Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wirblich, C. Articles by Schnell, M. J. Search for Related Content PubMed PubMed Citation Articles by Wirblich, C. Articles by Schnell, M. J.

 Previous Article  |  Next Article 

Journal of Virology, October 2008, p. 9730-9738, Vol. 82, No. 19
0022-538X/08/$08.00+0     doi:10.1128/JVI.00889-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

PPEY Motif within the Rabies Virus (RV) Matrix Protein Is Essential for Efficient Virion Release and RV Pathogenicity

Christoph Wirblich,^1,2 Gene S. Tan,¹ Amy Papaneri,^1,2 Peter J. Godlewski,³ Jan Marc Orenstein,⁴ Ronald N. Harty,^3* and Matthias J. Schnell^1,2*

Department of Microbiology and Immunology,¹ Jefferson Vaccine Center, Thomas Jefferson University, Philadelphia, Pennsylvania,² Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania,³ Department of Pathology, George Washington University, Washington, DC⁴

Received 28 April 2008/ Accepted 15 July 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Late (L) domains containing the highly conserved sequence PPXY were first described for retroviruses, and later research confirmed their conservation and importance for efficient budding of several negative-stranded RNA viruses. Rabies virus (RV), a member of the Rhabdoviridae family, contains the sequence PPEY (amino acids 35 to 38) within the N terminus of the matrix (M) protein, but the functions of this potential L-domain in the viral life cycle, viral pathogenicity, and immunogenicity have not been established. Here we constructed a series of recombinant RVs containing mutations within the PPEY motif and analyzed their effects on viral replication and RV pathogenicity. Our results indicate that the first proline at position 35 is the most important for viral replication, whereas P36 and Y38 have a lesser but still noticeable impact. The reduction in viral replication was most likely due to inhibition of virion release, because initially no major impact on RV RNA synthesis was observed. In addition, results from electron microscopy demonstrated that the M4A mutant virus (PPEYSAEA) displayed a more cell-associated phenotype than that of wild-type RV. Furthermore, all mutations within the PPEY motif resulted in reduced spread of the recombinant RVs as indicated by a reduction in focus size. Importantly, recombinant PPEY L-domain mutants were highly attenuated in mice yet still elicited potent antibody responses against RV G protein that were as high as those observed after infection with wild-type virus. Our data indicate that the RV PPEY motif has L-domain activity essential for efficient virus production and pathogenicity but is not essential for immunogenicity and thus can be targeted to increase the safety of rabies vaccine vectors.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Rabies virus (RV) is a nonsegmented negative-stranded RNA of the genus Lyssavirus within the Rhabdoviridae family (19). Rhabdoviruses, such as RV and vesicular stomatitis virus (VSV), are simple enveloped RNA viruses which encode only five proteins: a nucleoprotein (N), which encapsidates the genomic and antigenomic RNA and forms the ribonucleoprotein (RNP); a phosphoprotein (P), which is the noncatalytic subunit of the RNA polymerase complex; a matrix protein (M); a transmembrane glycoprotein (G); and the viral polymerase (L) (54). Whereas the RNP is the template for viral transcription and replication (4), the RV G and M are the key players in viral budding and assembly (38-40, 43, 46). In the case of RV G, it has been shown that this protein is not essential for viral budding, but the amount of virions is reduced about 30-fold if RV G is deleted (39). In addition, Mebatsion et al. showed that the RV G cytoplasmic domain (CD) specifically interacts with the RV M protein and that a CD-deleted glycoprotein reduces RV budding about sixfold (39, 40). This is in contrast to VSV, for which it has been shown that only a CD is required and not a specific amino acid sequence (46). However, similar to RV, VSV can also bud without its own glycoprotein but with also a reduced efficiency. Therefore, for both viruses it is believed that G protein is somehow providing a "pulling" signal for efficient viral budding from the infected cell (44, 46, 48, 51).

The RV M protein is a multifunctional protein. It has been shown to regulate the balance between transcription and replication of RV (12, 13). M also interacts with the RNP, which it condenses into a dense and coiled form, and with the cell membrane, where it recruits the RNP for assembly and budding (for a review, see reference 22). Mebatsion et al. demonstrated the essential role of RV M in virion assembly and budding with the finding that removal of RV M from the RV genome reduced budding 500,000-fold, indicating that RV M is even more important for viral budding than RV G (40).

It is interesting that RV M (P. Godlewski and R. Harty, unpublished data) and VSV M (2, 16, 27) can bud from the cell surface membrane by themselves as virus-like particles, a feature which has been described for the retroviral matrix protein Gag from human immunodeficiency virus and Rous sarcoma virus (14, 55). Another common feature of matrix proteins from different enveloped viruses is the presence of "late" or L-domains, which mediate efficient virus budding by interacting with host cell proteins, most of which are components of the vacuolar protein sorting pathway (for review, see references 1 and 25). To date, four L-domain core motifs have been identified (PPxY, PT/SAP, YxxL, and FPIV, where x can be any amino acid), and specific host proteins have been implied to interact directly or indirectly with these L-domains (for review, see reference 1).

Interestingly, certain L-domains found in matrix proteins can substitute for each other (6). For example, Irie et al. demonstrated that the PTAP L-domain of Ebola virus VP40 could functionally replace the PPPY L-domain of VSV M (22). As such, efficient budding of the PTAP-containing VSV/Ebola recombinant was shown to be dependent on the PTAP-specific host interactor Tsg101, which is not essential for budding of the PPPY-containing wild-type (WT) VSV (21).

L-domain activity has yet to be identified and characterized for RV. The RV M protein does contain a PPxY motif (PPEY) close to the amino terminus of M, similar to that described for VSV. Interestingly, a second potential L-domain motif (YxxL) is also present in RV M and is organized in an overlapping fashion (PpxYxxL), similar to that of Ebola virus VP40 (15).

While their function in mediating virion egress has been well defined, the effects of L-domains on viral pathogenesis and immunogenicity have not been well studied. For VSV, only viruses with modifications in the PSAP region of M have been studied in a mouse model of VSV infection and pathogenesis (20). Because the PSAP region of VSV M does not possess L-domain activity similar to that observed for the PPPY motif in BHK-21 cells, the detected attenuation of PSAP mutants in mice could be based on the unexpected findings that PSAP mutants showed less cytopathology, reduced levels of activated caspase-3, and enhanced production of beta interferon (20).

Our results presented in this study are the first to suggest that for RV, the ₃₅PPEY₃₈ motif, and not the YxxL motif, is essential for efficient virus production. Indeed, the first proline at position 35 was most important for viral replication, since mutation of this single residue reduced viral titers dramatically. In contrast, mutation of either P36 or Y38 resulted in a less significant, but still noticeable, reduction in virus titer. The reduction in viral replication was most likely due to inhibition of virion release, because initially no major impact on RV RNA synthesis was observed.

Recombinant PPEY M mutants were highly attenuated in mice but still elicited potent antibody responses against RV G protein that were as high as those observed following infection with wild-type virus. These findings suggest that the PPEY L-domain can serve as a target for increasing the safety not only of rabies vaccine vectors but also of other vaccine vehicles containing L-domains.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Antibodies, cells, and viruses. Monoclonal antibody against actin (AC-15) was purchased from Sigma. Polyclonal rabbit antiserum against residues 4 to 19 of RV M was obtained from Pacific Immunology (Ramona, CA), and rabbit antiserum against RV G was kindly provided by B. Dietzschold, Thomas Jefferson University.

Construction of recombinant RV carrying M mutants. The plasmid encoding RV M (pT7T-M) has been described previously (13). RV M was PCR amplified out of pTIT-M with primers adding a 5' EcoRI site (TAATATGAATTCATGAACCTCCTACGTAAG) and a 3' XhoI site (TTAAAACTCGAGTTATTCTAGAAGCAGAGA). The PCR fragment was then cloned into the pCAGGs expression vector using EcoRI and XhoI digestions, resulting in pCAGGs-RV-M. To introduce mutations within the RV M, the RV M gene was PCR amplified from pCAGGs-RV-M using the above primers, and the resulting PCR fragment was cloned into the pGEM-T-Easy vector (Promega Inc.). Site-directed mutagenesis was used to introduce the respective mutations in pGEM-T-RV-M. Briefly, complementary primers (5'P35A and 3'P35A, 5'P36A and 3'P36A, 5'P38A and 3'P38A, or 5'P41A and 3'P35A) encompassing the residue targeted and some of the flanking sequences were used to amplify the entire plasmid. The reaction mixture was then digested with DpnI to remove parental plasmid and transformed into JM109 bacterial cells according to the instructions of the manufacturer (Promega Inc.). The transformants were screened by sequencing. Positive clones (pGEM-T-RV-M-P35A, pGEM-T-RV-M-P36A pGEM-T-RV-M-P38A, and pGEM-T-RV-M-P41A) were digested with EcoRI and XhoI and then cloned back into pCAGGs to yield pCAGGs-35S, pCAGGs-36A, pCAGGs-38A, and pCAGGs-41A. The primers used are listed in Table 1. In the case of pCAGGs-35A, we discovered that a Ser was introduced instead of an Ala. We decided that this was an acceptable amino acid for the proposed study and renamed the plasmid pCAGGs-35S. To create the mutant where all four critical residues were mutated to alanine, the pGEM-T-RV-M construct was used as a template to engineer the first two Ala exchanges, utilizing the primers 5'P3536A and 3'P3536A, and the other mutations were introduced in a stepwise approach utilizing first the primer pair 5'P38A and 3'P38A, followed by 5'P41A and 3'P41A. Positive clones were identified after each round of mutagenesis by sequencing. The final plasmid was designated pCAGGs-4A. To construct the recombinant RV containing the respective M mutations the plasmids pCAGGs-35S, pCAGGs-36A, pCAGGs-38A, pCAGGs-41A, and pCAGGs-4A were digested with BstZ17I and SnaBI and the resulting fragment cloned into pSPBN (33). The resulting plasmids were designated pM35S, pM36A, pM38A, pM41A, and pM4A.

View this table: [in this window] [in a new window]

TABLE 1. Primers used for mutagenesis of RV M

Recovery of recombinant RV. Recombinant viruses were recovered as described previously with the following modifications (53). Briefly, BSR-T7 cells, which stably express T7 RNA polymerase, were transfected using Lipofectamine 2000 (Invitrogen) with 1.7 µg of full-length RV cDNA in addition to 0.8 µg pTIT-N, 0.4 µg pTIT-P, 0.4 µg pTIT-L, or 0.3 µg pTIT-G, which encode the N, P, L, and G proteins of RV. Six to 7 days posttransfection the supernatant was passaged on fresh BSR cells, and infectious RV was detected 3 days later with fluorescein isothiocyanate-conjugated monoclonal antibody against RV N (Centocor).

Western blotting. BHK-21 cells were seeded into a 24-well plate (2 x 10⁵/well) and infected the following day with 2 x 10⁶ focus-forming units (FFU) of RV in 200 µl serum-free medium. After 1 h at 37°C, the inocula were removed and 1 ml fresh medium was added. Floating and adherent cells were collected 48 h after infection, washed with phosphate-buffered saline (PBS), and lysed in 200 µl detergent solution (10 mM Tris-HCl [pH 7.6], 1% NP-40, 0.4% deoxycholate, 66 mM EDTA) supplemented with protease inhibitor cocktail (Sigma, Inc.). The lysate was spun for 3 min at 13,000 x g, and the supernatant was mixed with an equal volume of sample buffer (62.5 mM Tris-HCl [pH 6.8], 2% sodium dodecyl sulfate, 2% β-mercaptoethanol, 20% glycerol, and 0.01% bromophenol blue). Prior to loading, the samples were incubated at 94°C for 5 min and equal volumes were run on sodium dodecyl sulfate-10% polyacrylamide gels in Tris-Tricine buffer (45). The proteins were transferred onto 0.45-µm PVDF-Plus membranes (GE Osmonics, Minnetonka, MN) for 1 h at 300 mA in transfer buffer (25 mM Tris, 190 mM glycine, 20% methanol) using a Hoefer MiniVE blotting unit. After transfer, the membrane was incubated in blocking solution (0.05% Tween 20, 5% nonfat dry milk in PBS) for 1 h at room temperature with agitation, followed by overnight incubation with primary antibody in blocking solution. Rabbit polyclonal antisera were used to detect RV M and G proteins, and actin was detected with a mouse monoclonal antibody. Incubation with horseradish peroxidase-conjugated anti-mouse and anti-rabbit immunoglobulin (Jackson Laboratories) was performed for 1 h at room temperature in blocking solution. Protein bands were visualized with the SuperSignal West Pico chemiluminescence substrate (Pierce, Rockford, IL).

Single-step growth assays. NA cell monolayers were infected at a multiplicity of infection (MOI) of 5. After 1 h of incubation at 37°C, the inoculum was removed, cells were washed twice with PBS, and the cell cultures were replenished with RPMI with 5% fetal bovine serum and incubated at 37°C. Supernatants were harvested at the indicated time points and virus titers were determined.

Virus spread assay. The virus spread assay methods have been described previously (43).

EM. Human HeLa cells were infected at an MOI of 1 with SPBN or M4A for 48 h and fixed, stained, and evaluated by electron microscopy (EM) as described previously (32, 34).

RNA purification and cDNA synthesis. RNA was isolated utilizing the Qiagen RNeasy kit (Valencia, CA) as instructed by the manufacturer. One µg of total isolated RNA was reverse transcribed by using Omniscript reverse transcriptase (Qiagen) according to the manufacturer's protocol and a gene-specific primer either for genomic SPBN RVN RNA (RP381) or for SPBN RVN mRNA (RP389) (53). The reaction mixtures were incubated for 1 h at 37°C, and the enzyme was subsequently inactivated by a 5-min step at 95°C. cDNAs were stored at –20°C.

Quantitative real-time PCR. The quantitative real-time PCR analysis methods have been described previously (53).

Animal studies. (i) Pathogenesis study. Groups of five 6- to 8-week-old C57BL/6 mice were inoculated intranasally with 7 x 10⁴ FFU in 20 µl. Mice were monitored daily for clinical changes and signs of rabies, and weights were determined. Moribund mice or mice losing more than 25% body weight were euthanized.

(ii) Immunizations. For immunization, groups of five 5- to 6-week-old female Swiss Webster mice were immunized intramuscularly (i.m.) in the gastrocnemius muscle with 1 x 10⁶ infectious virus particles in 100 µl of PBS. Mice were bled after 21 days, and sera were analyzed for virus-neutralizing antibodies.

All animal experiments were performed according to Institutional Animal Care and Use Committee-approved protocols (Animal Welfare Assurance no. A3085-01).

(iii) Immunogenicity assay. An enzyme-linked immunosorbent assay (ELISA) for RV G (32, 33) and rabies virus-neutralizing antibody titers (36) has been described previously. The virus-neutralizing antibody titers were transformed into international units using the World Health Organization's anti-rabies virus antibody standard.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Construction, recovery, and analysis of recombinant RV containing mutations in the PPEY L-domain. The PPPY motif of VSV M has been shown to be important for virus budding (26); however, a similar role for the PPEY or overlapping YxxL motif of RV M has yet to be defined. In addition, the functions of L-domains in viral pathogenicity are less well studied. Therefore, we decided to analyze the function of the PPEY domain of RV M for both RV budding and its role in RV pathogenesis. For this approach, we designed and generated a series of RV M mutants in which either the PPEY, YxxL, or both motifs were altered. For example, we introduced three mutations within ₃₅PPEY₃₈VPL₄₁ (P35S, P36A, and Y38A) and one mutation downstream of PPEY (L41A) which exchanged the L of the YxxL to an A. An additional M gene mutant containing SAEAVPA in place of PPEYVPL was constructed to compile all single mutations (Fig. 1).

View larger version (13K): [in this window] [in a new window]

FIG. 1. Construction of RVs expressing mutated M proteins. (A) The top of the figure shows the RV vector SPBN, which was used as the background for introducing mutations within the M protein. (B) The first 60 amino acids of RV M are shown; the PPEY motif is indicated in bold. (C) The PPEY motif of wild-type RV M and the introduced amino acid changes to generate the five recombinant RVs used in this study.

Previous research of the L-domain functions of other viruses indicated their importance in mediating efficient viral budding, but there have been no indications that they are essential for viral growth. Moreover, Mebatsion et al. showed that a recombinant RV without a matrix protein can be propagated in tissue culture even though it grows to very low titers. Therefore, we decided to introduce the RV M mutants directly into the M gene of the infectious RV clone pSPBN, which should enable us to perform both biochemical and pathogenicity studies. All recombinant RVs containing these mutations (pM35S, pM36A, pM38A, pM41A, and p4A) were recovered by standard methods, and the mutations were confirmed by DNA sequencing of reverse transcription-PCR products from cells infected with the respective mutant. Whereas infectious virus was easily obtained for all five recombinant RVs, we noticed that the single mutant RV M35S and the M4A mutant, which contains all four mutations, grew to much lower titers than that observed for wild-type SPBN (Fig. 2). Retarded growth was also seen for M36A and M38A but to a lesser extent than for M35S and M4A (Fig. 2).

View larger version (22K): [in this window] [in a new window]

FIG. 2. One-step growth curve for M mutants. NA cells were infected with SPBN, M35S, M36A, M38A, M41A, or M4A at an MOI of 5 FFU for 1 hour. Aliquots of tissue culture supernatants were collected, and viral titers were determined in duplicate at the indicated time points. The data presented are from one of several independent experiments performed.

Characterization of growth and recombinant PPEY mutants. The differences in growth of the viral stocks indicated that the introduced mutation within the PPEY motif did affect replication of the mutant viruses compared to that of RV SPBN. To further analyze the growth pattern of the recombinant RVs, we performed one-step growth curve analyses of M35S, M36A, M38A, M41A, and M4A on NA cells. For this approach, NA cells were infected with the six recombinant RVs at an MOI of 5, and supernatants of the infected cells were analyzed for the presence of infectious RV at 24, 48, and 72 h after infection. Our results indicated that there was a delay in virus release for all single RV M mutants (Fig. 2). Titers of the M35S mutant were dramatically reduced, whereas titers for M38A and M36A were reduced to a lesser extent compared to that of RV SPBN (Fig. 2). Interestingly, replication of recombinant M41A was only modestly affected (Fig. 2). It is interesting that at the earlier time points, such as 48 h after infection, the differences were not as pronounced as at 72 h. For example, the M36A had a titer similar to M41A at 48 h postinfection, but the final titer of M36A was consistently lower than that of M41A (Fig. 2). Although differences were not always exactly the same, production of infectious RVs over time were always in the following order: SPBN had the highest titer, followed by M41A, M38A, M36A, and M35S/M4A. These results indicate that the proline at position 35 within RV M is the most important amino acid within this motif for efficient production of infectious RV virions. Similar findings were made on BSR cells (data not shown). The M4A recombinant, which combines all four mutations of M35S, M36A, M38A, and M41A in its M protein, was similarly impaired in viral replication as M35S, indicating that there were no additive effects of the multiple mutations and also that the YxxL motif alone is likely not a functional L-domain for RV assembly and budding in this assay system.

Protein, RNA synthesis, and replication kinetics of PPEY mutant viruses. While it is clear that viral PPxY motifs are important for virus budding, we sought to determine whether mutations in the PPEY motif of RV M had additional effects on viral replication, both at the level of mRNA production and genome/antigenome amplification. Mebatsion et al. demonstrated that removal of the gene encoding RV M resulted in higher expression of the other viral proteins probably due to reduced replication (40). In addition, Finke et al. showed that changes in expression of M resulted in differences in the ratio of mRNA to genomic RNA (12, 13).

To determine whether any of the introduced mutations in RV M affected M protein synthesis, NA cells were infected at an MOI of 5, and cell extracts were prepared and analyzed by Western blotting at 35 and 48 h postinfection. We found variation in the levels of M proteins, but only at a range of two- to threefold (Fig. 3), which does not correlate with the 10- to 100-fold difference in viral titers observed for the recombinant M mutants (Fig. 2).

View larger version (79K): [in this window] [in a new window]

FIG. 3. Western blot analysis of expression of mutated M proteins from RV. NA cells were infected with SPBN, M35S, M36A, M38A, M41A, or M4A (MOI of 5) and lysed 48 h later. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to Western blotting with antibodies specific for RV G, actin, or RV M.

Based on this finding, we hypothesized that the difference in expression levels was more likely based on differences in replication than in protein stability and that mutations in or close to the PPEY motif have no major effect on the expression or stability of RV M.

We also analyzed the composition of purified virions. Our results indicated that, whereas the protein compositions were identical for all recombinant viruses, the amounts were reduced in a similar manner as observed for the infectious titers (data not shown).

Next, we analyzed the effect of the RV M mutations for mRNA and genomic RNA synthesis, as well as the production of infectious virus over time. NA cells were infected at an MOI of 5 to allow synchronous infection of all cells. At 12, 24, and 48 h postinfection, supernatants were collected and the cells were lysed. Total RNA was isolated for real-time PCR analysis of genomic and N mRNA from the respective recombinant viruses SPBN, M35S, M36A, M38A, M41A, and M4A (Fig. 4). The SPBN wild-type virus showed the typical pattern of RNA synthesis and release of infectious virions previously described (53). Initially, high levels of viral mRNA were expressed, followed by a constant increase of genomic RNA level over the first 48 h, which was paralleled by the release of increasing amounts of infectious virions into the supernatant. The same pattern of RNA synthesis and viral growth was also observed in this setting for recombinant virus M41A (Fig. 4, SPBN and M41A). However, different findings were obtained for viruses containing mutations within the PPEY motif. Whereas a similar reduction in the release of virions as detected in the one-step growth curve analysis was seen for all recombinant RVs, M35S and M4A did not show the typical switch from transcription to replication. In contrast, these recombinants produced similar levels of mRNA and genomic RNA over time, indicating that impaired budding also affects RNA synthesis. Similar findings were made for M4A, in particular a reduction in mRNA levels at early times after infection, and no significant increase in genomic RNA levels was seen during the first 48 h. However, the reduction in replication and transcription cannot explain the reduction in the amount of released virions. Indeed, recombinants M36A and M38A, which displayed similar mRNA levels compared to SPBN at early times after infection and even increased mRNA levels at later times, had clearly reduced viral titers. This became obvious for example when mRNA and genomic RNA levels of M36A and SPBN were compared and shown to be similar at 12 h postinfection while the infectious titers differed by 100-fold.

View larger version (25K): [in this window] [in a new window]

FIG. 4. RNA replication and production of infectious virions. NA cells were infected with SPBN, M35S, M36A, M38A, M41A, or M4A (MOI of 5), and cells and supernatants were collected at the indicated time points. The number of genomic RNA copies (genomic; solid line) and RV mRNA copies (messenger; dotted line) and viral titers were determined in duplicate at the indicated time points.

EM analysis of cells infected with SPBN or M4A. We next sought to use electron microscopy to determine whether PPEY mutants were more cell associated, and thus budding defective, than wild-type virus. Briefly, HeLa cells were infected at an MOI of 1.0 for 48 h, after which they were fixed and processed for negative staining. Results from these experiments showed that although some cell-associated virus was detected for wild-type-infected cells (Fig. 5A), significantly more viral particles were observed to be cell associated or membrane tethered in M4A-infected cells (Fig. 5B), providing further evidence of impaired budding of this PPEY mutant.

View larger version (118K): [in this window] [in a new window]

FIG. 5. Evaluation of wild-type RV SPBN and M mutant M4A by electron microscopy. HeLa cells were infected with SPBN (A) or M4A (B) at an MOI of 1 for 48 h. Cells were fixed at room temperature in neutral buffered 2.5% glutaraldehyde and gelled into warm agar. Cells were postfixed in 1% OsO4, dehydrated in graded ethanol-propylene oxide, and embedded in Spurr's epoxy. Thin sections were cut and stained with uranyl acetate and lead citrate and examined with a a LEO EM10 electron microscope at 60 kV. Original magnification, x52,000.

Based on the results provided above, we conclude that mutations that disrupt the PPEY motif greatly affect production of infectious virus due in part to reduced viral budding.

M mutant viruses are highly attenuated but immunogenic in mice. The findings described above identified for the first time an important role for the PPEY motif in release of infectious RV. Because the kinetics of viral spread have been shown to be an important feature for rabies virus pathogenicity, we hypothesized that the reduction in viral spread due to mutation of the PPEY motif results in attenuation of RV. In an in vitro (pilot) study, we noticed that viral spread in Vero cells, as indicated by the size of the area of infected cells, was significantly reduced for all mutated viruses except M41A (Fig. 6). Based on these results, we decided to further study the pathogenicity of these mutant viruses in a mouse model. Because the RV vector used is based on an RV vaccine strain that is apathogenic after peripheral inoculation, we used intranasal (i.n.) inoculations. Groups of five C57BL/6 8-week-old female mice were inoculated i.n. with 7.0 x 10⁴ FFU. We found that only mice infected with wild-type SPBN or the M41A mutant succumbed to infection on day 10 or 11, whereas all other mice survived (Fig. 7). There was no significant difference in pathogenicity between M41A and SPBN. Mice infected with M36A were the least affected based on weight loss during the first 20 days after infection, despite replicating to higher titers than the 35S and 4A mutants. Interestingly, the M36A virus exhibited the smallest foci in the spread assay and also caused a strong cytopathic effect (CPE) in cell culture, unlike the M35 and M4A mutants. The M38A mutant, which also caused CPE in cell culture but replicated to much higher titers than M36A and M35S, was intermediate between the M35S and M41A viruses in terms of pathogenicity. Taken together our data indicate that pathogenicity is determined by a combination of factors which includes the ability to cause CPE and not simply correlated with viral titers and budding efficiency.

View larger version (30K): [in this window] [in a new window]

FIG. 6. Spread of RV with mutated M and the wild-type RV SPBN in Vero cells. Cells were infected at an MOI of 0.01 and overlaid with semisolid agar. At the indicated times, the agar overlay was removed and the cells were fixed with 80% acetone and stained with fluorescein isothiocyanate-labeled anti-RV N antibody. Fluorescent foci were captured, and the size of each focus was calculated using Spot advanced software. Each bar represents the mean (± standard error) of results for 30 foci. Asterisks indicate significant differences (P < 0.001).

View larger version (40K): [in this window] [in a new window]

FIG. 7. Mortality (A) and weight (B) among mice infected with recombinant RVs with M mutations. Groups of five C57BL/6 8-week-old female mice were inoculated i.n. with 7.0 x 104 FFU. Weights were recorded, and animals were observed for signs of rabies daily. Moribund animals or animals losing more than 25% of their weight were euthanized.

Replication-impaired RV M mutants induce similar immune responses against RV. To analyze whether the observed attenuation affected the immunogenicity of the recombinant RVs, all mice from the four groups surviving the inoculation were bled, and seroconversion against RV was analyzed by an RV G-specific ELISA. The results indicated that there were no significant differences in RV G-specific immune responses in mice inoculated with M35S, M36A, M38A, or M4A, and thus the attenuation phenotype did not affect immunogenicity (Fig. 8). Since it was also of interest to determine whether such a highly attenuated virus might serve as a better vaccine than the currently used strain, SAD B19 (SPBN is a strain derived from SAD B19 [5, 47, 49]), we decided to compare SPBN and M4A in mice after i.m. inoculation. The rationale to use M4A was based on the fact that this recombinant virus would need at least four nucleotides exchanged to convert back to wild-type or pathogenic M. Furthermore, M4A was also the most attenuated RV. Because i.n. inoculation is lethal for SPBN, we chose the i.m. route for this analysis. Two groups of five BALB/c mice each were inoculated i.m. with 1 x 10⁵ FFU of SPBN or M4A. Four weeks later, neutralizing antibodies against RV were determined. The results showed that on average, 120 IU were detected for SPBN compared to 105 IU for M4A; these levels were not significantly different statistically and were well above the antibody titer of 0.5 IU which is considered to be protective for rabies infection.

View larger version (49K): [in this window] [in a new window]

FIG. 8. RV G-specific immune responses. Surviving mice infected with M4A, M35S, M36A, or M38A were bled 30 days after i.n. infection, and sera from single mice from each group were analyzed for ELISA reactivity against RV G in serial dilutions of 1:50, 1:150, 1:450, and 1:1350. OD, optical density.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Budding and assembly of virions is a key process in the viral life cycle and therefore important for our understanding of basic molecular virology and also for the development of novel vaccines and antiviral therapeutics. Much progress has been made in identifying so-called late-budding domains (L-domains) for enveloped viruses, which are mostly located in viral matrix proteins (for review, see reference 1). However, the presence and function of such domains have not been studied directly for RV.

Here we performed a site-directed mutagenesis study of the PPEY (PPxY) motif and the overlapping YVPL (YxxL) motif in RV M. We demonstrated that the exchange of the first proline within PPEY results in the most dramatic reduction of viral titers, with P36 and Y38 playing less important roles for producing high viral titers. Our results are similar overall to those observed with alanine scanning within the PPPY motif of VSV; however, the first proline of RV PPEY appears to be most important for efficient budding, whereas the tyrosine of the VSV PPPY motif appears to be most critical for efficient budding of VSV (26). One possible explanation for this observation could lie in the fact that mammalian cells express several members of the HECT family of ubiquitin ligases, many of which are able to bind to PPxY motifs (28).

HECT ubiquitin ligases link viral and cellular PPXY motifs to the vacuolar protein-sorting pathway. RV and VSV could thus preferentially recruit different members of the HECT family of ubiquitin ligase. In keeping with this argument, it is important to note that in our study we used NA cells, whereas for VSV BHK cells were used, which could differ in the expression level of host factors that bind to the PPXY motif. Although we have not verified experimentally that the PPEY motif recruits ubiquitin ligases or other host proteins, our data clearly show that it is the main if not sole late domain motif in RV M, as budding of RV PPxY mutants was reduced to 10% or less compared to that of the wild type, while the budding efficiency of VSV was reduced to about 15% to 20% of wild type (26). In addition, we also demonstrated an increase in cell-associated virions by EM for M4A, further indicating that the PPEY motif has typical L-domain activity and plays an important role in virus budding. However, very similar to VSV, some mutants showed the most dramatic reduction at the earlier time points, indicating an advantage of efficient budding at early times postinfection (26).

We observed some impact of the PPEY mutants on production of genomic RNA and mRNA. While these changes cannot explain the magnitude of the observed decrease in viral titers, there were clearly some effects on viral RNA production. Of note, the PPxY motif (positions 35 to 38) is different than the arginine previously identified by Finke et al. at position 58, which is important for the switch from transcription to replication (12, 13). Considering that M is important for the switch from transcription to replication, the inefficient release of virions from the cell most likely results in a difference in intracellular levels of viral proteins, which may contribute to the observed changes in RNA levels. Previously, similar changes were seen for RVs where a G and/or M protein from a heterologous RV strain with only modest sequence conservation was introduced; this resulted in decreased budding efficiency and changes in viral RNA synthesis (43). It would be interesting to analyze RNA production for the VSV PPPY mutants in a similar system to the one used here for RV.

Along with the similarities between RV and VSV regarding L-domains, there are also distinct differences. For example, VSV contains a PSAP motif downstream of PPPY which is not present in RV (16, 23), whereas RV harbors an ASAP motif upstream of the PPEY motif. While the RV ASAP motif differs from the canonical PT/SAP late domain motif, structural and mutational studies have confirmed that the binding pocket of Tsg101 that binds to the first proline residue can accommodate small residues like alanine with only minor reductions in overall binding affinity (18, 41, 56). However, this motif is only partially conserved between different rabies virus strains and in some strains carries large amino acids like methionine in place of alanine. The ASAP in RV M is therefore unlikely to function as an L-domain, although this needs to be confirmed experimentally.

In addition, RV M contains a YVPL motif similar to the YxxL motif found in several other viruses, such as retroviruses, paramyxoviruses, and poxviruses (3, 17, 24, 29, 30, 42). Of note, the YVPL motif is organized in an overlapping fashion with PPEY as PPEYVPL, similar to the two overlapping L-domains identified in Ebola virus VP40 PTAP and PPEY (PTAPPEY) (15). However, the data provided in this study suggest that the PPEY motif, but not the YxxL motif, possesses L-domain function for RV in the cell types tested. Of note, the tyrosine-to-alanine exchange did significantly reduce the RV titers, but this is likely due to disruption of the PPEY motif rather than disruption of the YxxL motif. Indeed, results from this investigation show that the L-to-A mutation of YxxL in RV M41 had no major effect on viral budding. However, a possible role for YVPL in rabies virus budding or pathogenesis in other cell types cannot be ruled out completely. It is interesting that the overlapping L-domains of Ebola virus VP40 when inserted into the M protein of VSV resulted in a 10-fold increase in virus-like particle production compared to that of WT VSV M, but a similar 10-fold increase was not observed in BHK-21 cells infected with VSV expressing the Ebola L-domains (22).

Interestingly, although infection with the RV strain SPBN is not cytolytic, two of the PPEY mutants caused a cytopathic phenotype following infection of NA cells. The cytopathic phenotype was more pronounced for the M36A recombinant than that induced by the M38A recombinant. All other recombinant M mutants were noncytopathic, including M4A, which might indicate that the ratio of M to G is important for cytopathology. It has been shown previously that an increase in RV G results in apoptosis (7, 10), and the result would suggest that RV M might be antiapoptotic. This would be in contrast to VSV, where M has been shown to be proapoptotic and mutations within the PPPY late domain lead to a reduction of CPE (26).

The role of L-domains in viral pathogenesis has not been well studied. To our knowledge, only one study of the VSV M PSAP domain has been performed (20). However, the PSAP region of VSV M does not possess similar L-domain activity as that observed for PPPY in BHK-21 cells. Therefore, the detected attenuation of PSAP mutants in mice may be based more on the unexpected finding that PSAP mutants showed a less cytopathic phenotype, reduced levels of activated caspase-3, and enhanced production of beta interferon (20). Consequently, we analyzed pathogenicity and immunogenicity of the recombinant RV M mutants after i.n. inoculations in mice. The i.n. route was utilized because SPBN is not pathogenic after i.m. inoculation. In this setting, all mice infected with SPBN and M41A succumbed to the infection, whereas the other four groups of mice survived. Differences in pathogenicity are indicated by the weight curves (Fig. 7B). The only similarity among all four of the viruses that did not kill the animals was a clear reduction in the kinetics of viral spread (Fig. 6). Viral spread has been described previously as a key feature of RV pathogenicity both at the level of RV entry and replication rate. In the case of RV, it has been shown in different settings that fast and efficient spread of virions is essential for RV pathogenesis and for the virus to complete the viral life cycle before it is detected and cleared by the host response (8, 11, 43, 53).

Lastly, we compared the immunogenicity induced by the most attenuated PPEY mutant (M4A) and the most pathogenic strain (WT SPBN) in mice. Our results indicated that M4A was as immunogenic as SPBN, further supporting the finding that RV immunogenicity was not affected by the introduction of attenuating mutations (33). Of note, the induction of more than 100 IU, which indicates 200-fold-higher virus-neutralizing antibody than that considered protective by WHO, shows the great potential of such modified vehicles for further studies of RV vectors as vaccines for other infectious diseases (9, 31, 32, 35-37, 50, 52).

 
This work was supported by a Center for Neuroanatomy and Neurotropic Viruses grant to Peter Strick, Center for Neuroscience, University of Pittsburgh (USPHS-NCRR P40RR018604, subcontract to M.J.S.) and NIAID NIH grant AI46499 to R.N.H.

 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Thomas Jefferson University, 531 BLSB, 233 South 10th St., Philadelphia, PA 19107. Phone: (215) 503-4634. Fax: (215) 503-5393. E-mail for M. Schnell: Matthias.schnell{at}jefferson.edu. E-mail for R. Harty: rharty{at}vet.upenn.edu

Published ahead of print on 30 July 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Chen, B. J., and R. A. Lamb. 2008. Mechanisms for enveloped virus budding: can some viruses do without an ESCRT? Virology 372:221-232.[Medline]
2
2. Chong, L. D., and J. K. Rose. 1993. Membrane association of functional vesicular stomatitis virus matrix protein in vivo. J. Virol. 67:407-414.[Abstract/Free Full Text]
3
3. Ciancanelli, M. J., and C. F. Basler. 2006. Mutation of YMYL in the Nipah virus matrix protein abrogates budding and alters subcellular localization. J. Virol. 80:12070-12078.[Abstract/Free Full Text]
4
4. Conzelmann, K. K. 2004. Reverse genetics of mononegavirales. Curr. Top. Microbiol. Immunol. 283:1-41.[Medline]
5
5. Conzelmann, K. K., J. H. Cox, L. G. Schneider, and H. J. Thiel. 1990. Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology 175:485-499.[CrossRef][Medline]
6
6. Craven, R. C., R. N. Harty, J. Paragas, P. Palese, and J. W. Wills. 1999. Late domain function identified in the vesicular stomatitis virus M protein by use of rhabdovirus-retrovirus chimeras. J. Virol. 73:3359-3365.[Abstract/Free Full Text]
7
7. Dietzschold, M. L., M. Faber, J. A. Mattis, K. Y. Pak, M. J. Schnell, and B. Dietzschold. 2004. In vitro growth and stability of recombinant rabies viruses designed for vaccination of wildlife. Vaccine 23:518-524.[CrossRef][Medline]
8
8. Faber, M., M. L. Faber, A. Papaneri, M. Bette, E. Weihe, B. Dietzschold, and M. J. Schnell. 2005. A single amino acid change in rabies virus glycoprotein increases virus spread and enhances virus pathogenicity. J. Virol. 79:14141-14148.[Abstract/Free Full Text]
9
9. Faber, M., E. W. Lamirande, A. Roberts, A. B. Rice, H. Koprowski, B. Dietzschold, and M. J. Schnell. 2005. A single immunization with a rhabdovirus-based vector expressing severe acute respiratory syndrome coronavirus (SARS-CoV) S protein results in the production of high levels of SARS-CoV-neutralizing antibodies. J. Gen. Virol. 86:1435-1440.[Abstract/Free Full Text]
10
10. Faber, M., R. Pulmanausahakul, S. S. Hodawadekar, S. Spitsin, J. P. McGettigan, M. J. Schnell, and B. Dietzschold. 2002. Overexpression of the rabies virus glycoprotein results in enhancement of apoptosis and antiviral immune response. J. Virol. 76:3374-3381.[Abstract/Free Full Text]
11
11. Faber, M., R. Pulmanausahakul, K. Nagao, M. Prosniak, A. B. Rice, H. Koprowski, M. J. Schnell, and B. Dietzschold. 2004. Identification of viral genomic elements responsible for rabies virus neuroinvasiveness. Proc. Natl. Acad. Sci. USA 101:16328-16332.[Abstract/Free Full Text]
12
12. Finke, S., and K. K. Conzelmann. 2003. Dissociation of rabies virus matrix protein functions in regulation of viral RNA synthesis and virus assembly. J. Virol. 77:12074-12082.[Abstract/Free Full Text]
13
13. Finke, S., R. Mueller-Waldeck, and K. K. Conzelmann. 2003. Rabies virus matrix protein regulates the balance of virus transcription and replication. J. Gen. Virol. 84:1613-1621.[Abstract/Free Full Text]
14
14. Gottlinger, H. G., T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1991. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proc. Natl. Acad. Sci. USA 88:3195-3199.[Abstract/Free Full Text]
15
15. Harty, R. N., M. E. Brown, G. Wang, J. Huibregtse, and F. P. Hayes. 2000. A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding. Proc. Natl. Acad. Sci. USA 97:13871-13876.[Abstract/Free Full Text]
16
16. Harty, R. N., J. Paragas, M. Sudol, and P. Palese. 1999. A proline-rich motif within the matrix protein of vesicular stomatitis virus and rabies virus interacts with WW domains of cellular proteins: implications for viral budding. J. Virol. 73:2921-2929.[Abstract/Free Full Text]
17
17. Honeychurch, K. M., G. Yang, R. Jordan, and D. E. Hruby. 2007. The vaccinia virus F13L YPPL motif is required for efficient release of extracellular enveloped virus. J. Virol. 81:7310-7315.[Abstract/Free Full Text]
18
18. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed. 1995. p6^Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. J. Virol. 69:6810-6818.[Abstract]
19
19. ICTVdB Management. 2006. Rhabdoviridae. In C. Büchen-Osmond (ed.), The Universal Virus Database, version 3. Columbia University, New York, NY. http://www.ncbi.nlm.nih.gov/ICTVdB.
20
20. Irie, T., E. Carnero, A. Okumura, A. Garcia-Sastre, and R. N. Harty. 2007. Modifications of the PSAP region of the matrix protein lead to attenuation of vesicular stomatitis virus in vitro and in vivo. J. Gen. Virol. 88:2559-2567.[Abstract/Free Full Text]
21
21. Irie, T., and R. N. Harty. 2005. L-domain flanking sequences are important for host interactions and efficient budding of vesicular stomatitis virus recombinants. J. Virol. 79:12617-12622.[Abstract/Free Full Text]
22
22. Irie, T., J. M. Licata, and R. N. Harty. 2005. Functional characterization of Ebola virus L-domains using VSV recombinants. Virology 336:291-298.[CrossRef][Medline]
23
23. Irie, T., J. M. Licata, J. P. McGettigan, M. J. Schnell, and R. N. Harty. 2004. Budding of PPxY-containing rhabdoviruses is not dependent on host proteins TGS101 and VPS4A. J. Virol. 78:2657-2665.[Abstract/Free Full Text]
24
24. Irie, T., Y. Shimazu, T. Yoshida, and T. Sakaguchi. 2007. The YLDL sequence within Sendai virus M protein is critical for budding of virus-like particles and interacts with Alix/AIP1 independently of C protein. J. Virol. 81:2263-2273.[Abstract/Free Full Text]
25
25. Jayakar, H. R., E. Jeetendra, and M. A. Whitt. 2004. Rhabdovirus assembly and budding. Virus Res. 106:117-132.[CrossRef][Medline]
26
26. Jayakar, H. R., K. G. Murti, and M. A. Whitt. 2000. Mutations in the PPPY motif of vesicular stomatitis virus matrix protein reduce virus budding by inhibiting a late step in virion release. J. Virol. 74:9818-9827.[Abstract/Free Full Text]
27
27. Li, C. C., F. W. Ruscetti, N. R. Rice, E. Chen, N. S. Yang, J. Mikovits, and D. L. Longo. 1993. Differential expression of Rel family members in human T-cell leukemia virus type I-infected cells: transcriptional activation of c-rel by Tax protein. J. Virol. 67:4205-4213.[Abstract/Free Full Text]
28
28. Martin-Serrano, J., S. W. Eastman, W. Chung, and P. D. Bieniasz. 2005. HECT ubiquitin ligases link viral and cellular PPXY motifs to the vacuolar protein-sorting pathway. J. Cell Biol. 168:89-101.[Abstract/Free Full Text]
29
29. Martin-Serrano, J., A. Yarovoy, D. Perez-Caballero, and P. D. Bieniasz. 2003. Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins. Proc. Natl. Acad. Sci. USA 100:12414-12419.[Abstract/Free Full Text]
30
30. Martin-Serrano, J., T. Zang, and P. D. Bieniasz. 2003. Role of ESCRT-I in retroviral budding. J. Virol. 77:4794-4804.[Abstract/Free Full Text]
31
31. McGettigan, J. P., M. L. Koser, P. M. McKenna, M. E. Smith, J. M. Marvin, L. C. Eisenlohr, B. Dietzschold, and M. J. Schnell. 2006. Enhanced humoral HIV-1-specific immune responses generated from recombinant rhabdoviral-based vaccine vectors co-expressing HIV-1 proteins and IL-2. Virology 344:363-377.[CrossRef][Medline]
32
32. McGettigan, J. P., K. Naper, J. Orenstein, M. Koser, P. M. McKenna, and M. J. Schnell. 2003. Functional human immunodeficiency virus type 1 (HIV-1) Gag-Pol or HIV-1 Gag-Pol and env expressed from a single rhabdovirus-based vaccine vector genome. J. Virol. 77:10889-10899.[Abstract/Free Full Text]
33
33. McGettigan, J. P., R. J. Pomerantz, C. A. Siler, P. M. McKenna, H. D. Foley, B. Dietzschold, and M. J. Schnell. 2003. Second-generation rabies virus-based vaccine vectors expressing human immunodeficiency virus type 1 Gag have greatly reduced pathogenicity but are highly immunogenic. J. Virol. 77:237-244.[CrossRef][Medline]
34
34. McGettigan, J. P., S. Sarma, J. M. Orenstein, R. J. Pomerantz, and M. J. Schnell. 2001. Expression and immunogenicity of human immunodeficiency virus type 1 Gag expressed by a replication-competent rhabdovirus-based vaccine vector. J. Virol. 75:8724-8732.[Abstract/Free Full Text]
35
35. McKenna, P. M., P. P. Aye, B. Dietzschold, D. C. Montefiori, L. N. Martin, P. A. Marx, R. J. Pomerantz, A. Lackner, and M. J. Schnell. 2004. Immunogenicity study of glycoprotein-deficient rabies virus expressing simian/human immunodeficiency virus SHIV89.6P envelope in a rhesus macaque. J. Virol. 78:13455-13459.[Abstract/Free Full Text]
36
36. McKenna, P. M., M. L. Koser, K. R. Carlson, D. C. Montefiori, N. L. Letvin, A. B. Papaneri, R. J. Pomerantz, B. Dietzschold, P. Silvera, J. P. McGettigan, and M. J. Schnell. 2007. Highly attenuated rabies virus-based vaccine vectors expressing simian-human immunodeficiency virus 89.6P Env and simian immunodeficiency virus mac239 Gag are safe in rhesus macaques and protect from an AIDS-like disease. J. Infect. Dis. 195:980-988.[CrossRef][Medline]
37
37. McKenna, P. M., J. P. McGettigan, R. J. Pomerantz, B. Dietzschold, and M. J. Schnell. 2003. Recombinant rhabdoviruses as potential vaccines for HIV-1 and other diseases. Curr. HIV Res. 1:229-237.[CrossRef][Medline]
38
38. Mebatsion, T., S. Finke, F. Weiland, and K. K. Conzelmann. 1997. A CXCR4/CD4 pseudotype rhabdovirus that selectively infects HIV-1 envelope protein-expressing cells. Cell 90:841-847.[CrossRef][Medline]
39
39. Mebatsion, T., M. Konig, and K. K. Conzelmann. 1996. Budding of rabies virus particles in the absence of the spike glycoprotein. Cell 84:941-951.[CrossRef][Medline]
40
40. Mebatsion, T., F. Weiland, and K. K. Conzelmann. 1999. Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. J. Virol. 73:242-250.[Abstract/Free Full Text]
41
41. Pornillos, O., S. L. Alam, D. R. Davis, and W. I. Sundquist. 2002. Structure of the Tsg101 UEV domain in complex with the PTAP motif of the HIV-1 p6 protein. Nat. Struct. Biol. 9:812-817.[Medline]
42
42. Puffer, B. A., L. J. Parent, J. W. Wills, and R. C. Montelaro. 1997. Equine infectious anemia virus utilizes a YXXL motif within the late assembly domain of the Gag p9 protein. J. Virol. 71:6541-6546.[Abstract]
43
43. Pulmanausahakul, R., J. Li, M. J. Schnell, and B. Dietzschold. 2008. The glycoprotein and the matrix protein of rabies virus affect pathogenicity by regulating viral replication and facilitating cell-to-cell spread. J. Virol. 82:2330-2338.[Abstract/Free Full Text]
44
44. Robison, C. S., and M. A. Whitt. 2000. The membrane-proximal stem region of vesicular stomatitis virus G protein confers efficient virus assembly. J. Virol. 74:2239-2246.[Abstract/Free Full Text]
45
45. Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379.[CrossRef][Medline]
46
46. Schnell, M. J., L. Buonocore, E. Boritz, H. P. Ghosh, R. Chernish, and J. K. Rose. 1998. Requirement for a non-specific glycoprotein cytoplasmic domain sequence to drive efficient budding of vesicular stomatitis virus. EMBO J. 17:1289-1296.[CrossRef][Medline]
47
47. Schnell, M. J., H. D. Foley, C. A. Siler, J. P. McGettigan, B. Dietzschold, and R. J. Pomerantz. 2000. Recombinant rabies virus as potential live-viral vaccines for HIV-1. Proc. Natl. Acad. Sci. USA 97:3544-3549.[Abstract/Free Full Text]
48
48. Schnell, M. J., J. E. Johnson, L. Buonocore, and J. K. Rose. 1997. Construction of a novel virus that targets HIV-1-infected cells and controls HIV-1 infection. Cell 90:849-857.[CrossRef][Medline]
49
49. Schnell, M. J., T. Mebatsion, and K. K. Conzelmann. 1994. Infectious rabies virus from cloned cDNA. EMBO J. 13:4195-4203.[Medline]
50
50. Siler, C. A., J. P. McGettigan, B. Dietzschold, S. K. Herrine, J. Dubuisson, R. J. Pomerantz, and M. J. Schnell. 2002. Live and killed rhabdovirus-based vectors as potential hepatitis C vaccines. Virology 292:24-34.[CrossRef][Medline]
51
51. Takada, A., C. Robison, H. Goto, A. Sanchez, K. G. Murti, M. A. Whitt, and Y. Kawaoka. 1997. A system for functional analysis of Ebola virus glycoprotein. Proc. Natl. Acad. Sci. USA 94:14764-14769.[Abstract/Free Full Text]
52
52. Tan, G. S., P. M. McKenna, M. L. Koser, R. McLinden, J. H. Kim, J. P. McGettigan, and M. J. Schnell. 2005. Strong cellular and humoral anti-HIV Env immune responses induced by a heterologous rhabdoviral prime-boost approach. Virology 331:82-93.[CrossRef][Medline]
53
53. Tan, G. S., M. A. Preuss, J. C. Williams, and M. J. Schnell. 2007. The dynein light chain 8 binding motif of rabies virus phosphoprotein promotes efficient viral transcription. Proc. Natl. Acad. Sci. USA 104:7229-7234.[Abstract/Free Full Text]
54
54. Wagner, R. R., and J. K. Rose. 1996. Rhabdoviridae: the viruses and their replication, p. 1121-1136. In B. N. Fields and D. M. Knipe (ed.), Fields virology, 3rd ed., vol. 1. Lippincott-Raven, New York, NY.
55
55. Wills, J. W., C. E. Cameron, C. B. Wilson, Y. Xiang, R. P. Bennett, and J. Leis. 1994. An assembly domain of the Rous sarcoma virus Gag protein required late in budding. J. Virol. 68:6605-6618.[Abstract/Free Full Text]
56
56. Wirblich, C., B. Bhattacharya, and P. Roy. 2006. Nonstructural protein 3 of bluetongue virus assists virus release by recruiting ESCRT-I protein Tsg101. J. Virol. 80:460-473.[Abstract/Free Full Text]

---

Journal of Virology, October 2008, p. 9730-9738, Vol. 82, No. 19
0022-538X/08/$08.00+0     doi:10.1128/JVI.00889-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Wirblich, C. Articles by Schnell, M. J. Search for Related Content PubMed PubMed Citation Articles by Wirblich, C. Articles by Schnell, M. J.