This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tungteakkhun, S. S.
Right arrow Articles by Duerksen-Hughes, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tungteakkhun, S. S.
Right arrow Articles by Duerksen-Hughes, P. J.

 Previous Article  |  Next Article 

Journal of Virology, October 2008, p. 9600-9614, Vol. 82, No. 19
0022-538X/08/$08.00+0     doi:10.1128/JVI.00538-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

The Interaction between Human Papillomavirus Type 16 and FADD Is Mediated by a Novel E6 Binding Domain{triangledown}

Sandy S. Tungteakkhun, Maria Filippova, Jonathan W. Neidigh, Nadja Fodor, and Penelope J. Duerksen-Hughes*

Department of Basic Sciences, Loma Linda University School of Medicine, Loma Linda, California 92354

Received 11 March 2008/ Accepted 2 July 2008


arrow
ABSTRACT
 
High-risk strains of human papillomavirus, such as types 16 and 18, have been etiologically linked to cervical cancer. Most cervical cancer tissues are positive for both the E6 and E7 oncoproteins, since it is their cooperation that results in successful transformation and immortalization of infected cells. We have reported that E6 binds to tumor necrosis factor receptor 1 and to Fas-associated death domain (FADD) and, in doing so, prevents E6-expressing cells from responding to apoptotic stimuli. The binding site of E6 to FADD localizes to the first 23 amino acids of FADD and has now been further characterized by the use of deletion and site-directed mutants of FADD in pull-down and functional assays. The results from these experiments revealed that mutations of serine 16, serine 18, and leucine 20 obstruct FADD binding to E6, suggesting that these residues are part of the E6 binding domain on FADD. Because FADD does not contain the two previously identified E6 binding motifs, the Lxx{phi}Lsh motif, and the PDZ motif, a novel binding domain for E6 has been identified on FADD. Furthermore, peptides that correspond to this region can block E6/FADD binding in vitro and can resensitize E6-expressing cells to apoptotic stimuli in vivo. These results demonstrate the existence of a novel E6 binding domain.


arrow
INTRODUCTION
 
Human papillomaviruses (HPVs) are small, double-stranded DNA viruses that preferentially infect epithelial tissues of the genital tract, hands, and feet (25, 42). The high-risk strains, in particular types 16 and 18, are closely associated with most incidences of cervical cancer, currently the second most common cancer and the fifth leading cause of cancer-related deaths among women worldwide (8, 38). High-risk strains are present in greater than 90% of cervical cancer cases (over half of these cases being positive for HPV-16) and have also been implicated in head and neck squamous cell carcinomas (16, 28). Specifically, HPVs have been found in ca. 20% of cancers associated with the oropharynx (31). Low-risk strains, such as HPV-6 and HPV-11, however, cause genital warts and do not lead to malignancy (43, 44).

In most cases of cervical carcinoma, the integration of viral DNA into the host genome precedes transformation of the cell and is frequently accompanied by overexpression of the oncoproteins E6 and E7. Together, these two proteins are responsible for the deregulation of the cell cycle, due in part to interactions with the tumor suppressor proteins p53 and pRb, leading to their inactivation (4). E6 is best known for its ability to associate with the cellular protein E6AP, which together with E6 is responsible for directing the degradation of p53 (15). This ability of E6 is essential for ensuring cellular survival and for promoting viral propagation. In addition to p53, it is now known that E6 interacts with a wide array of other cellular proteins (reviewed in references 36 and 59). Previously, we reported that the oncoprotein interacts with key regulators of the apoptotic pathway, including tumor necrosis factor receptor 1 (TNFR1) (22), the adaptor molecule Fas-associated death domain (FADD) (21), and procaspase 8 (31). More specifically, E6 binds to the C terminus of TNFR1 and to the N terminus of the death effector domains (DEDs) of FADD and procaspase 8.

The extrinsic pathway of apoptosis is initiated by binding of a ligand such as tumor necrosis factor alpha (TNF-{alpha}) or Fas-L to its respective cell surface receptor (reviewed in references 11 and 60), giving rise to formation of the death-inducing signaling complex. Signal propagation then proceeds with recruitment of the adaptor protein FADD to the signaling complex via engagement between the death domains of Fas and FADD. Procaspase 8 then binds to FADD via DED engagement between the two proteins. In the presence of E6, however, we have shown that FADD and caspase 8 are unable to continue to transmit the apoptotic signal because of the dose-dependent, E6-mediated acceleration of their degradation (21, 27). These associations inhibit the propagation of apoptosis and allow the virus to avoid clearance by the host immune response.

There are two known binding domains to which E6 preferentially binds when interacting with its protein partners. E6 is reported to bind to a sequence characterized by Lxx{phi}Lsh in which "x" represents any amino acid, "{phi}" is a hydrophobic residue, "s" is an amino acid with a small side chain, and "h" is an amino acid that can make multiple hydrogen bonding interactions with its side chain (3, 18, 37, 55). Proteins that contain this motif include the E6 binding partners E6AP, E6BP, and tuberin. In addition, binding of E6 to proteins such as hDlg, hScrib, and MAGI-1 is mediated by their PDZ domains (24, 34). Therefore, to date, two E6-binding motifs have been identified. Interestingly, both of these motifs are absent from the sequence of FADD DED, although these two proteins do indeed interact in both an in vitro and an in vivo system (21). This suggests the existence of an additional binding motif for E6.

In the present study, we sought to identify the residues of FADD that are required for E6 binding and, in doing so, have identified a novel E6 binding domain. We also explored the possibility of using peptides to inhibit the interaction between E6 and its target protein. We found that peptide inhibitors designed to mimic the hypothesized E6 binding domain successfully abrogated E6 binding to FADD DED in vitro and that overexpressing this domain in cells restored the normal cellular response to apoptotic signals. Our findings lend further support to current literature regarding the feasibility of using peptides to obstruct protein-protein interactions and also contribute to the list of potential agents that can be used for the design of therapeutic approaches for cervical cancer.


arrow
MATERIALS AND METHODS
 
Reagents. Working stocks of monoclonal antibodies directed against Fas (clone CH-11; Medical and Biological Laboratories Co., Ltd. [Nagoya, Japan]), monoclonal antibodies directed against β-actin (Sigma) and HA (Roche Applied Science), peroxidase-coupled monoclonal antibodies against glutathione S-transferase (GST), peroxidase-coupled anti-rabbit polyclonal antibodies (Santa Cruz Biotechnology), and rabbit polyclonal antibodies against FADD (Santa Cruz Biotechnology) were used as previously reported (28). Cycloheximide (Sigma, St. Louis, MO), doxycycline (Clontech, Palo Alto, CA), and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT; Sigma) were prepared as previously reported (28). Z-DEVD-FMK (Medical and Biological Laboratories Co., Ltd. [Nagoya, Japan]) was dissolved in dimethyl sulfoxide to yield a 100 µM stock.

Cell culture. U2OS cells derived from a human osteosarcoma were obtained from the American Type Culture Collection (Manassas, VA) and cultured in McCoy's 5A medium (Invitrogen, Carlsbad, CA) supplemented to contain 10% fetal bovine serum (Invitrogen), penicillin (100 U/ml), and streptomycin (100 µg/ml) (Sigma). Cells were passaged and used at ca. 80% confluence. SiHa cells derived from human cervical squamous cell carcinoma were obtained from the American Type Culture Collection (Manassas, VA) and cultured in Eagle minimal essential medium (Invitrogen, Carlsbad, CA), supplemented as described for the maintenance of U2OS cells.

Plasmids. The pHA-E6 S and pHA-E6 AS plasmids have been described previously (22) and, respectively, contain either the sense or the antisense versions of epitope-tagged E6 (HA-E6) under the control of the cytomegalovirus promoter. The following plasmids were obtained from and described in the Tet-off kit from Clontech: the pTet-off plasmid, coding for tTA (tet activator); pTK-Hyg, coding for hygromycin resistance; and pTRE2, the cloning plasmid. pTRE HA-E6 was obtained by cloning the HindIII blunt-end BamHI fragment into the EcoRI blunt-end BamHI sites of the pTRE2 vector.

Carl Ware (La Jolla Institute for Allergy and Immunology, La Jolla, CA) kindly provided the pcDNA3-FADD plasmid (in the present study, this plasmid is referred to as pcDNA FADD), which served as the basis for all of our additional FADD-expressing constructs.

To express caspase 8 in the pAD plasmid (Stratagene) for use in the mammalian two-hybrid assay, the caspase 8 DED sequence was obtained from cDNA prepared from U2OS cells by PCR amplification using the primers 5'-ACTTCAGCAGAAATCTTTATGATATTGGGGAAC-3' and 5'-GAGATTGTCATTACCCCACACA-3' and was cloned in-frame with the activation domain of the pAD plasmid. To express FADD and its variants in the pBD plasmid (Stratagene) for use in the mammalian two-hybrid assay, the appropriate region of FADD was cloned in-frame with the binding domain of the pBD plasmid.

To express FADD and its variants in the Escherichia coli system for subsequent protein purification, the EcoRI-XhoI fragment from pM-FADD, coding for FADD, was cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-XhoI sites in the multiple cloning site to produce the plasmid pHis-FADD. Production of the D1 construct (lacking amino acids 23 to 62) and the D2 construct (lacking amino acids 1 to 79) has been previously described (21). The point mutations in the SELT, SSLS, SLT2, SLT3, and SLT4 constructs were created based on D1 by using a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocol. The following primer pairs were used to create the FADD DED mutant constructs: 5'-GTGTCGTCCAGCCTGTCGAGCGGCCAGACGGTCGAGCTCCTGCGC-3' and 5'-GCGCAGGAGCTCGACCGTCTGGCCGCTCGACAGGCTGGACGACAC-3' for the SELT mutations, 5'-CTGCACTCGGTGGCGTCCGGCACGGCGAGCAGCGAGCTGACC-3' and 5'-GGTCAGCTCGCTGCTCGCCGTGCCGGACGCCACCGAGTGCAG-3' for the SSLS mutations, 5'-CACTCGGTGTCGTCCGGCCTGGCGAGCGGCGAGGCGGTCGAGCTCCTGCGCGAGCTG-3' and 5'- CAGCTCGCGCAGGAGCTGGACCGCCTCGCCGCTCGCCAGGCCGGACGACACCGAGTG-3' for the SLT2 mutations, 5'-TCGGTGTCGTCCAGCCTGTCGAGCACCGAGGTCAGCGAGCTCCTGCGCGAGCTG-3' and 5'-CAGCTCGCGCAGGAGCTCGCTGACCTCGGTGCTCGACAGGCTGGAC GACACCGA-3' for the SLT3 mutations, and 5'- TCGGTGTCGTCCAGCCTGACCAGCACCGAGGTCACCGAGCTCCTGCGCGAGCTG-3' and 5'-CAGCTCGCGCAGGAGCTCGGTGACCTCGGTGCTGGTCAGGCTGGACGA CACCGA-3' for the SLT4 mutations.

To express the N-terminal region of FADD DED implicated in E6 binding in cells, the SacI-XbaI region was removed from pcDNA3-FADD.

To express His-tagged E6AP in E. coli for subsequent protein purification, EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496) necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). This fragment was subsequently cloned in-frame with the His6 epitope of pTriEx-4 (Novagen) by using the SmaI-PvuII sites in the multiple cloning site to produce the plasmid pHis-E6AP.

To express GST-tagged E6 in E. coli for subsequent protein purification, we created a plasmid coding for the fusion protein GST-E6 by cloning E6 (EcL136II-EcoRI blunt-end fragment) into the SmaI site of pGEX-2T (Amersham Biosciences).

Transfections. FuGENE VI (Roche Applied Science) was used to transfect all cells except SiHa, which were transfected with FuGENE HD (Roche Applied Science), as directed by the manufacturer and as described previously (28).

Immunoblotting and immunoprecipitation. To prepare cell lysates for immunoblot, cells (5 x 105) were lysed in 100 µl of lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 5% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride) for 10 min on ice. One tablet of protease inhibitor mixture (Roche Applied Science) was added per 10 ml of lysis buffer just prior to use. The protein concentration in cleared lysates was measured by using the Bio-Rad DC protein assay (Bio-Rad).

Lysates (40 µg of total protein/lane) were then subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-12% PAGE) and transferred to Immobilon P membranes (Millipore Corp.). Membranes were subsequently blocked in 5% milk, followed by application of primary and secondary antibodies in Tris-buffered saline-Tween 20 (TBST) solution. Proteins were detected by applying the chemiluminescent SuperSignal West Femto or Pico Maximum Sensitivity substrate (Pierce).

To prepare cell lysates for immunoprecipitation, cells (5 x 105) were lysed in 200 µl of radioimmunoprecipitation assay buffer (25 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.1% SDS, one tablet of protease inhibitor mixture per 10 ml of lysis buffer). Lysates were then incubated with 4 µg of polyclonal antibodies against FADD (Santa Cruz Biotechnology) for 1 h at 4°C on a rotator. Then, 50 µl (per sample) of protein G-agarose (Roche Applied Science), which had been previously blocked in 1% bovine serum albumin in TBST for 1 h at 4°C on a rotator, was then added to the cell lysate-antibody mixture, followed by incubation for an additional 1 h. The precipitated complex was then subjected to immunoblotting and probed with the appropriate antibodies.

Treatment of cells with anti-Fas and cycloheximide. To measure cell survival following anti-Fas treatment, U2OS cells (1 x 104 cells/well) or SiHa cells (2 x 104 cells/well) were seeded into 96-well plates and allowed to adhere overnight. Anti-Fas (50 ng/ml) was then added in the presence of cycloheximide (5 µg/ml) to inhibit de novo protein synthesis, and the cells were incubated for 16 h prior to measuring cell viability by the MTT assay (28).

Development and use of the Tet-off system. U2OS cells capable of expressing variable amounts of HA-E6, regulated by the dose of doxycycline present in the medium, were created by using the Tet-off system (Clontech) according to the manufacturer's protocol with some modifications. Cultures of these cells were grown in the indicated concentrations of the drug, which were maintained throughout the duration of the experiment.

Mammalian two-hybrid assay. The mammalian two-hybrid binding assay was performed as directed by the manufacturer (Stratagene). Transfection of the indicated combination of vectors and subsequent luciferase activity measurements were performed as previously described (28).

Expression and purification of recombinant proteins. Purification of GST, GST-E6, and the various His-tagged proteins was done as previously described (28).

In vitro pull-down assays. An in vitro pull-down assay was utilized to assess the ability of bead-bound GST or GST-E6 proteins (glutathione beads from Sigma) to bind to bacterially expressed and purified FADD protein as previously described (28).

To examine the ability of peptides to inhibit the interaction between E6 and FADD, a 0, 10 or 25 µM concentration of the respective peptides was added to the mixture of proteins for incubation. Subsequent washes were performed as described above.

p53 ELISA. A p53 enzyme-linked immunosorbent assay (ELISA) was used to quantify p53 levels in cells and was performed as previously described (20).

AlphaScreen technology. AlphaScreen technology was used to assess the interaction between GST-bound E6, the various His-tagged FADD DED mutants, and His-tagged E6AP as directed by the manufacturer (Perkin-Elmer). The binding assays were performed by using white 384-well Optiplates (Perkin-Elmer) in a total volume of 25 µl. Proteins were diluted in a buffer containing phosphate-buffered saline, 10% glycerol, and 2 mM dithiothreitol. The AlphaScreen kits (nickel-coated acceptor beads and glutathione-coated donor beads) were obtained from Perkin-Elmer. Then, 5 µl of the buffer containing phosphate-buffered saline, 0.1% bovine serum albumin, and 0.5% Tween 20 was added to the plate, followed by the addition of 5 µl of each of the interacting protein partners. After a 1-h incubation at room temperature, 5 µl of both donor beads and acceptor beads, at a concentration of 50 µg/ml, was added to the mixture. All manipulations involving AlphaScreen beads were done under subdued lighting. The plates were allowed to incubate overnight in the dark at room temperature. The signal emitted from the interacting proteins was detected by using an EnVision multilabel plate reader from Perkin-Elmer. For experiments involving peptides, the indicated concentration of peptides was added prior to the initial 1-h incubation.

Peptide synthesis. Peptides were synthesized by using a Trp-cage scaffold (48) on an ABI model 433A peptide synthesizer using fast FMOC (9-fluorenylmethoxy carbonyl) chemistry. The FMOC amino acids (with side chain protection) were purchased from Advanced Chemtech, and the Wang resin preloaded with the appropriate C-terminal residue was purchased from Novabiochem. The protecting groups and resin support were cleaved from the peptide using reagent R (90% trifluoroacetic acid, 5% thioanisol, 3% ethanedithiol, and 2% anisol). After filtering off the resin and concentrating the remaining solution, the peptide was precipitated in cold diethyl ether. The ether was removed, and the dried peptide was dissolved in water with the minimum acetonitrile necessary for solubility. Reversed-phase high-pressure liquid chromatography (HPLC) with a mobile phase of acetonitrile with 0.08% trifluoroacetic acid (A) and water with 0.1% trifluoroacetic acid (B) was used to obtain the purified peptide. Analytical HPLC indicated that the purified peptides were >98% pure. The expected mass and fragmentation pattern of all peptides were obtained on our liquid chromatography-mass spectrometry system, a ThermoFinnigan LCQDeca XP mass spectrometer with attached Surveyor HPLC, confirming the sequence of the synthetic peptides. Additional peptides, without the Trp-cage scaffold, were synthesized and used to assess their ability to block E6 binding to FADD DED in vitro (Mimotopes).


arrow
RESULTS
 
Amino acids within the N terminus of FADD DED mediate binding of HPV-16 E6. Previously, we have reported that expression of HPV-16 E6 protects cells from Fas-induced apoptosis, leading to increased cell viability compared to cells lacking E6. Using a tet-regulated system in which the presence of doxycycline inhibited the expression of E6, we found that protection from Fas-induced apoptosis is due to the E6-mediated accelerated degradation of FADD. In the presence of E6 (0 ng of doxycycline/ml), FADD undergoes accelerated degradation. With 100 ng of doxycycline/ml added to the culture medium, however, a lack of E6 expression results in increased amounts of FADD protein. Elevated levels of FADD allow for the efficient propagation of the apoptotic signal corresponding to the decreased viability observed in Fig. 1A. The residues that mediate E6 binding localize to the N-terminal 23 amino acids of FADD DED (21). A deletion mutant lacking amino acids 2 to 79 (D2) was unable to bind to E6 complexed to GST beads in an in vitro pull-down assay. However, a deletion mutant deficient in the nucleotides coding for amino acids 23 to 62 (D1) demonstrated strong binding to E6, implicating the significance of the N terminus of FADD DED in E6 binding. To further localize the regions of FADD required for binding, site-directed mutagenesis was utilized. The additional mutants were constructed based on D1 since this construct bound efficiently to E6 and thus harbors all of the residues necessary for binding. Figure 1B displays the sequence of the various FADD DED mutants used to assess binding to GST-E6.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 1. Mutation of specific amino acids in the N terminus of FADD DED can block E6 binding. (A) E6 expression protects cells from Fas-induced apoptosis. Control cells not expressing E6 or cells expressing E6 under the control of the tetracycline/doxycycline response element, U2OSE6tet24, were grown in the presence of the indicated concentrations of doxycycline for 48 h. Cells were then treated with 50 ng of anti-Fas/ml in the presence of 5 µg of cycloheximide/ml. Cells were incubated for an additional 16 h prior to measuring cell viability via the MTT assay. Measurements were made in triplicate, and the error bars represent the standard deviation. (B) The protein sequences of the mutants that were created based on the sequence of D1 (lacking amino acids 23 to 62) are shown, along with the results of in vitro pull-down assays with E6 complexed to GST beads. The amino acids that were mutated in each construct are highlighted in red. The SELT, SSLS, and SLT2 names were chosen based on amino acids in the regions where the mutations were made.

Mutant FADD proteins were bacterially expressed, purified, and used in in vitro pull-down assays with glutathione beads bound to GST-E6. After SDS-PAGE separation and immunoblotting of the proteins bound to the beads, a band corresponding to the SELT mutant protein was observed (data not shown). This band appeared to be weaker than the band corresponding to D1, indicating a reduction in the ability of E6 to bind this protein. Nonetheless, the appearance of a protein band points to the ability of GST-E6 to efficiently bind to and pull-down the FADD protein despite the mutations made. Because this set of mutations did not eliminate binding, we continued to introduce mutations into FADD DED. The next set of mutations was made in the region adjacent to that which codes for the SELT amino acids (SSLS). The results of subsequent pull-down assays demonstrated that while binding was slightly reduced with this SSLS mutant, it was not eliminated, which is similar to the findings obtained with the SELT construct.

In order to identify a set of mutations that could completely eliminate E6 binding, another construct, SLT2, was created, which incorporated some mutations from SELT and some mutations from SSLS (Fig. 1B). In vitro pull-down assays with purified E6 and SLT2 proteins demonstrated that E6 was unable to bind to SLT2, implying that the region of FADD encoding the 5 amino acids mutated in SLT2 is necessary for E6 binding and that mutating specific amino acids in this binding pocket can efficiently inhibit binding. Figure 2A depicts the three-dimensional structure of FADD DED, and Fig. 2B uses yellow to highlight the amino acids mutated in SLT2. However, when we tested this mutant protein in a series of biological assays to determine whether the mutations would also impair the normal functions of FADD, we found that the mutant protein was unable to undergo normal turnover in cells, to mediate the transmission of the apoptotic signal, and to efficiently bind to procaspase 8 DED. Therefore, it is likely that the five mutations introduced into the sequence of FADD DED may have induced a major conformational change in the protein structure.


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 2. The SLT2 set of five mutations in FADD DED that localize to the E6 binding domain occupy a patch on the surface of the FADD protein. The PDB has published the three-dimensional structure of FADD DED (accession number 1a1w). This structure was viewed utilizing the Viewer Lite program. The structure of the wild-type protein is shown (A), and the amino acids mutated in the various mutant constructs are highlighted in yellow (B, C, and D).

The SLT3 and SLT4 sets of three amino acid mutations in FADD DED inhibit E6/FADD binding and E6-mediated FADD degradation while preserving caspase 8 binding and the ability to induce apoptosis. The inability of the SLT2 construct to execute the normal functions of FADD led to the creation of additional mutants in order to locate the residues in the DED of FADD specific for E6 binding. Since the ability to bind E6 was lost with the five mutations in SLT2, this suggests that some combination of these amino acids is relevant to the mediation of oncoprotein binding. SLT3 and SLT4 were created based on the amino acids that were mutated in the original SLT2 construct and incorporate three mutations rather than the five in SLT2. Figures 2C and D depict the amino acids that were mutated in SLT3 and SLT4 in yellow. The three-dimensional rendition of the FADD DED protein demonstrates that the E6 binding domain on FADD is comprised of amino acids that localize to the outer surface of the protein. Figure 3A lists the sequences of the constructs used to perform the next set of in vitro pull-down assays with GST-E6.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 3. Two combinations of three amino acid mutations in FADD inhibit E6 binding. (A) Schematic representation of the additional FADD DED mutants used to map the region of E6 binding. The protein sequence of the mutants that were created based on the sequence of D1 (lacking amino acids 23 to 62) are shown, along with the results of in vitro pull-down assays with E6 complexed to GST beads. The amino acids that were mutated in each construct are highlighted in red. (B) Mutating three amino acids in the N terminus of FADD DED inhibits E6 binding to FADD. Glutathione bead-bound GST was used to pull-down bacterially expressed and purified wild-type FADD (D1) protein (lane 1); GST-E6 was used to pull down purified wild-type D1 and FADD variants SLT2, SLT3, and SLT4 (lanes 2 to 5), as described previously. For the upper panel, blots were probed, following SDS-PAGE separation of proteins and transfer to membranes, with antibodies to FADD. For the lower panel, the same membrane was stripped and reprobed with antibodies to GST. (C) AlphaScreen technology verifies that E6 cannot bind to the FADD mutants SLT2, SLT3, and SLT4. GST-tagged E6 at 10–3 µM was incubated for 1 h with 0.5, 0.1, or 0.02 µM His-tagged D1 protein at room temperature. Glutathione-coated donor beads and nickel-coated acceptor beads were then added, and plates were read on an EnVision multilabel plate reader after an overnight incubation period in the absence of light.

Pull-down assays of proteins bound to GST-E6 and subsequent immunoblotting demonstrate that although E6 can efficiently bind to D1, it cannot bind to SLT2 (as previously noted) and that the binding to SLT3 and SLT4 is nearly undetectable (Fig. 3B). Therefore, the amino acids that were mutated in these proteins are those that are involved in facilitating E6/FADD binding.

The inability of GST-E6 to pull-down the SLT3 and SLT4 proteins suggests that the binding pocket for E6 is disrupted by the amino acid changes introduced. In order to verify our findings, Perkin-Elmer's AlphaScreen technology was used. AlphaScreen, which is based on the transfer of ambient oxygen from the donor bead (coupled to GST-E6) to the acceptor bead (coupled to His-FADD), is a very sensitive method for assessing binding interactions. The data obtained from AlphaScreen analysis with purified GST-E6 and the various FADD mutants reveals that although there is strong binding between E6 and D1, the binding of E6 to SLT2, SLT3, and SLT4 is significantly reduced (Fig. 3C). Thus, results from two independent in vitro assays demonstrate that the SLT3 and SLT4 proteins are unable to bind to E6.

Since the mutations in SLT3 and SLT4 can inhibit E6 binding in vitro, we tested the consequences of E6 expression on the stability of the mutant proteins in vivo. Previously, we have demonstrated that E6 binds to wild-type FADD and heightens the rate at which it undergoes degradation. Moreover, FADD becomes unavailable to continue transmission of the apoptotic signal, making E6 expressing cells resistant to death-inducing stimuli (21). Disruption of E6 binding in cells should, therefore, lead to the inability of E6 to promote the accelerated degradation of FADD, thus enabling FADD to propagate the apoptotic signal once initiated.

To test whether the mutations in the SLT3 and SLT4 constructs can obstruct E6-mediated degradation of FADD in an in vivo system, U2OS cells that express E6 under the control of the tetracycline response element were transfected with plasmids coding for the mutant proteins. U2OSE6tet24 cells cultured with either 0 or 100 ng of doxycycline/ml were transfected with plasmids encoding wild-type or mutant FADD proteins. In the presence of E6, wild-type FADD undergoes accelerated degradation. In the absence of E6, however, higher levels of wild-type FADD protein can be detected (rightmost two bands in Fig. 4A, upper panel). In contrast, transfection with the SLT3 and SLT4 constructs results in detectable levels of FADD protein expression in both the presence (0 ng of doxycycline/ml) and absence (100 ng of doxycycline/ml) of E6 (Fig. 4A, upper panel). Densitometry of results obtained from three independent experiments supports these findings (Fig. 4A, lower panel). This suggests that the mutations introduced in these constructs change the nature of the E6 binding pocket on FADD DED, interfere with the ability of E6 to mediate FADD degradation, and result in normal FADD protein expression in the presence of E6.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 4. Two combinations of three amino acid mutations in FADD DED inhibit E6-mediated FADD degradation, while leaving other tested biological functions of FADD intact. (A) E6 cannot bind to SLT3 or SLT4 and thus does not mediate the accelerated degradation of the mutant FADD proteins. For the upper panel, U2OSE6tet24 cells cultured with 0 or 100 ng of doxycycline/ml were transfected with plasmids encoding wild-type FADD, the SLT3 mutant, or the SLT4 mutant FADD protein. At 24 h posttransfection, cell lysates were prepared for immunoblotting, and subsequent membranes were blotted with antibodies against FADD to analyze FADD content. For the lower panel, transfection experiments were repeated three times, and densitometric analysis of the resultant protein bands was performed by using a ChemiImager 4400 (AlphaInnotech Corp.). Error bars represent the standard deviations obtained from three separate experiments. (B) The three amino acid mutations in SLT4 do not inhibit the ability of FADD to undergo normal turnover. U2OS cells were transfected with pcDNA FADD wild type (lanes 1 to 3), pcDNA SLT3 (lanes 4 to 6), or pcDNA SLT4 (lanes 7 to 9), as described before. At 24 h posttransfection, cycloheximide (5 µg/ml) was added to inhibit de novo protein synthesis, and cells were then lysed at the indicated time points and used for immunoblotting. The subsequent membrane was blotted with antibodies against FADD to analyze FADD content (top panel). For the center panel, the same membrane was stripped and reblotted with antibodies against β-actin to normalize for loading. For the bottom panel, the same membrane was stripped and reblotted with antibodies against green fluorescent protein (GFP) to demonstrate transfection efficiency. (C) The mutations made in SLT3 and SLT4 do not inhibit the ability of FADD to trigger apoptosis. U2OS cells were transfected with either pcDNA (empty vector), pcDNA FADD, pcDNA SLT3, or pcDNA SLT4. At 24 h posttransfection, cell viability was measured via the MTT assay. Measurements were made in triplicate, and the error bars represent the standard deviation. (D) The amino acids mutated in SLT3 and SLT4 do not eliminate the ability of FADD DED to bind to procaspase 8 DED. Sequences encoding procaspase 8 DED, wild-type FADD DED, the SLT3 mutant, or the SLT4 mutant FADD DED were cloned into the bait or prey plasmids of a mammalian two-hybrid kit (Stratagene). The indicated combination of plasmids, along with a plasmid encoding the luciferase reporter gene, was transfected into cells that express E6 under the control of the tetracycline/doxycycline response element. Cells were treated with the indicated concentrations of doxycycline to regulate E6 expression. Luciferase expression was measured by using a luminometer to detect chemiluminescence. Measurements were made in triplicate, and the error bars represent the standard deviation.

To further characterize the SLT3 and SLT4 mutants, we tested whether normal protein turnover would be affected when cells express these proteins. At 24 h after transfecting U2OS cells with the various FADD constructs, cells were treated with cycloheximide for 0, 2, or 4 h to inhibit de novo protein synthesis. Figure 4B demonstrates that wild-type FADD undergoes degradation and results in decreased protein expression over time, whereas expression of the SLT3 mutant protein is stable at all time points, similar to what was observed for the SLT2 mutant (data not shown). This suggests that the amino acids mutated here also impair protein turnover. However, the SLT4 mutant behaves as the wild-type protein as seen by diminished protein expression over time, indicating functional protein turnover. Therefore, although the mutations in both SLT3 and SLT4 prevent E6 binding, only the protein encoded by the SLT4 construct allows for normal protein turnover of FADD.

As mentioned previously, the mutations in SLT2 are in the region necessary for binding to procaspase 8 and for the subsequent transmission of the apoptotic signal. To test whether the expressed SLT3 and SLT4 mutant proteins can facilitate apoptosis, U2OS cells were transfected with the pcDNA plasmid (vector alone), pcDNA FADD, pcDNA SLT3, or pcDNA SLT4. Cell viability measurements were made 48 h posttransfection. Figure 4C demonstrates that, unlike SLT2, the mutations in SLT3 and SLT4 do not impair apoptosis, resulting in viability that is comparable to cells expressing wild-type FADD protein. This indicates that the mutations in SLT3 and SLT4 do not abolish recruitment of procaspase 8 to the DED region of FADD. To further examine this proposed binding, a mammalian two-hybrid system was used to assess this protein-protein interaction. Figure 4D shows that, whereas procaspase 8 DED cannot associate with SLT2, the amino acid changes in SLT3 and especially in SLT4 do not eliminate the procaspase 8 DED interaction with FADD DED. This, combined with the results in Fig. 4B, suggests that the amino acids mutated in SLT3 and SLT4 primarily affect HPV 16 E6 binding to FADD and that the behavior of the SLT4 mutant more closely resembles that of wild-type FADD with respect to turnover and procaspase 8 binding. These results indicate that the residues mutated in SLT3 and SLT4 do not interfere with procaspase 8 recruitment and activation or transmission of apoptotic signals.

The E6 binding domain on FADD DED localizes to the outer surface of the protein. In localizing the E6 binding site on FADD DED, several mutant constructs were created, as listed in Fig. 1B and 3A. Site-directed mutagenesis of specific residues in the protein sequence resulted in a reduction in the ability of E6 to efficiently bind to FADD. The various combinations of amino acids that were selected for mutation are summarized in Fig. 5A. Each of the mutant constructs harbors mutations in the amino acids that reside in the N-terminal 23 amino acids of the FADD DED sequence. Although a diverse set of amino acid changes hinder E6/FADD binding to various degrees, it is the three amino acids mutated in SLT4 that appear to be most specific for oncoprotein binding. The availability of the three-dimensional structure of FADD in the Protein Data Bank (PDB) allows for the visualization of the implicated E6 binding domain (Fig. 5B). In this representation, the amino acids mutated in SLT4 (serine 16, serine 18, and leucine 20) are depicted in blue, and those mutated in SLT2 but not SLT4 (serine 14 and threonine 21) are shown in yellow. The relevant amino acids occupy a patch on the surface of FADD.


Figure 5
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 5. A specific combination of amino acids in the N terminus of FADD DED mediates E6/FADD binding. (A) Various mutant FADD constructs designed to localize the amino acids which facilitate E6 binding to FADD DED. Mutation of different combinations of amino acids in the N-terminal 23 amino acids of FADD DED lead to a reduction in the ability of E6 to bind FADD. (B) The three-dimensional structure of FADD DED as viewed with the Viewer Lite program with the amino acids mutated in SLT4 depicted in blue and those mutated in SLT2 but not SLT4 shown in yellow.

Peptide inhibitors that mimic the E6 binding domain on FADD DED can inhibit the E6/FADD interaction. Based on the structure shown in Fig. 5B, the residues that constitute the E6 binding domain localize to the outer surface of FADD DED. This suggests that peptides or peptide-like molecules may be effective in inhibiting the E6/FADD interaction. It has been reported that synthetic peptides have been successfully used to inhibit protein-protein interactions (37). Identification of the region on FADD that mediates oncoprotein binding thus allows for the creation of peptides that mimic the E6 binding domain. Figure 6A shows the sequences of two peptides, varying in length, that were synthesized based on the proposed E6 binding domain (A and B). In addition, the sequences of two peptides synthesized based on reports that they can be successfully used to block E6 binding to its known protein partner E6AP are shown (C and D) (37, 55). Since smaller peptides often lack a well-defined three-dimensional structure, the peptides were grafted onto a Trp-cage scaffold (47), which is itself helical, and may help stabilize the secondary structure of the small peptide (19). In vitro pull-down assays were performed with bacterially expressed and purified FADD protein, glutathione beads bound to GST-E6, and the peptide inhibitors. After testing various concentrations of the peptides, ranging from 0 to 100 µM (data not shown), peptide A seemed to be the most promising in blocking E6 binding utilizing in vitro pull-down assays, such that the addition of a 25 µM concentration of peptide A significantly reduced the interaction between E6 and FADD DED. Peptide B had some inhibitory activity, although it was less than that seen with peptide A (data not shown). To further explore this inhibition, the peptides were used in an AlphaScreen analysis with purified GST-E6 and His-FADD (D1) proteins. AlphaScreen, which is based on the transfer of ambient oxygen from the donor bead (coupled to GST-E6) to the acceptor bead (coupled to His-FADD [D1]), is a very sensitive method for assessing the potential inhibitory activity of the peptides. The results from this assay (Fig. 6B) demonstrate that in the presence of both peptides A and B there is a significant reduction in signal, indicating that the addition of these peptides prevents the protein partners from coming into close proximity to one another. Peptides C and D, however, do not negatively affect the binding between E6 and FADD, as seen by the unimpaired binding at the three concentrations of peptides tested. These observations highlight the specificity of peptides A and B in obstructing the E6/FADD interaction. Although both peptides A and B were comparably effective at blocking the interaction between E6 and FADD, we chose to focus our work on the shortest sequence of amino acids capable of efficiently impeding E6/FADD binding, that of peptide A.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 6. Peptides can be used to block the interaction between E6 and FADD DED in vitro. (A) Peptides synthesized and tested for the ability to obstruct binding between E6 and FADD. Peptides A and B correspond to the proposed E6 binding domain on FADD. Peptides C and D correspond to the E6 binding domain on E6AP. (B) Peptides which mimic the E6 binding domain on FADD can inhibit E6/FADD interaction. Peptides A, B, C, and D at 0, 10, or 25 µM was added to a mixture of purified His-tagged D1 (0.4 µM) and GST-tagged E6 proteins (10–3 µM) (as described for Fig. 3C). After the specified incubation period, the addition of beads, and an overnight incubation in the absence of light, the plates were read on an EnVision multilabel plate reader. (C) Peptide A does not inhibit E6/E6-AP binding. Peptide A at 0, 10, or 25 µM was added to a mixture of purified His-tagged D1 and GST-tagged E6 proteins (as described for Fig. 3C) or to a mixture of purified His-tagged E6AP and GST-tagged E6 proteins. Peptides C and D, known inhibitors of E6/E6AP binding, at 0, 10, or 25 µM were added to mixtures of His-tagged E6AP and GST-tagged E6. (His-D1 at 0.5 µM, His-E6AP at 0.5 µM, and µM GST-E6 at 10–3 µM were used.) Plates were read as in panel B after an overnight incubation. (D) A peptide containing mutations in the amino acids implicated in mediating E6 binding to FADD supports our findings of a novel E6 binding domain. For the top panel, peptides were synthesized and tested for the ability to obstruct binding between E6 and FADD (Mimotopes). For the bottom panel, peptide 1 (containing a short fragment of the wild-type FADD protein sequence) and peptide 2 (containing a short fragment of the FADD sequence with the 5 amino acid changes introduced in the SLT2 construct) at 0, 50, 100, or 400 µM were added to mixtures of His-tagged D1 (0.4 µM) and GST-tagged E6 (10–3 µM). Plates were read as in panel B after an overnight incubation.

E6 binding to FADD DED is mediated by different amino acids than those involved in E6 binding to E6AP. The amino acid sequence that includes the E6 binding region on FADD DED shows some sequence similarity to the amino acid sequence that includes the E6 binding region for E6AP. The ability of peptide A to obstruct the interaction between E6 and E6AP was therefore also tested. AlphaScreen analysis (Fig. 6C) reveals that at the concentrations tested, peptide A specifically impairs E6/FADD (D1) binding while leaving E6/E6AP binding intact. To verify the effectiveness of this assay system, the binding between E6 and E6AP was tested in the presence of known inhibitors of this interaction (peptides C and D). As expected, Fig. 6C indicates that Peptides C and D significantly impair E6/E6AP binding. These results provide further evidence that the identified E6 binding domain on FADD is indeed novel.

The peptides listed in Fig. 6A were constructed with a Trp-cage scaffold, as previously mentioned. In addition, peptides A and B were designed to represent the wild-type version of the putative E6 binding domain. In order to further test whether the amino acids identified as being those necessary for the mediation of oncoprotein binding to FADD are indeed essential for the inhibition of E6/FADD binding and to see whether shorter peptides lacking the Trp-cage could also function in this way, a peptide encoding a short fragment of the FADD DED protein including a subset of the five amino acid changes introduced in SLT2 was synthesized. This peptide (peptide 2), along with a control peptide encoding the wild-type FADD protein sequence (peptide 1), was used in an AlphaScreen analysis with purified His-tagged FADD and GST-tagged E6 proteins. As demonstrated in Fig. 6D, inclusion of peptide 1 (wild-type sequence) resulted in a decrease in signal. This indicates a reduction in the binding between E6 and FADD, even though peptide 1 is significantly shorter than the previously tested peptide A (compare Fig. 6A and D). However, it should be noted that higher levels of this shorter peptide are necessary to achieve inhibition. Peptide 2, which incorporated some of the mutations from SLT2, however, did not inhibit binding at any of the concentrations tested, strengthening our evidence for the specificity of the residues identified by mutation analysis. These observations further support our findings of a novel E6 binding domain that is characterized by a specific combination of amino acids in the N terminus of FADD DED.

Expressing a peptide corresponding to the E6 binding domain on FADD resensitizes E6-expressing cells to stimuli that induce apoptosis. The 23 amino acids in the N terminus of the DED of FADD appear to mediate oncoprotein binding based upon the mutations made in the various constructs. Overexpressing the region of FADD involved in E6 binding may competitively inhibit E6 binding to endogenous FADD in E6-expressing cells. This would leave more FADD available to facilitate apoptosis once the apoptotic cascade of events is initiated. To test this model, cells expressing either the sense (U2OSE612) or antisense (U2OSE6 AS) version of E6 were either transfected or not transfected with a plasmid encoding the N-terminal 23 amino acids of FADD DED, hereafter referred to as "pcDNA 23 aa" (Fig. 7A). At 24 h after transfection, cell lysates were prepared and endogenous FADD expression was analyzed via Western blotting. Figure 7B demonstrates that in E6-expressing cells transfected with the plasmid encoding the proposed E6 binding domain, E6 does not cause a loss of detectable steady-state levels of FADD (Fig. 7B, lane 1). In the absence of this peptide, however, the presence of E6 results in a reduction in the levels of detectable FADD protein due to degradation (Fig. 7B, lane 2). To test whether E6-expressing cells can be resensitized to apoptosis-inducing stimuli when the E6-binding domain on FADD is overexpressed, the HPV-negative cell line C33A and the HPV-positive cancer cell lines SiHa and Caski were tested. After transfection of these cells with pcDNA 23 aa, cells were treated with anti-Fas to induce apoptosis via the extrinsic pathway and viability was measured by using the MTT assay. As shown in Fig. 7C, viability of E6-expressing SiHa cells transfected with vector alone is relatively high as a result of E6 binding to FADD and the resultant unsuccessful propagation of the apoptotic signal. However, upon transfection with pcDNA 23 aa, the viability of E6-expressing cells is lower for cells transfected with pcDNA alone. Overexpression of the implicated E6 binding domain on FADD in the HPV-positive Caski cell line reveals that although viability is reduced after the addition of anti-Fas, the difference in viability between cells transfected with pcDNA versus pcDNA 23 aa is less dramatic than that observed for SiHa cells. This may be explained by the fact that Caski cells are naturally sensitive to Fas. Taken together, these results indicate that the expression of a peptide corresponding to the E6 binding domain on FADD DED can resensitize E6-expressing cells to apoptosis-inducing stimuli. Our findings also suggest that the E6 oncoprotein contributes to the resistance of SiHa cells to Fas-induced apoptosis, in a context where the entire genome of HPV-16 is expressed.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 7. Overexpressing the region of FADD implicated in E6 binding in cells blocks the interaction between E6 and FADD DED and resensitizes cells to apoptosis inducing stimuli. (A) The pcDNA3 vector encoding the 23 amino acid residues on FADD implicated in E6 binding expresses the novel E6 binding domain. The amino acids in the E6 binding domain of FADD, based on the mutations introduced in SLT4, are highlighted in red. (B) Overexpression of the peptide corresponding to the E6 binding domain in cells interferes with E6-mediated FADD degradation. U2OS cells expressing either the sense (U2OSE612) or antisense (U2OSE6 AS) version of E6 were either transfected (lanes 1 and 3) or not transfected (lanes 2 and 4) with pcDNA 23 aa. At 24 h posttransfection, cell lysates were prepared, proteins separated by SDS-PAGE and transferred to a membrane. The membrane was then blotted with antibodies against FADD to analyze FADD expression (top panel). The same membrane was stripped and reblotted with antibodies against β-actin to demonstrate that equivalent amounts of lysate were used for analysis (bottom panel). (C) Expression of the implicated E6 binding domain on FADD DED resensitizes E6-expressing cells to Fas-induced apoptosis. HPV-negative C33A cells or HPV-positive Caski and SiHa cells were transfected with pcDNA 23 aa or with pcDNA vector alone. At 24 h posttransfection, cells were treated with 50 ng of anti-Fas/ml in the presence of 5 µg of cycloheximide/ml. Cells were incubated for an additional 16 h prior to measuring cell viability via the MTT assay. Measurements were made in triplicate, and the error bars represent the standard deviation. The pcDNA 23 aa plasmid expresses detectable levels of our protein of interest (inset). U2OS cells were (lane 2) or were not (lane 1) transfected with the pcDNA 23 aa plasmid. At 48 h posttransfection, cell lysates were used for Western blot analysis with antibodies directed against FADD. (D) The 23-amino-acid region on FADD implicated in E6 binding does not interfere with the ability of E6 to bind and degrade p53. U2OS cells expressing (U2OSE612) or not expressing E6 (U2OSE6 AS) were transfected with pcDNA 23 aa or with pcDNA vector alone. At 24 h posttransfection, cells were treated with 2 µg of mitomycin C/ml for 16 h prior to measuring p53 levels with ELISA. Measurements were made in triplicate, and the error bars represent the standard deviation.

Binding between E6 and E6AP leads to the formation of the ubiquitin ligase moiety responsible for the degradation of the tumor suppressor protein p53. As previously mentioned, there are sequence similarities between E6AP and FADD. However, despite these similarities, it has been shown that the amino acids that direct oncoprotein binding to FADD are indeed unique and that peptides harboring this binding domain do not interfere with E6/E6AP binding (Fig. 6C). This led to the prediction that sequences encoding this novel E6 binding domain would have little or no effect on cellular p53 levels. To directly test this prediction, a p53 ELISA was used to determine p53 levels in E6-expressing cells transfected with either the pcDNA vector alone or with pcDNA 23 aa. After transfection of cells, mitomycin C was added to induce DNA damage and thereby increase cellular p53. As seen in Fig. 7D, transfection of either the control plasmid (pcDNA) or the plasmid coding for the 23-amino-acid peptide (pcDNA 23 aa) had no effect on the cellular level of p53, in either cells expressing or lacking E6. These findings further demonstrate the specificity of the peptide inhibitor in obstructing E6/FADD binding.


arrow
DISCUSSION
 
In order to persist in their host after infection, viruses have developed the ability to manipulate the host immune response to avoid clearance (5, 30). The mechanisms utilized by viruses to avoid elimination are extensive and can target molecules involved in a number of different steps along the cell death cascade. Some viruses have developed means to impede apoptosis during the initial steps of signal propagation by interfering with caspase 8 or FADD (7, 54, 61). In addition, while some viruses have developed mechanisms to evade the host immune system by producing homologues of cytokines and chemokines, as well as their receptors (1, 6, 14), others have developed means to obstruct both the extrinsic and intrinsic cell death pathways simultaneously (9, 53, 62).

In order to escape elimination by the host, the HPV modulates apoptosis through several mechanisms (26), including the interaction of its oncoprotein E6 with the tumor suppressor protein p53 (46, 64). In addition, E6 can also bind to TNFR1 (63), FADD (21), procaspase 8 (31), bax (35, 40), and bak (17, 56), thus preventing proapoptotic signal transduction. Many, though not all of these binding interactions are followed by accelerated degradation of the binding partner. It has previously been reported that HPV-16-positive cervical carcinoma cells are resistant to apoptosis induced by Fas L (33), although the mechanism by which this occurs was not described. In support of this observation, we have reported that HPV-16 E6 binds directly to the DED of FADD and mediates its degradation, thereby making HPV-infected cells resistant to Fas-induced apoptosis (21). This discovery contributes to the current findings regarding the importance of FADD protein expression and cancer since it has been reported that defects in FADD expression correlate with tumor progression (58). Loss of functional FADD expression, for example, leads to a decrease in cancer cell death and is followed by metastasis in non-small cell lung carcinoma (52).

Prior to our findings with FADD, E6 had been shown to bind to a number of protein partners, including E6AP (32), E6BP (13), paxillin (57), and tuberin (39). The consensus sequence by which E6 binds these proteins is Lxx{phi}Lsh (2, 39). Further analysis of the interaction between E6 and its protein partners revealed that the seven-residue leucine-containing motif, LQELLGE, constitutes the E6 binding motif. E6 is also known to interact with proteins that harbor a PDZ domain via its C-terminal XT/SXV (41, 45) sequence of amino acids, which is conserved among different HPV strains.

We have shown that E6 binds to a 23-amino-acid region within the N terminus of FADD DED through the creation of a series of deletion (21) and site-directed mutants (Fig. 1B and 3A). A sequence comparison between FADD DED and the reported protein partners of E6 revealed that not only does FADD DED lack the Lxx{phi}Lsh motif but the PDZ-binding motif is also absent, suggesting the presence of a novel E6 binding motif. Mutagenesis of regions in FADD that resemble truncated versions of the leucine-containing motif did not affect the efficiency of E6 binding to FADD (21), lending further support to the existence of an additional E6 binding motif. The SSELT sequence was used as the basis for the series of mutations highlighted in Fig. 1B and 3A. Interestingly, although five amino acid changes in this region successfully abrogated oncoprotein binding, the ability of FADD to undergo normal protein turnover, to propagate the apoptotic signal, and to interact with procaspase 8 were also lost. A possible explanation for these phenomena may be that the mutations that were introduced in the SLT2 construct resulted in a conformational change in the structure of FADD, making it unable to interact with the proteins needed for proper function. These findings also suggested that the E6 binding pocket on FADD is encoded by some combination of the amino acids that were mutated in SLT2.

In looking at the constructs that were created to help localize the region of E6 binding to FADD, it appeared that the ability of E6 to associate with FADD was significantly reduced or inhibited when specific amino acids were mutated. This observation led to the creation of SLT3 and SLT4, constructs that harbor a combination of three amino acid mutations believed to be important in mediating oncoprotein binding to FADD DED. Intriguingly, the proteins encoded by both constructs were unable to bind to E6, as demonstrated by in vitro pull-down assays (Fig. 3B), by AlphaScreen technology (Fig. 3C), and by the lack of accelerated protein degradation in the presence of E6 (Fig. 4A, 0 ng of doxycycline/ml). However, the difference between the two proteins lie in the ability of the protein encoded by the SLT4 construct to more efficiently undergo protein turnover in the presence of cycloheximide (Fig. 4B) and to bind procaspase 8 (Fig. 4D). This implies that serine 16, serine 18, and leucine 20 are the residues within the N terminus of FADD DED that are involved in E6 binding and that they do not interfere significantly with the other tested functions of FADD.

The availability of the three-dimensional structure of FADD DED in the PDB (accession number 1a1w) allows for visualization of the structure, as well as the location of the introduced mutations. Figures 2 and 5 reveal that the mutations made in the SLT2, SLT3, and SLT4 constructs localize to the outer surface of the protein, suggesting that peptides designed to mirror the proposed E6 binding domain might be successful in blocking E6 binding to its target protein, FADD. It has previously been reported that peptide or small molecule inhibitors can be successfully used to block protein-protein interaction (68, 69).

Based upon the localization of the E6 binding domain to the N-terminal 23 amino acids of FADD, peptide inhibitors were designed (Fig. 6A). The literature indicates that the E6 binding motif has a strong tendency to form an {alpha}-helix (3, 12). Therefore, to encourage proper peptide conformation, the peptides were grafted directly onto the Trp-cage (38). Peptides constructed with this backbone remain stable in aqueous solution without additional proteins (51). The results from both in vitro pull-down assays (data not shown) and AlphaScreen analysis with the peptides (Fig. 6B) indicated that both peptides A and B were effective in inhibiting the E6/FADD interaction. Due to the sequence similarity between FADD and E6AP in the region of E6 binding, it was possible that peptides which harbor the amino acids that mediate E6 binding to E6AP might also affect E6 binding to FADD. Therefore, the effects of two peptides designed to contain the residues in the E6 binding domain on E6AP (Fig. 6A, peptides C and D) were also tested. In vitro binding assays demonstrate that neither of these peptides impaired the E6/FADD interaction (Fig. 6B). Further, incorporating peptide A in a high-throughput binding assay demonstrated that the peptide specifically reduces or inhibits binding of E6 to FADD while leaving the interaction between E6 and E6AP undisturbed (Fig. 6C). These results indicate that the two proteins do not share the same E6 binding domain. These data also demonstrate that peptides designed to mimic the proposed E6 binding domain on FADD can be successfully used to inhibit oncoprotein binding to FADD DED in vitro. This finding significantly contributes to the current knowledge regarding the efficacious use of small molecules to block protein-protein interactions.

We also found that expression of the 23-amino-acid region of FADD DED implicated in E6 binding in vivo successfully resensitized E6-expressing cells to normal apoptotic stimuli (Fig. 7C) in the HPV-positive human cervical squamous carcinoma cells. In the case of the SiHa cells, viability was reduced from 58% to approximately half that, and in CaSki cells, viability was reduced from ca. 10% to ca. 5%. Caski cells are inherently more sensitive to Fas-induced apoptosis, as can be seen by the significantly lower viability in Caski cells compared to SiHa cells after transfection with the pcDNA empty vector (Fig. 7C). In both cases, and with these very different levels of baseline sensitivity, transfection of pcDNA 23 aa led to a reduction in viability after {alpha}-Fas treatment. Taken together, these data support our findings of a novel E6 binding domain that is not made up of a linear sequence of amino acids but instead is composed of a set of residues that form the structural domain necessary to facilitate E6 binding.

E6 is a relatively short protein of 151 amino acids; however, attempts to purify E6 have proven difficult due to the high content of {alpha}-helical and β-sheet secondary structures. These properties give rise to a protein that is both unstable and insoluble once purified (23). Recently, however, a model of the structure of HPV-16 E6 has been proposed based upon the creation of an E6 mutant in which six nonconserved cysteines were replaced with serines (50) to enhance protein solubility. The protein was shown to retain the tested biological activities of its wild-type predecessor. Visualization of this proposed structure (PDB accession no. 2FK4) reveals the {alpha}-helicity of the protein. It is reported that E6 binds to its protein partners through engagement of the leucine containing Lxx{phi}Lsh or PDZ motifs. We have demonstrated that E6 FADD interaction is mediated by a novel motif characterized by S16, S18, and L20. The highly irregular surface of the E6 protein supports these findings, suggesting that a combination of different surface residues facilitates binding between E6 and at least some of its partners. The availability of the three-dimensional structure of E6 provides us with the future opportunity to localize the residues on E6 that mediate binding to FADD.

Viruses, such as HPV, have developed means by which to avoid elimination by the host immune response in order to continue to persist and to propagate. The ability of the oncoprotein E6 to protect infected cells from undergoing apoptosis through its interactions with the TNFR and the DEDs of both procaspase 8 and FADD enhance the prospective oncogenicity of the virus. This underlines the significance of E6 in promoting virus survival postinfection. To date, several approaches have been taken to inhibit E6 expression, including the administration of small interfering RNA directed against E6 (49), the use of antibody targeting designed to inhibit the interaction between E6 and p53 in order to prevent E6-mediated p53 degradation (29), and the restoration of apoptosis in E6-infected cells through the administration of peptide aptamers targeting E6 (10). Our finding of a novel E6 binding domain on FADD, a key player in viral oncogenesis, in conjunction with our results demonstrating successful use of peptide inhibitors to block E6 activity further contribute to the list of potential agents that can be used for the design of therapeutic approaches for cervical cancer. In addition, since some head and neck cancers have been found to contain high-risk HPV types, our findings may also aid in the design of therapeutic approaches for these cancers as well.


arrow
ACKNOWLEDGMENTS
 
This study was supported by NIH grant 1 R01 CA-095461 (P.J.D.-H.).

We thank Carl Ware (La Jolla Institute for Allergy and Immunology) for the pcDNA-FADD-encoding plasmid and Ireland Burch for synthesizing the peptide inhibitors.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Basic Sciences, Loma Linda University School of Medicine, 11085 Campus Street, 121 Mortensen Hall, Loma Linda, CA 92354. Phone: (909) 558-4300, ext. 81361. Fax: (909) 558-0177. E-mail: pdhughes{at}llu.edu Back

{triangledown} Published ahead of print on 16 July 2008. Back


arrow
REFERENCES
 
    1
  1. Alcami, A. 2003. Viral mimicry of cytokines, chemokines and their receptors. Nat. Rev. Immunol. 3:36-50.[CrossRef][Medline]
  2. 2
  3. Baleja, J. D., J. J. Cherry, Z. Liu, H. Gao, M. C. Nicklaus, J. H. Voigt, J. J. Chen, and E. J. Androphy. 2006. Identification of inhibitors to papillomavirus type 16 E6 protein based on three-dimensional structures of interacting proteins. Antivir. Res. 72:49-59.[CrossRef][Medline]
  4. 3
  5. Be, X., Y. Hong, J. Wei, E. J. Androphy, J. J. Chen, and J. D. Baleja. 2001. Solution structure determination and mutational analysis of the papillomavirus E6 interacting peptide of E6AP. Biochemistry 40:1293-1299.[CrossRef][Medline]
  6. 4
  7. Bedell, M. A., K. H. Jones, and L. A. Laimins. 1987. The E6-E7 region of human papillomavirus type 18 is sufficient for transformation of NIH 3T3 and rat-1 cells. J. Virol. 61:3635-3640.[Abstract/Free Full Text]
  8. 5
  9. Benedict, C. A. 2003. Viruses and the TNF-related cytokines, an evolving battle. Cytokine Growth Factor Rev. 14:349-357.[CrossRef][Medline]
  10. 6
  11. Benedict, C. A., T. A. Banks, and C. F. Ware. 2003. Death and survival: viral regulation of TNF signaling pathways. Curr. Opin. Immunol. 15:59-65.[CrossRef][Medline]
  12. 7
  13. Bertin, J., R. C. Armstrong, S. Ottilie, D. A. Martin, Y. Wang, S. Banks, G. H. Wang, T. G. Senkevich, E. S. Alnemri, B. Moss, M. J. Lenardo, K. J. Tomaselli, and J. I. Cohen. 1997. Death effector domain-containing herpesvirus and poxvirus proteins inhibit both Fas- and TNFR1-induced apoptosis. Proc. Natl. Acad. Sci. USA 94:1172-1176.[Abstract/Free Full Text]
  14. 8
  15. Brink, A. A., G. D. Zielinski, R. D. Steenbergen, P. J. Snijders, and C. J. Meijer. 2005. Clinical relevance of human papillomavirus testing in cytopathology. Cytopathology 16:7-12.[CrossRef][Medline]
  16. 9
  17. Burgert, H. G., Z. Ruzsics, S. Obermeier, A. Hilgendorf, M. Windheim, and A. Elsing. 2002. Subversion of host defense mechanisms by adenoviruses. Curr. Top. Microbiol. Immunol. 269:273-318.[Medline]
  18. 10
  19. Butz, K., C. Denk, A. Ullmann, M. Scheffner, and F. Hoppe-Seyler. 2000. Induction of apoptosis in human papillomavirus-positive cancer cells by peptide aptamers targeting the viral E6 oncoprotein. Proc. Natl. Acad. Sci. USA 97:6693-6697.[Abstract/Free Full Text]
  20. 11
  21. Chen, G., and D. V. Goeddel. 2002. TNF-R1 signaling: a beautiful pathway. Science 296:1634-1635.[Abstract/Free Full Text]
  22. 12
  23. Chen, J. J., Y. Hong, E. Rustamzadeh, J. D. Baleja, and E. J. Androphy. 1998. Identification of an alpha helical motif sufficient for association with papillomavirus E6. J. Biol. Chem. 273:13537-13544.[Abstract/Free Full Text]
  24. 13
  25. Chen, J. J., C. E. Reid, V. Band, and E. J. Androphy. 1995. Interaction of papillomavirus E6 oncoproteins with a putative calcium-binding protein. Science 269:529-531.[Abstract/Free Full Text]
  26. 14
  27. Cunnion, K. M. 1999. Tumor necrosis factor receptors encoded by poxviruses. Mol. Genet. Metab. 67:278-282.[CrossRef][Medline]
  28. 15
  29. Daniels, P. R., C. M. Sanders, and N. J. Maitland. 1998. Characterization of the interactions of human papillomavirus type 16 E6 with p53 and E6-associated protein in insect and human cells. J. Gen. Virol. 79(Pt. 3):489-499.[Abstract]
  30. 16
  31. D'Souza, G., A. R. Kreimer, R. Viscidi, M. Pawlita, C. Fakhry, W. M. Koch, W. H. Westra, and M. L. Gillison. 2007. Case-control study of human papillomavirus and oropharyngeal cancer. N. Engl. J. Med. 356:1944-1956.[Abstract/Free Full Text]
  32. 17
  33. Du, J., G. G. Chen, A. C. Vlantis, P. K. Chan, R. K. Tsang, and C. A. van Hasselt. 2004. Resistance to apoptosis of HPV 16-infected laryngeal cancer cells is associated with decreased Bak and increased Bcl-2 expression. Cancer Lett. 205:81-88.[CrossRef][Medline]
  34. 18
  35. Elston, R. C., S. Napthine, and J. Doorbar. 1998. The identification of a conserved binding motif within human papillomavirus type 16 E6 binding peptides, E6AP and E6BP. J. Gen. Virol. 79(Pt. 2):371-374.[Abstract]
  36. 19
  37. Fairlie, D. P., M. L. West, and A. K. Wong. 1998. Towards protein surface mimetics. Curr. Med. Chem. 5:29-62.[Medline]
  38. 20
  39. Filippova, M., and P. J. Duerksen-Hughes. 2003. Inorganic and dimethylated arsenic species induce cellular p53. Chem. Res. Toxicol. 16:423-431.[CrossRef][Medline]
  40. 21
  41. Filippova, M., L. Parkhurst, and P. J. Duerksen-Hughes. 2004. The human papillomavirus 16 E6 protein binds to Fas-associated death domain and protects cells from Fas-triggered apoptosis. J. Biol. Chem. 279:25729-25744.[Abstract/Free Full Text]
  42. 22
  43. Filippova, M., H. Song, J. L. Connolly, T. S. Dermody, and P. J. Duerksen-Hughes. 2002. The human papillomavirus 16 E6 protein binds to tumor necrosis factor (TNF) R1 and protects cells from TNF-induced apoptosis. J. Biol. Chem. 277:21730-21739.[Abstract/Free Full Text]
  44. 23
  45. Foster, S. A., G. W. Demers, B. G. Etscheid, and D. A. Galloway. 1994. The ability of human papillomavirus E6 proteins to target p53 for degradation in vivo correlates with their ability to abrogate actinomycin D-induced growth arrest. J. Virol. 68:5698-5705.[Abstract/Free Full Text]
  46. 24
  47. Gardiol, D., S. Galizzi, and L. Banks. 2002. Mutational analysis of the discs large tumour suppressor identifies domains responsible for human papillomavirus type 18 E6-mediated degradation. J. Gen. Virol. 83:283-289.[Abstract/Free Full Text]
  48. 25
  49. Garland, S. M. 2002. Human papillomavirus update with a particular focus on cervical disease. Pathology 34:213-224.[CrossRef][Medline]
  50. 26
  51. Garnett, T. O., and P. J. Duerksen-Hughes. 2006. Modulation of apoptosis by human papillomavirus (HPV) oncoproteins. Arch. Virol. 151:2321-2335.[CrossRef][Medline]
  52. 27
  53. Garnett, T. O., M. Filippova, and P. J. Duerksen-Hughes. 2006. Accelerated degradation of FADD and procaspase 8 in cells expressing human papillomavirus 16 E6 impairs TRAIL-mediated apoptosis. Cell Death Differ. 13:1915-1926.[CrossRef][Medline]
  54. 28
  55. Gillison, M. L., W. M. Koch, R. B. Capone, M. Spafford, W. H. Westra, L. Wu, M. L. Zahurak, R. W. Daniel, M. Viglione, D. E. Symer, K. V. Shah, and D. Sidransky. 2000. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J. Natl. Cancer Inst. 92:709-720.[Abstract/Free Full Text]
  56. 29
  57. Griffin, H., R. Elston, D. Jackson, K. Ansell, M. Coleman, G. Winter, and J. Doorbar. 2006. Inhibition of papillomavirus protein function in cervical cancer cells by intrabody targeting. J. Mol. Biol. 355:360-378.[CrossRef][Medline]
  58. 30
  59. Hay, S., and G. Kannourakis. 2002. A time to kill: viral manipulation of the cell death program. J. Gen. Virol. 83:1547-1564.[Abstract/Free Full Text]
  60. 31
  61. Herrero, R., X. Castellsague, M. Pawlita, J. Lissowska, F. Kee, P. Balaram, T. Rajkumar, H. Sridhar, B. Rose, J. Pintos, L. Fernandez, A. Idris, M. J. Sanchez, A. Nieto, R. Talamini, A. Tavani, F. X. Bosch, U. Reidel, P. J. Snijders, C. J. Meijer, R. Viscidi, N. Munoz, and S. Franceschi. 2003. Human papillomavirus and oral cancer: the International Agency for Research on Cancer multicenter study. J. Natl. Cancer Inst. 95:1772-1783.[Abstract/Free Full Text]
  62. 32
  63. Huibregtse, J. M., M. Scheffner, and P. M. Howley. 1993. Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins. Mol. Cell. Biol. 13:4918-4927.[Abstract/Free Full Text]
  64. 33
  65. Kobayashi, T., K. Tsutsumi, D. Kuwahara, H. Iwatake, and T. Takakuwa. 2001. Resistance to Fas-mediated apoptosis in human papillomavirus type 16-immortalized human laryngeal epithelial cells after tumorigenesis. Nippon Jibiinkoka Gakkai Kaiho 104:139-146. (In Japanese.)[Medline]
  66. 34
  67. Lee, C., and L. A. Laimins. 2004. Role of the PDZ domain-binding motif of the oncoprotein E6 in the pathogenesis of human papillomavirus type 31. J. Virol. 78:12366-12377.[Abstract/Free Full Text]
  68. 35
  69. Li, B., and Q. P. Dou. 2000. Bax degradation by the ubiquitin/proteasome-dependent pathway: involvement in tumor survival and progression. Proc. Natl. Acad. Sci. USA 97:3850-3855.[Abstract/Free Full Text]
  70. 36
  71. Liu, Y., and J. D. Baleja. 2008. Structure and function of the papillomavirus E6 protein and its interacting proteins. Front. Biosci. 13:121-134.[CrossRef][Medline]
  72. 37
  73. Liu, Y., Z. Liu, E. Androphy, J. Chen, and J. D. Baleja. 2004. Design and characterization of helical peptides that inhibit the E6 protein of papillomavirus. Biochemistry 43:7421-7431.[CrossRef][Medline]
  74. 38
  75. Longworth, M. S., and L. A. Laimins. 2004. Pathogenesis of human papillomaviruses in differentiating epithelia. Microbiol. Mol. Biol. Rev. 68:362-372.[Abstract/Free Full Text]
  76. 39
  77. Lu, Z., X. Hu, Y. Li, L. Zheng, Y. Zhou, H. Jiang, T. Ning, Z. Basang, C. Zhang, and Y. Ke. 2004. Human papillomavirus 16 E6 oncoprotein interferences with insulin signaling pathway by binding to tuberin. J. Biol. Chem. 279:35664-35670.[Abstract/Free Full Text]
  78. 40
  79. Magal, S. S., A. Jackman, S. Ish-Shalom, L. E. Botzer, P. Gonen, R. Schlegel, and L. Sherman. 2005. Downregulation of Bax mRNA expression and protein stability by the E6 protein of human papillomavirus 16. J. Gen. Virol. 86:611-621.[Abstract/Free Full Text]
  80. 41
  81. Mantovani, F., and L. Banks. 2001. The human papillomavirus E6 protein and its contribution to malignant progression. Oncogene 20:7874-7887.[CrossRef][Medline]
  82. 42
  83. Melton, J. L., and J. E. Rasmussen. 1991. Clinical manifestations of human papillomavirus infection in nongenital sites. Dermatol. Clin. 9:219-233.[Medline]
  84. 43
  85. Motoyama, S., C. A. Ladines-Llave, S. Luis Villanueva, and T. Maruo. 2004. The role of human papillomavirus in the molecular biology of cervical carcinogenesis. Kobe. J. Med. Sci. 50:9-19.[Medline]
  86. 44
  87. Munger, K., A. Baldwin, K. M. Edwards, H. Hayakawa, C. L. Nguyen, M. Owens, M. Grace, and K. Huh. 2004. Mechanisms of human papillomavirus-induced oncogenesis. J. Virol. 78:11451-11460.[Free Full Text]
  88. 45
  89. Munger, K., and P. M. Howley. 2002. Human papillomavirus immortalization and transformation functions. Virus Res. 89:213-228.[CrossRef][Medline]
  90. 46
  91. Munger, K., M. Scheffner, J. M. Huibregtse, and P. M. Howley. 1992. Interactions of HPV E6 and E7 oncoproteins with tumour suppressor gene products. Cancer Surv. 12:197-217.[Medline]
  92. 47
  93. Narayan, V. A., R. W. Kriwacki, and J. P. Caradonna. 1997. Structures of zinc finger domains from transcription factor Sp1. Insights into sequence-specific protein-DNA recognition. J. Biol. Chem. 272:7801-7809.[Abstract/Free Full Text]
  94. 48
  95. Neidigh, J. W., R. M. Fesinmeyer, and N. H. Andersen. 2002. Designing a 20-residue protein. Nat. Struct. Biol. 9:425-430.[CrossRef][Medline]
  96. 49
  97. Niu, X. Y., Z. L. Peng, W. Q. Duan, H. Wang, and P. Wang. 2006. Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo. Int. J. Gynecol. Cancer 16:743-751.[CrossRef][Medline]
  98. 50
  99. Nomine, Y., M. Masson, S. Charbonnier, K. Zanier, T. Ristriani, F. Deryckere, A. P. Sibler, D. Desplancq, R. A. Atkinson, E. Weiss, G. Orfanoudakis, B. Kieffer, and G. Trave. 2006. Structural and functional analysis of E6 oncoprotein: insights in the molecular pathways of human papillomavirus-mediated pathogenesis. Mol. Cell 21:665-678.[CrossRef][Medline]
  100. 51
  101. Pitera, J. W., and W. Swope. 2003. Understanding folding and design: replica-exchange simulations of "Trp-cage" miniproteins. Proc. Natl. Acad. Sci. USA 100:7587-7592.[Abstract/Free Full Text]
  102. 52
  103. Shin, M. S., H. S. Kim, S. H. Lee, J. W. Lee, Y. H. Song, Y. S. Kim, W. S. Park, S. Y. Kim, S. N. Lee, J. Y. Park, J. H. Lee, W. Xiao, K. H. Jo, Y. P. Wang, K. Y. Lee, Y. G. Park, S. H. Kim, J. Y. Lee, and N. J. Yoo. 2002. Alterations of Fas-pathway genes associated with nodal metastasis in non-small cell lung cancer. Oncogene 21:4129-4136.[CrossRef][Medline]
  104. 53
  105. Shisler, J., C. Yang, B. Walter, C. F. Ware, and L. R. Gooding. 1997. The adenovirus E3-10.4K/14.5K complex mediates loss of cell surface Fas (CD95) and resistance to Fas-induced apoptosis. J. Virol. 71:8299-8306.[Abstract]
  106. 54
  107. Shisler, J. L., and B. Moss. 2001. Molluscum contagiosum virus inhibitors of apoptosis: the MC159 v-FLIP protein blocks Fas-induced activation of procaspases and degradation of the related MC160 protein. Virology 282:14-25.[CrossRef][Medline]
  108. 55
  109. Sterlinko Grm, H., M. Weber, R. Elston, P. McIntosh, H. Griffin, L. Banks, and J. Doorbar. 2004. Inhibition of E6-induced degradation of its cellular substrates by novel blocking peptides. J. Mol. Biol. 335:971-985.[CrossRef][Medline]
  110. 56
  111. Thomas, M., and L. Banks. 1998. Inhibition of Bak-induced apoptosis by HPV-18 E6. Oncogene 17:2943-2954.[CrossRef][Medline]
  112. 57
  113. Tong, X., and P. M. Howley. 1997. The bovine papillomavirus E6 oncoprotein interacts with paxillin and disrupts the actin cytoskeleton. Proc. Natl. Acad. Sci. USA 94:4412-4417.[Abstract/Free Full Text]
  114. 58
  115. Tourneur, L., A. Buzyn, and G. Chiocchia. 2005. FADD adaptor in cancer. Med. Immunol. 4:1.[CrossRef][Medline]
  116. 59
  117. Tungteakkhun, S. S., and P. J. Duerksen-Hughes. 2008. Cellular binding partners of the human papillomavirus E6 protein. Arch. Virol. 153:397-408.
  118. 60
  119. Wallach, D., E. E. Varfolomeev, N. L. Malinin, Y. V. Goltsev, A. V. Kovalenko, and M. P. Boldin. 1999. Tumor necrosis factor receptor and Fas signaling mechanisms. Annu. Rev. Immunol. 17:331-367.[CrossRef][Medline]
  120. 61
  121. Wang, G. H., J. Bertin, Y. Wang, D. A. Martin, J. Wang, K. J. Tomaselli, R. C. Armstrong, and J. I. Cohen. 1997. Bovine herpesvirus 4 BORFE2 protein inhibits Fas- and tumor necrosis factor receptor 1-induced apoptosis and contains death effector domains shared with other gamma-2 herpesviruses. J. Virol. 71:8928-8932.[Abstract]
  122. 62
  123. Zanardi, T. A., S. Yei, D. L. Lichtenstein, A. E. Tollefson, and W. S. Wold. 2003. Distinct domains in the adenovirus E3 RID{alpha} protein are required for degradation of Fas and the epidermal growth factor receptor. J. Virol. 77:11685-11696.[Abstract/Free Full Text]
  124. 63
  125. Zeng, M., A. Kumar, G. Meng, Q. Gao, G. Dimri, D. Wazer, H. Band, and V. Band. 2002. Human papillomavirus 16 E6 oncoprotein inhibits retinoic X receptor-mediated transactivation by targeting human ADA3 coactivator. J. Biol. Chem. 277:45611-45618.[Abstract/Free Full Text]
  126. 64
  127. zur Hausen, H. 2000. Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. J. Natl. Cancer Inst. 92:690-698.[Abstract/Free Full Text]


Journal of Virology, October 2008, p. 9600-9614, Vol. 82, No. 19
0022-538X/08/$08.00+0     doi:10.1128/JVI.00538-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tungteakkhun, S. S.
Right arrow Articles by Duerksen-Hughes, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tungteakkhun, S. S.
Right arrow Articles by Duerksen-Hughes, P. J.