Kawanishi, J. Sashihara, A. Hata, P. Zou, H. Kosuge, and K. Yamanishi. 1999. Comparison of the complete DNA sequences between human herpesvirus 6 variants A and B. J. Virol. 73:8053-8063.[Abstract/Free Full Text]
  32. 17
  33. Isegawa, Y., Z. Ping, K. Nakano, N. Sugimoto, and K. Yamanishi. 1998. Human herpesvirus 6 open reading frame U12 encodes a functional β-chemokine receptor. J. Virol. 72:6104-6112.[Abstract/Free Full Text]
  34. 18
  35. Isegawa, Y., M. Takemoto, K. Yamanishi, A. Ohshima, and N. Sugimoto. 2007. Real-time PCR determination of human herpesvirus 6 antiviral drug susceptibility. J. Virol. Methods 140:25-31.[CrossRef][Medline]
  36. 19
  37. Jans, D. A., and S. Hubner. 1996. Regulation of protein transport to the nucleus: central role of phosphorylation. Physiol. Rev. 76:651-685.[Abstract/Free Full Text]
  38. 20
  39. Jiang, C.-J., N. Imamoto, R. Matsuki, Y. Yoneda, and N. Yamamoto. 1998. Functional characterization of a plant importin {alpha} homologue. Nuclear localization signal (NLS)-selective binding and mediation of nuclear import of NLS proteins in vitro. J. Biol. Chem. 273:24083-24087.[Abstract/Free Full Text]
  40. 21
  41. Kamata, M., Y. Nitahara-Kasahara, Y. Miyamoto, Y. Yoneda, and Y. Aida. 2005. Importin-{alpha} promotes passage through the nuclear pore complex of human immunodeficiency virus type 1 Vpr. J. Virol. 79:3557-3564.[Abstract/Free Full Text]
  42. 22
  43. Kawaguchi, Y., R. Bruni, and B. Roizman. 1997. Interaction of herpes simplex virus 1 {alpha} regulatory protein ICP0 with elongation factor 1{delta}: ICP0 affects translational machinery. J. Virol. 71:1019-1024.[Abstract]
  44. 23
  45. Kawaguchi, Y., T. Matsumura, B. Roizman, and K. Hirai. 1999. Cellular elongation factor 1{delta} is modified in cells infected with representative alpha-, beta-, or gammaherpesviruses. J. Virol. 73:4456-4460.[Abstract/Free Full Text]
  46. 24
  47. Kawaguchi, Y., C. Van Sant, and B. Roizman. 1998. Eukaryotic elongation factor 1{delta} is hyperphosphorylated by the protein kinase encoded by the UL13 gene of herpes simplex virus 1. J. Virol. 72:1731-1736.[Abstract/Free Full Text]
  48. 25
  49. Kitamura, R., T. Sekimoto, S. Ito, S. Harada, H. Yamagata, H. Masai, Y. Yoneda, and K. Yanagi. 2006. Nuclear import of Epstein-Barr virus nuclear antigen 1 mediated by NPI-1 (importin {alpha}5) is up- and down-regulated by phosphorylation of the nuclear localization signal for which Lys379 and Arg380 are essential. J. Virol. 80:1979-1991.[Abstract/Free Full Text]
  50. 26
  51. Köhler, M., S. Ansieau, S. Prehn, A. Leutz, H. Haller, and E. Hartmann. 1997. Cloning of two novel human importin-{alpha} subunits and analysis of the expression pattern of the importin-{alpha} protein family. FEBS Lett. 417:104-108.[CrossRef][Medline]
  52. 27
  53. Krosky, P. M., M.-C. Baek, and D. M. Coen. 2003. The human cytomegalovirus UL97 protein kinase, an antiviral drug target, is required at the stage of nuclear egress. J. Virol. 77:905-914.[CrossRef][Medline]
  54. 28
  55. Lawrence, G. L., J. Nicholas, and B. G. Barrell. 1995. Human herpesvirus 6 (strain U1102) encodes homologues of the conserved herpesvirus glycoprotein gM and the alphaherpesvirus origin-binding protein. J. Gen. Virol. 76:147-152.[Abstract/Free Full Text]
  56. 29
  57. Manichanh, C., C. Olivier-Aubron, J. P. Lagarde, J. T. Aubin, P. Bossi, A. Gautheret-Dejean, J. M. Hurraux, and H. Agut. 2001. Selection of the same mutation in the U69 protein kinase gene of human herpesvirus 6 after prolonged exposure to ganciclovir in vitro and in vivo. J. Gen. Virol. 82:2767-2776.[Abstract/Free Full Text]
  58. 30
  59. Mattaj, I. W., and L. Englmeier. 1998. Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67:265-306.[CrossRef][Medline]
  60. 31
  61. Michel, D., I. Pavic, A. Zimmermann, E. Haupt, K. Wunderlich, M. Heuschmid, and T. Mertens. 1996. The UL97 gene product of human cytomegalovirus is an early-late protein with a nuclear localization but is not a nucleoside kinase. J. Virol. 70:6340-6346.[Abstract]
  62. 32
  63. Miyamoto, Y., M. Hieda, M. T. Harreman, M. Fukumoto, T. Saiwaki, A. E. Hodel, A. H. Corbett, and Y. Yoneda. 2002. Importin {alpha} can migrate into the nucleus in an importin β- and Ran-independent manner. EMBO J. 21:5833-5842.[CrossRef][Medline]
  64. 33
  65. Moore, M. S., and G. Blobel. 1993. The GTP-binding protein Ran/TC4 is required for protein import into the nucleus. Nature 365:661-663.[CrossRef][Medline]
  66. 34
  67. Moss, P., and A. Rickinson. 2005. Cellular immunotherapy for viral infection after HSC transplantation. Nat. Rev. Immunol. 5:9-20.[CrossRef][Medline]
  68. 35
  69. Ng, T. I., W. O. Ogle, and B. Roizman. 1998. UL13 protein kinase of herpes simplex virus 1 complexes with glycoprotein E and mediates the phosphorylation of the viral Fc receptor: glycoprotein E and I. Virology 241:37-48.[CrossRef][Medline]
  70. 36
  71. Ng, T. I., C. Talarico, T. Burnette, K. Biron, and B. Roizman. 1996. Partial substitution of the functions of herpes simplex virus 1 UL13 gene by the human cytomegalovirus UL97 gene. Virology 225:347-358.[CrossRef][Medline]
  72. 37
  73. Ogle, W. O., T. I. Ng, K. L. Carter, and B. Roizman. 1997. The UL13 protein kinase and the infected cell type are determinants of posttranslational modification of ICP0. Virology 235:406-413.[CrossRef][Medline]
  74. 38
  75. Okuno, T., H. Sao, H. Asada, K. Shiraki, M. Takahashi, and K. Yamanishi. 1990. Analysis of a glycoprotein of human herpesvirus 6 (HHV-6) using monoclonal antibodies. Virology 176:625-628.[CrossRef][Medline]
  76. 39
  77. Overton, J. D., D. J. McMillan, L. S. Klavinskis, L. Hope, A. J. Ritchie, and P. L. Wong-Kai-In. 1992. Herpes simplex virus type 1 gene UL13 encodes a phosphoprotein that is a component of the virion. Virology 190:184-192.[CrossRef][Medline]
  78. 40
  79. Palacios, I., K. Weis, C. Kiebe, I. W. Mattaj, and C. Dingwall. 1996. Ran/TC4 mutants identify a common requirement for snRNA and protein import into the nucleus. J. Cell Biol. 133:485-494.[Abstract/Free Full Text]
  80. 41
  81. Prichard, M. N., N. Gao, S. Jairath, G. Mulamba, P. Krosky, D. M. Coen, B. O. Parker, and G. S. Pari. 1999. A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J. Virol. 73:5663-5670.[Abstract/Free Full Text]
  82. 42
  83. Purves, F. C., and B. Roizman. 1992. The UL13 gene of herpes simplex virus 1 encodes the functions for posttranslational processing associated with phosphorylation of the regulatory protein {alpha}22. Proc. Natl. Acad. Sci. USA 89:7310-7314.[Abstract/Free Full Text]
  84. 43
  85. Robbins, J., S. M. Dilworth, R. A. Laskey, and C. Dingwall. 1991. Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64:615-623.[CrossRef][Medline]
  86. 44
  87. Roberts, B. 1989. Nuclear location signal-mediated protein transport. Biochim. Biophys. Acta 1008:263-280.[Medline]
  88. 45
  89. Salahuddin, S. Z., D. V. Ablashi, P. Markham, S. F. Josephs, S. Sturzegger, M. Kaplan, G. Halligan, P. Biberfeld, F. Wong-Staal, B. Kramarsky, and R. C. Gallo. 1986. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234:596-601.[Abstract/Free Full Text]
  90. 46
  91. Santoro, F., P. E. Kennedy, G. Locatelli, M. S. Malnati, E. A. Berger, and P. Lusso. 1999. CD46 is a cellular receptor for human herpesvirus 6. Cell 99:817-827.[CrossRef][Medline]
  92. 47
  93. Shapiro, D. J., P. A. Sharp, W. W. Wahl, and M. J. Keller. 1988. A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47-55.[Medline]
  94. 48
  95. Smith, I. L., J. M. Cherrington, R. E. Jiles, M. D. Fuller, W. R. Freeman, and S. A. Spector. 1997. High-level resistance of cytomegalovirus to ganciclovir is associated with alterations in both the UL97 and DNA polymerase genes. J. Infect. Dis. 176:69-77.[Medline]
  96. 49
  97. Soldan, S. S., R. Berti, N. Salem, P. Secchiero, L. Flamand, P. A. Calabresi, M. B. Brennan, H. W. Moloni, H. F. McFarland, H. C. Lin, M. Patnaik, and S. Jacobson. 1997. Association of human herpes virus 6 (HHV-6) with multiple sclerosis: increased IgM response to HHV-6 early antigen and detection of serum HHV-6 DNA. Nat. Med. 3:1394-1397.[CrossRef][Medline]
  98. 50
  99. Takahashi, K., S. Sonoda, K. Higashi, T. Kondo, H. Takahashi, M. Takahashi, and K. Yamanishi. 1989. Predominant CD4 T-lymphocyte tropism of human herpesvirus 6-related virus. J. Virol. 63:3161-3163.[Abstract/Free Full Text]
  100. 51
  101. Takemoto, M., T. Shimamoto, Y. Isegawa, and K. Yamanishi. 2001. The R3 region, one of three major repetitive regions of human herpesvirus 6, is a strong enhancer of immediate-early gene U95. J. Virol. 75:10149-10160.[Abstract/Free Full Text]
  102. 52
  103. Watanabe-Fukunaga, R., S. Iida, Y. Shimizu, S. Nagata, and R. Fukunaga. 2005. SEI family of nuclear factors regulates p53-dependent transcriptional activation. Genes Cells 10:851-860.[Abstract/Free Full Text]
  104. 53
  105. Yamanishi, K., T. Okuno, K. Shiraki, M. Takahashi, T. Kondo, Y. Asano, and T. Kurata. 1988. Identification of human herpesvirus-6 as a causal agent for exanthema subitum. Lancet i:1056-1067.
  106. 54
  107. Yasuhara, N., N. Shibazaki, S. Tanaka, M. Nagai, Y. Kamikawa, S. Oe, Y. Kamachi, H. Kondoh, and Y. Yoneda. 2007. Triggering neural differentiation of ES cells by subtype switching of importin-{alpha}. Nat. Cell Biol. 9:72-79.[CrossRef][Medline]
  108. 55
  109. Yoneda, Y., N. Imamoto-Sonobe, M. Yamaizumi, and T. Uchida. 1987. Reversible inhibition of protein import into the nucleus by wheat germ agglutinin injected into culture cells. Exp. Cell Res. 173:586-595.[CrossRef][Medline]


Journal of Virology, January 2008, p. 710-718, Vol. 82, No. 2
0022-538X/08/$08.00+0     doi:10.1128/JVI.00736-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Isegawa, Y.
Right arrow Articles by Sugimoto, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Isegawa, Y.
Right arrow Articles by Sugimoto, N.