Previous Article | Next Article ![]()
Journal of Virology, October 2008, p. 9306-9317, Vol. 82, No. 19
0022-538X/08/$08.00+0 doi:10.1128/JVI.00301-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Kansas State University, Manhattan, Kansas 66506,1 National Institute of Allergy and Infectious Disease, National Institutes of Health, Bethesda, Maryland 208922
Received 11 February 2008/ Accepted 10 July 2008
|
|
|---|
|
|
|---|
Although recent studies have presented evidence for the replication of human noroviruses in cells (1, 12, 29), studies of the replication of these viruses have been severely hampered by the lack of a reliable cell culture system (6). Among the noroviruses, only murine noroviruses (including MNV-1) (17) have been successfully propagated in cell culture (30). Murine noroviruses are present widely in laboratory mouse colonies without apparent clinical symptoms (13, 31). MNV-1 has a tissue tropism of macrophage-like cells in vivo and in vitro (30), but it is not clear if human noroviruses target such cells. In the present study, we hypothesized that LC might be associated with the efficient replication of vesiviruses in cell culture and as a consequence may promote human norovirus replication in cells. We constructed a recombinant plasmid containing cDNA encoding the LC from FCV under the control of the cytomegalovirus (CMV) promoter (pCI-LC) to test this hypothesis. Previously, we reported an NV replicon system (NV replicon-bearing cells) using a recombinant plasmid containing a full-length NV genome (pNV101) (8) with a neomycin resistance gene (Neor) in the place of VP1 (pNV-Neo) (3, 5). Using a similar strategy, we constructed pNV-GFP, where Neor was replaced by a gene encoding green fluorescent protein (GFP). We also constructed a similar plasmid with GFP inserted into the ORF2 of the infectious clone of FCV (pQ14), pQ-GFP, for comparative studies. Cotransfection studies with pNV101, pNV-GFP, pQ14, or pQ-GFP with pCI-LC showed that LC promoted the replication of both FCV and NV in cells. Furthermore, we found that this cotransfection method was useful in the identification of cis-acting elements for NV replication in cells, which provides a novel tool for studying RNA elements. Using this system, we identified RNA elements at the start of the subgenomic RNA and 3' end of NV genome essential for virus replication.
|
|
|---|
Plasmid construction and generation of region-specific antisera.
Standard recombinant DNA methods were used for the construction of plasmids. The consensus full-length clone of NV, pNV101, has been described previously (8). We reported pNV-Neo, which is used for generating NV replicon-bearing cells based in BHK21 or Huh-7 cells (5). We generated a similar reporter plasmid based on NV101 with a gene encoding GFP, pNV-GFP, to study the replication of NV (Fig. 1). For the construction of pNV-GFP, the GFP gene was amplified from the pAcGFP1 vector (Clontech, Mountain View, CA) with the primers GFP-NV-F (aattggatccTATGGTG AGCAAGGGCGAGGA) and GFP-NV-R (aattaccggtTCAAGCTCGAGATCTGAGTC) (the italic bases in the primers indicate the start and stop codons of GFP). The PCR product was digested with BamHI and AgeI (the sites underlined in the primers) and cloned into the corresponding sites of pNV-Neo. The resulting construct contained the GFP gene engineered into the 5'-end region of the ORF2 so that the expressed product would contain the first 33 aa of the VP1 fused in frame with GFP (Fig. 1B). Similarly, we constructed pNV-RL (for Renilla luciferase) after the Renilla luciferase was amplified with primers NV-Bam-Luc-F (ataaggatccTATGGAAGACGCCAAAAAC) and NV-Age-Luc-R (aattaccggtTTACAATTTGGACTTTCCG), using pRL-CMV (Promega, Madison, WI) as a template. The viral polymerase (Pol) active site, GDD in pNV101, pNV-GFP, or pNV-RL, was deleted by using a site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the primers N-
GDD-F (CATGTCATATTTCTCATTTTATGAGATTGTGTCAACTGACATAG) and N-
GDD-R (CTATGTCAGTTGACACAATCTCATAAAATGAGAAATATGACATG), generating the pNV101
GDD, pNV-GFP
GDD, or pNV-RL
GDD plasmids, respectively (underlined bases indicate the position of the deletion of nine bases encoding GDD between them). To examine transfection efficiency, we generated a plasmid expressing chimeric VP1(33aa)-GFP fused to the end of NV ORF1 by deleting a base (G) at position 5354 in pNV-GFP by mutagenesis. The primers used for this deletion were M5354DG-F (CTTCTGCCCGAATTCTAAATGAT GATGGCG) and M5354DG-R (CGCCATCATCATTTAGAATTCGGGCAGAAG) (underlined bases indicate the position of the deletion of G between them). Transfection of this plasmid yields expression of GFP, as a part of viral Pol-VP1(33aa)-GFP (unpublished observation). This plasmid was used to measure the transfection efficiency for the expression of NV ORF1 in MVA-T7-infected cells. We also generated pCI-GFP, which produces the expression of GFP under the CMV promoter control to measure overall transfection efficiency. The GFP gene was amplified by PCR using pAcGFP1 as a template with the primers GFP-Xho-F (aattctcgagATGGTGAGCAAGGGCGAGGA) and GFP-Not-R (aattgcggccgcTCAAGCTCGAGATCTGAGTC). The amplicon was cloned into pCI vector using the enzyme sites for XhoI and NotI.
![]() View larger version (18K): [in a new window] |
FIG. 1. Genomic organization of NV, FCV, and recombinant plasmids based on the full-length genome of NV or FCV. (A) Schematic diagram of the genome organization of NV and FCV. FCV has a unique protein, LC, at the start of the subgenomic RNA. (B) Recombinant plasmids of pNV101 (a plasmid containing the full-length genome of NV under the T7 promoter): pNV-GFP, pQ14 (an infectious clone of FCV), and pQ-GFP. pNV-GFP was generated using unique sites of BamHI and AgeI in ORF2 of the NV genome, and GFP gene was cloned in place of VP1. pQ-GFP was generated using the unique restriction sites SanDI and SpeI in ORF2 of the FCV genome, and the GFP gene was cloned in the place of LC and VP1.
|
GDD-F (CGACATGATGACTTATGGTGTTTACATGTTTC) and FCV-
GDD-R (GAAACATGTAAACACCATAAGTCATCATGTCG), generating pQ14
GDD and pQ-GFP
GDD, respectively. To examine the effects of LC from FCV on the replication of FCV or NV, we generated a plasmid containing the LC gene under the control of CMV promoter (pCI-LC). For the pCI-LC, the region encoding LC in FCV was amplified with the primers FCVLC-Xho-F (aattctcgagATGTGCTCAACCTGCGCTAACG) and FCVLC-Not-R (aattgcggccgcTTATCATTCCAATCTGAACAATGGCA) by PCR, using pQ14 as a template. The amplicon was cloned into pCI vector using the enzyme sites of XhoI and NotI. Similarly, we generated a plasmid containing the V gene of simian virus 5 (SV5) under the control of the CMV promoter (pCI-V). The gene encoding the V protein in SV5 (DA strain) was amplified with the primers SV5V-Nhe-F (aattgctagcATGGATCCCACTGATCTGAGC) and SV5V-Not-R (aattgcggccgcTTAAGTATCTCGTTCACATTCAG) by reverse transcription-PCR (RT-PCR), using viral RNA as a template. The RT-PCR was performed using the following conditions: 45°C for 30 min (for RT) and 95°C for 10 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 1 min, and elongation at 72°C for 1 min. The amplicon was cloned into pCI vector using the enzyme sites of NheI and NotI. Also, we generated a plasmid, pNVP1 to express NV VP1 in cells for a control. The region encoding NV VP1 was amplified by PCR with the primers NVP1-Xho-F (aattctcgagATGATGATGGCGTCTAAGG) and NVP1-Not-R (aattgcggccgcTTATCGGCGCA GACCAAGC) (the italic bases in the primers indicate the start and stop codons of VP1) using pNV101 as a template. The amplicon was cloned into pCI vector using the enzyme sites XhoI and NotI.
Transfection study.
All transfections were performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) with 2 µg of each plasmid per well in six-well plates (ca. 1 x 106 to 2 x 106 cells). Cells including BHK21, HEK293T, or Vero cells were infected with the modified vaccinia virus (Ankara strain) expressing T7 Pol (MVA-T7) (32) at a multiplicity of infection of 10 for 1 h before transfection. The plasmid pNV101, pNV-GFP, pQ14, pQ-GFP, pNV101
GDD, pNV-GFP
GDD, pQ14
GDD, or pQ-GFP
GDD was transfected alone or cotransfected with pCI-LC or pCI-V to study the effects of LC or V in the replication of FCV or NV. The plasmid NV-GFP or pNV-GFP
GDD was also cotransfected with pCI-LC and pCI-V to study the combined effects of LC and V on NV replication. Similarly, each mutant plasmid of pNV-GFP (described below) was cotransfected with pCI-LC and pCI-V into MVA-T7-infected Vero cells to study cis-acting elements of NV. After transfection, the replication of FCV or NV was monitored by detecting the expression of VP1 or GFP (GFP-based constructs) with the various assays described below. In addition, plasmid pNV-RL or plasmid pNV-RL
GDD was transfected alone or with pCI-LC, pCI-V, or pCI-LC plus pCI-V into MVA-T7-infected Vero cells. For the control of this transfection, we used pCI and pNV-GFP. At 20 h posttransfection, cell lysates were prepared for Renilla luciferase activity using the Renilla luciferase assay system (Promega).
Virus replication assay. Virus replication was measured by various assays including immunofluorescence assay (IFA), Western blot analysis, enzyme-linked immunosorbent assay (ELISA), plaque-forming assay (for FCV), and flow cytometry analysis.
(i) Detection of NV or FCV VP1. The expression of NV or FCV VP1 was measured by IFA using antibody against NV virus-like particles (VLPs) or FCV virions. Cells transfected with various plasmids were fixed with cold methanol at 18 to 24 h posttransfection for IFA. Monoclonal antibody to NV VLPs or polyclonal antibody (guinea pig serum) to FCV virions were added to the fixed monolayers, and the binding of antibodies was detected with fluorescein isothiocyanate-conjugated, affinity-purified goat antibodies to mouse or guinea pig immunoglobulin G (Sigma-Aldridge, St. Louis, MO) as described previously (4). NV VP1 was also detected by Western blot analysis using polyclonal antibody to the protein as described previously (5). We also used ELISA for detecting NV VP1 after the transfections. Briefly, 96-well plates (Nunc, Rochester, NY) were coated with monoclonal antibody to NV VP1 as a capture antibody. Reagents were added to triplicate wells in the following sequence: cell lysate samples; hyperimmune guinea pig antiserum specific for NV VP1; goat anti-guinea pig immunoglobulin G conjugated to horseradish peroxidase; and the substrate tetramethylbenzidine (Kirkegaard & Perry Laboratories, Gaithersburg, MD). The absorbance was measured at 610 nm. The cutoff value was calculated as an absorbance at 610 nm that was at three standard deviations above the absorbance in cell control wells (cells infected with MVA-T7).
(ii) Detection of NV genome. To examine NV genome levels in the cells with various transfections, real-time quantitative RT-PCR (qRT-PCR) was performed by using a One-Step Platinum qRT-PCR kit (Invitrogen) according to the protocol established for the analysis of genogroup 1 norovirus samples (15). The primers COG1F (CGYTGGATGCGNTTYCATGA) and COG1R (CTTAGACGCCATCATCATTYAC) and the probe RING1(a)-TP (FAM-AGATYGCGATCYCCTGTCCA-TAMRA) were used for the real-time qRT-PCR, which targets genomic RNA (sequence between positions 5291 and 5375) (15). As a quantity control of cellular RNA levels, qRT-PCR for β-actin with the primers actin-F (GGCATCCACGAAACTACCTT) and actin-R (AGCACTGTGTTGGCGTACAG) and the probe actin-P (HEX-ATCATGAAGTGTGACGTGGACATCCG-TAMRA) was performed as described previously (3, 28). For qRT-PCR, the total RNA of cells (in six-well plates) was extracted with an RNeasy kit (Qiagen, Valencia, CA). The qRT-PCR amplification was performed in a Cepheid SmartCycler with the following parameters: 45°C for 30 min and 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 50°C for 1 min, and elongation at 72°C for 30 s. The relative genome levels in cells with various transfection were calculated after the RNA levels were normalized with those of β-actin.
(iii) Expression of GFP. After the transfection of plasmids encoding the GFP gene, GFP-positive cells were detected by fluorescence microscopy or enumerated by using flow cytometry analysis. After 16 to 20 h of transfection, the cells were treated with trypsin, fixed with 4% formaldehyde for 1 h, and then washed twice with phosphate-buffered saline by centrifugation and resuspended with phosphate-buffered saline. Flow cytometry analysis was performed on a population of 10,000 cells by using a FACSCalibur (BD Biosciences, Franklin Lakes, NJ).
Mutagenesis of potential cis-acting elements in pNV-GFP. The potential promoter or cis-acting elements located at the start of subgenomic RNA or the 3' end in NV genome was examined by substitution and deletion mutagenesis of pNV-GFP (see Fig. 6A and 7). First, we generated a series of substitute mutants at the start of the subgenomic RNA focusing on four untranslated bases, GUAA, using the primers listed in Table 1. The substitution mutants at the first base (G) in the subgenomic RNA to U, A, or C were designated as pNV-GFP-G5354U, pNV-GFP-G5354A, or pNV-GFP-G5354C, respectively. These mutations resulted in amino acid changes in the sequences of the virus Pol from valine to leucine (pNV-GFP-G5354U) or isoleucine (pNV-GFP-G5354A and pNV-GFP-G5354C). The second base (U) in the subgenomic RNA was also mutated to A, C, or G with the plasmids designated pNV-GFP-U5355A, pNV-GFP-U5354C, or pNV-GFP-U5354G, yielding amino acid changes from valine to glutamic acid, alanine, or glycine, respectively. The third base (A) was mutated to U, C, or G with the plasmids designated pNV-GFP-A5356U, pNV-GFP-A5356C, or pNV-GFP-A5356G (all were silent mutations). Mutation of the fourth base (A) to U, C, or G yielded plasmids designated pNV-GFP-A5357U, pNV-GFP-A5357C, or pNV-GFP-A5357G. These mutations changed the asparagine to tyrosine, histidine, or aspartic acid, respectively. Second, to examine the RNA elements at the 3' end of NV genome for virus replication, we generated a series of deletion mutations targeting the regions between the stop codon of GFP and the end of genome (Fig. 7). Nine deletion mutants were generated between the bases after the GFP gene, and the deletions corresponded to bases 7080, 7089, 7480, 7500, 7534, 7600, 7610, 7630, and 7640 (Fig. 7). These mutations were generated by inserting an AgeI site at the desired bases using the mutagenesis kit and primers listed in Table 1. The plasmids containing the mutants were digested with AgeI, which removed the deletion fragments and then they were religated to generate each mutant plasmid. The presence of the mutation for all plasmids described above was confirmed by sequencing analysis.
![]() View larger version (50K): [in a new window] |
FIG. 6. Mutagenesis study for the potential promoter activity at the start of subgenomic RNA of NV genome. (A) Conserved bases at the start of NV genome and subgenomic RNA. The first 26 conserved bases contain the start codons (boldface) for ORF1 and VP1 and the stop codon for ORF1 (underlined). In pNV-GFP, the GFP gene was inserted in place of VP1 using the BamHI site (positions 5465 to 5470). (B) GFP-positive cells observed under a fluorescent (left panel) or a light microscope (right panel) after Vero cells were cotransfected with pNV-GFP-G5354C or pNV-GFP-U5355G and pCI-LC plus pCI-V (after MVA-T7 infection). (C) Flow cytometry analysis of Vero cells were cotransfected with pNV-GFP-G5354C or pNV-GFP-U5355G and pCI-LC plus pCI-V (after MVA-T7 infection).
|
![]() View larger version (14K): [in a new window] |
FIG. 7. Mutagenesis study for cis-acting elements in 3'-end region of NV genome. (A) Schematic diagram of the 3'-end region of NV genome including ORF2, ORF3, and 3'UTR. The enzyme site of AgeI is located at positions 6753 to 6758 in ORF2, and there are 66 bases in the 3'UTR between the stop codon of VP2 (ORF3) and the poly(A) tail. (B) Summary of deletion mutants targeting ORF2, ORF3, and 3'UTR and GFP expression after cotransfection of each mutant, pCI-LC and pCI-V into MVA-T7-infected Vero cells.
|
|
View this table: [in a new window] |
TABLE 1. Primers used in the mutagenesis study
|
|
|
|---|
![]() View larger version (58K): [in a new window] |
FIG. 2. Transfection of pQ14 or pQ-GFP with or without pCI-LC into MVA-T7-infected Vero cells. (A) Flow cytometry analysis of cells transfected with pQ-GFP alone (upper panel), cotransfected with pQ-GFP and pCI-LC (middle panel), or cotransfected with pQ-GFP GDD and pCI-LC (bottom panel) into MVA-T7-infected Vero cells. In all flow cytometry analyses, cells were collected after 18 to 20 h of transfection, and the figures represent the counts of 10,000 cells with cell size (y axis) and GFP expression (x axis). The numbers in the panel represent the averages and standard deviations of at least three independent experiments in all figures. An asterisk (*) indicates that the number of GFP-expressing cells by cotransfection with pQ-GFP and pCI-LC was significantly higher (P < 0.05) than the transfection with pQ-GFP alone. (B) In the upper panel, GFP-positive cells were observed under a fluorescence microscope after Vero cells were transfected with pQ-GFP alone (left panel), pQ-GFP plus pCI-LC (middle panel), or pQ-GFP GDD plus pCI-LC (right panel). In the bottom panel, IFA staining was performed with antibody against FCV VP1 after Vero cells were transfected with pQ14 alone (left panel), pQ14 plus pCI-LC (middle panel), or pQ14 GDD plus pCI-LC (right panel). (C) Plaque-forming assay of recovered progeny viruses after Vero cells were transfected with pQ14 alone (upper panel) or pQ14 plus pCI-LC (bottom panel).
|
2-fold over those with pQ14 or pQ-GFP transfection alone (Fig. 2A and B). The number of GFP expressing cells by the cotransfection with pCI-LC and pQ-GFP was significantly higher (P < 0.05) than the transfection with pQ-GFP alone. Although the cotransfection increased the number of GFP-positive cells, the overall intensity of GFP expression in each cell was reduced by the cotransfection. In Fig. 2A, the distribution of GFP-expressing cells leaned toward to the cutoff line by the cotransfection with pQ-GFP and pCI-LC (middle panel) compared to the transfection with pQ-GFP alone (upper panel). The virus titers after the transfection of pQ14 with or without pCI-LC in Vero cells were similar to each other, yielding approximately 2 x 103 PFU/ml (Fig. 3C). Transfection of pQ14
GDD or pQ-GFP
GDD with or without pCI-LC did not produce VP1- or GFP-positive cells above the level of the control MVA-T7-infected cells (Fig. 2A and B).
![]() View larger version (57K): [in a new window] |
FIG. 3. Transfection of pNV-GFP or pNV-GFP GDD with or without pCI-LC into MVA-T7-infected Vero cells. (A) GFP-positive cells observed under a fluorescent (left panel) or a light microscope (right panel) after cells were transfected with pNV-GFP with or without pCI-LC. Cotransfection of pNV-GFP GDD and pCI-LC served as a negative control, and transfection of pNV-ORF1-GFP serves as a measurement of transfection efficiency in the present study. (B) Flow cytometry analysis to enumerate GFP-positive cells after the transfection of pNV-GFP, pCI-GFP plus pCI-LC, pNV-GFP GDD plus pCI-LC, or pNV-ORF1-GFP into MVA-T7-infected Vero cells. The numbers in the panel represent the averages and standard deviations of at least three independent experiments in the figures.
|
GDD with or without pCI-LC into MVA-T7-infected Vero, BHK21, and HEK293T cells did not yield GFP-positive cells by fluorescence microscopy or flow cytometry analysis (Fig. 3A and B). The transfection study with pNV-RL or pNV-RL
GDD was consistent with the results of pNV-GFP or pNV-RL
GDD, showing that while transfection of pNV-RL alone induced a slight increase in Renilla luciferase expression, the cotransfection with pCI-LC significantly increased (P < 0.01) the expression levels of Renilla luciferase (Table 2). |
View this table: [in a new window] |
TABLE 2. Expression of Renilla luciferase after transfection of pNV-RL or pNV-RL GDD alone or with pCI-LC, pCI-V, or pCI-LC+pCI-V into MVA-T7-infected Vero cells
|
GDD), the transfection of this mutant plasmid with or without pCI-LC in cells did not produce any expression of VP1 (Fig. 4). The NV RNA levels after the transfection measured by real-time qRT-PCR showed that cotransfection of pNV101 or pNV-GFP with pCI-LC increased the RNA levels
2-fold (P < 0.05) over those of cells transfected with pNV101 or pNV-GFP alone (Table 3).
![]() View larger version (37K): [in a new window] |
FIG. 4. Transfection of pNV101 or pNV101 GDD with or without pCI-LC into MVA-T7-infected Vero cells. (A) IFA staining (with monoclonal antibody) detecting NV VP1 in cells transfected with pNV101 with or without pCI-LC (magnification, x100). A cell in the box in the bottom panel shows the expression of NV VP1 in the cytoplasm with a higher magnification (x400). (B) Western blot analysis detecting NV VP1 in cells transfected with pNV101 with or without pCI-LC. Transfection of pCI-NVP1 serves as the positive control for VP1 expression in the transfected cells. (C) ELISA to detect NV VP1 in cell lysates after transfecting pNV101 with or without pCI-LC into MVA-T7-infected Vero cells. Transfection of pCI-NVP1 or cotransfection pNV-GFP GDD and pCI-LC serves as a positive or negative control, respectively, in the present study. The cutoff value was calculated as the average ±3 standard deviations of cell lysates prepared with the transfection of mock-medium into MVA-T7-infected cells. An asterisk (*) indicates that the level of VP1 expression by cotransfection with pCI-LC and pNV101 was significantly higher (P < 0.05) than the transfection with pNV101 alone.
|
|
View this table: [in a new window] |
TABLE 3. NV RNA levels after transfection of pNV-GFP or pNV-GFP alone or with pCI-LC in MVA-T7-infected Vero cells detected by real-time qRT-PCR
|
![]() View larger version (28K): [in a new window] |
FIG. 5. Transfection of pNV-GFP alone, pNV-GFP+pCI-V, or pNV-GFP+pCI-LC+pCI-V in MVA-T7-infected Vero cells. (A) GFP-positive cells observed under fluorescence after cells were transfected with pNV-GFP alone (left panel), pNV-GFP+pCI-V (middle panel), or pNV-GFP+pCI-LC+pCI-V (right panel). (B) Flow cytometry analysis to enumerate GFP-positive after cells were transfected with pNV-GFP alone (left panel), pNV-GFP+pCI-V (middle panel), or pNV-GFP+pCI-LC+pCI-V (right panel).
|
|
View this table: [in a new window] |
TABLE 4. Summary of mutagenesis study
|
![]() View larger version (74K): [in a new window] |
FIG. 8. Cotransfection of each pNV-GFP mutant, pCI-LC, and pCI-V into MVA-T7-infected Vero cells. (A) GFP-positive cells observed under a fluorescence microscope after cells were transfected with pNV-GFP-d7500 or pNV-GFP-d7534 and pCI-LC plus pCI-V. The bottom panel is the corresponding area observed under a light microscope (after MVA-T7 infection). (B) Flow cytometry analysis to enumerate GFP-positive cells after Vero cells were transfected with pNV-GFP-d7500 or pNV-GFP-d7534 and pCI-LC plus pCI-V (after MVA-T7 infection).
|
|
|
|---|
2-fold in these cell lines (Fig. 2A and B). Although the number of cells expressing GFP or VP1 increased by the cotransfection, virus titers after the transfection of pQ14 with or without pCI-LC were similar to each other (Fig. 2C). One possible explanation is that the intensity of GFP and VP1 expression was reduced by the cotransfection with pCI-LC in the cells (Fig. 2A and B), which may offset the titers. The overexpression of LC triggers morphological changes (cell rounding) and apoptosis of cells (unpublished observation). We also found that LC significantly reduced the expression of luciferase under the promoter of CMV after transfection (unpublished observation), suggesting that it might have an inhibitory effect on overall protein translation, probably due to the apoptosis. We are conducting further experiments to examine the role of LC in protein translation and apoptosis in correlation with the increased expression of FCV VP1 and GFP. When testing pCI-based plasmids containing LC from other FCV strains such as F9 (vaccine strain) or Ari (22) for the cotransfection study, we observed similar results, as they enhanced the expression of VP1 or GFP with FCV-based plasmids (unpublished observation). When we performed the same experiments with the reporter plasmids of NV, we found that LC promoted the replication of NV as well. First, the transfection of pNV101 or pNV-GFP into MVA-T7-infected cells (BHK21, HEK293T, or Vero cells) produced few VP1- or GFP-positive cells. However, cotransfection of pNV101 or pNV-GFP and pCI-LC produced significantly increased numbers of VP1- or GFP-positive cells, respectively, in those cells. The percentage of GFP-positive cells after the cotransfection of pNV-GFP and pCI-LC was ca. 3% of the whole population (Fig. 3). Cotransfection of pNV-GFP and pCI-V also produced increased numbers of GFP-expressing cells, indicating the importance of innate immunity as a restriction factor for NV replication in cells. Furthermore, we found that there were synergistic effects of LC and V in promoting NV replication. We observed similar results with the full-length clone of NV, pNV101. Although transfection of pNV101 alone produced few VP1-positive cells, cotransfection of pNV101 and pCI-LC resulted in significant numbers of cells expressing VP1 as detected by various methods including IFA, Western blot analysis, and ELISA. Using IFA with monoclonal antibody against NV VP1, we could observe distinct localization of VP1 in the cells reminiscent of that of MNV-1-infected cells (Fig. 4A) (30), suggesting that VP1 may be the part of the replicase complexes and/or virions are assembled within the replicase complexes during the replication of NV in cells. Since the transfection of pQ14 resulted in the production of approximately 2 x 103 PFU of viable viruses/ml, it is possible that the cotransfection of pNV101 and pCI-LC produces viable viruses in cells. We are currently working on the identification of viable NV or NV particles in the supernatant and/or cell lysates of the cotransfection. To rule out the effects of MVA-T7 in NV replication in the cotransfection study, we used BHK21 cells stably expressing T7 Pol for the cotransfection study and found similar results. Cotransfection of pNV-GFP and pCI-LC into the cells yielded GFP-positive cells but with much less efficiency than the MVA-T7 system (unpublished observation).
Using the cotransfection approach, we could identify potential cis-acting elements for NV replication. This is a significant advance because this cell-based system provides a valuable tool to study RNA elements for the fastidious virus. In the present study, we focused on RNA elements at the beginning of the subgenomic RNA and 3'-end region, including 3'UTR and ORF3 for NV replication. Our first observation noted that the first base (G) at the beginning of subgenomic RNA was essential for virus replication. The mutant plasmids with substitution to other bases at the first base (G) did not produce any GFP-positive cells. It has been postulated that the first base G is the site of VPg linkage, and the mutations may abolish this activity. The second base (U) is also important in the virus replication, and the mutation to bases other than G abolished the replication, as confirmed through the cotransfection study (Table 4). However, we cannot rule out that the lack of GFP expression by pNV-GFP-G5354U, pNV-GFP-G5354A, pNV-GFP-G5354C, pNV-GFP-U5355A, or pNV-GFP-U5355C is due to defects in Pol activity because the mutations also altered the amino acids at the end of the enzyme (Table 4). The third and fourth bases were not essential for virus replication, and substitution mutations only slightly reduced GFP-positive cells in the cotransfection experiments. As for RNA bases essential for NV replication at the 3' end of genome, we found that both the 3'UTR (66 bases) and the last stretch of bases encoding VP2 were essential for virus replication (Table 4 and Fig. 7 and 8). This finding was in accordance with our previous studies with FCV in which we also demonstrated that the ORF3 nucleotide sequence itself overlaps a cis-acting RNA signal at the genomic 3' end (26). It is possible that the secondary RNA structures in the region may interact with viral replicase complexes for successful replication. We plan to generate additional mutants in the region based on the predicted RNA structure to examine its roles in NV replication.
In summary, we conclude that LC may be a viral factor that promotes the replication of NV in cells. Also, we found that inhibiting the STAT1 pathway promoted NV replication. At present, we are trying to produce cell lines constitutively expressing LC, V, or LC plus V to examine whether they support NV replication without cotransfection. It is not yet clear by what mechanism LC has an effect on the replication of FCV and NV. It is possible that LC may interfere with the IFN pathway or interact with viral components to promote virus replication. We are currently conducting experiments to identify the potential mechanisms focused on the role of LC in the IFN pathway and interaction with viral proteins. We also report a reliable NV replicon system with reporter genes to study the replication of NV. Identification of viral or cellular factors which promote NV replication could provide vital clues to growing the fastidious human noroviruses in cell culture.
This paper is contribution no. 08-208-J from the Kansas Agricultural Experiment Station.
Published ahead of print on 16 July 2008. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»