This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeHart, J. L.
Right arrow Articles by Planelles, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeHart, J. L.
Right arrow Articles by Planelles, V.

 Previous Article  |  Next Article 

Journal of Virology, September 2008, p. 9265-9272, Vol. 82, No. 18
0022-538X/08/$08.00+0     doi:10.1128/JVI.00377-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Human Immunodeficiency Virus Type 1 Vif Induces Cell Cycle Delay via Recruitment of the Same E3 Ubiquitin Ligase Complex That Targets APOBEC3 Proteins for Degradation{triangledown} ,{ddagger}

Jason L. DeHart,1,{dagger} Alberto Bosque,1,{dagger} Reuben S. Harris,2 and Vicente Planelles1*

Division of Cellular Biology and Immunology, Department of Pathology, University of Utah School of Medicine, 15 North Medical Drive East no. 2100, Room 2520, Salt Lake City, Utah 84112,1 Biochemistry, Molecular Biology and Biophysics Department, University of Minnesota, 321 Church Street South East, 6-155 Jackson Hall, Minneapolis, Minnesota 554552

Received 21 February 2008/ Accepted 27 June 2008


arrow
ABSTRACT
 
Human immunodeficiency virus type 1 (HIV-1) Vif recruits a Cullin 5 ubiquitin ligase that targets APOBEC3 proteins for degradation. Recently, Vif has also been shown to induce cell cycle disturbance in G2. We show that in contrast to the expression of Vpr, the expression of Vif does not preclude cell division, and therefore, Vif causes delay and not arrest in G2. We also demonstrate that the interaction of Vif with the ubiquitin ligase is required for cell cycle disruption, as was previously shown for HIV-1 Vpr. The presence of APOBEC3 D/E, F, and G had no influence on Vif-induced alteration of the cell cycle. We conclude that cell cycle delay by Vif is a result of ubiquitination and degradation of a cellular protein that is different from the known APOBEC3 family members.


arrow
TEXT
 
Many viruses affect the cell division cycle to enhance viral replication. DNA tumor viruses induce progression through the cell cycle, and they do so through virally encoded proteins that prevent the retinoblastoma protein (pRB) from blocking E2F-mediated transcription of genes required for cell division (reviewed in references 12 and 27). Herpes simplex virus type 1 (HSV-1) blocks the progression from G1 to S by preventing pRB phosphorylation, therefore stabilizing the pRB/E2F association that keeps E2F inactive. HSV-1 achieves this blockage through the action of the virally encoded protein ICP27 (11, 38). Human cytomegalovirus blocks the transition from G1 to S through expression of the UL69 protein (14). The nonstructural protein 1 (NS1) of the autonomous parvovirus of mice induces cell cycle arrest in G2 in dividing cells and sensitizes transformed cells to apoptotic cell death (26). Members of the paramyxovirus family, such as measles virus and simian virus 5 (SV5) are also known to hinder cell cycle progression. Specifically, SV5, through expression of the V protein, induces a complex cell cycle disturbance consisting of an S-phase delay in some infected cells and a G2/M arrest in other infected cells (21). A well-known function of the SV5 V protein (pV) is its ability to bind to a Cul4-based E3 ubiquitin ligase via binding to the damaged DNA binding protein 1 (DDB1), which then recruits members of the signal transducer and activator of transcription (STAT) protein family and triggers their ubiquitination and proteasomal degradation (17). Through the degradation of STAT proteins, pV helps overcome type I interferon signaling in infected cells (17). Whether cell cycle alteration is related to or independent of pV's ability to degrade STAT is a question that remains unanswered. A potential link between the two effects stems from the observation that DDB1 can act as a cofactor for E2F1 to promote transcription of DNA replication and cell division genes, processes that would be hindered by pV binding to DDB1 (15).

Human immunodeficiency virus type 1 (HIV-1) encodes four accessory proteins, Vif, Vpr, Vpu, and Nef, which regulate multiple aspects of the host cell biology. Of the four proteins, Vif, Vpr, and Vpu have been shown to interact with and manipulate various Cullin-RING E3 ubiquitin ligases (9, 16, 22). Vif interacts with a Cullin 5-ElonginB/C E3 ligase to target the cytidine deaminases apolipoprotein B-editing catalytic subunit 3 (APOBEC3) D/E, F, and G for polyubiquitination and degradation. In doing so, HIV-1 overcomes host restrictions imposed by APOBEC3G and, to a lesser extent, those imposed by APOBEC3 D/E and F (16). Likewise, Vpu has been shown to target CD4 via a Cullin 1-βTRCP1 E3 ligase, resulting in enhanced release of viral particles (22). Recently, several groups have demonstrated that Vpr interacts with the Cullin 4-DDB1-DCAF1 E3 ligase (6, 10, 18, 20, 34, 39, 41). This interaction results in the polyubiquitination and degradation of an as-yet-unidentified protein, leading to ATR activation and subsequent cell cycle arrest in G2.

Previous reports have shown that Vpr induces G2 arrest when it is expressed ectopically or in the context of full-length, replication competent HIV-1 strains (19, 33, 47). However, it has also been reported that while the deletion of Vpr from the HIV-1 genome largely relieves G2 arrest, a moderate amount of infected cells still accumulate in G2 (5, 47). Recent work has demonstrated that the HIV-1 Vif accessory protein is responsible for this residual G2 accumulation (33, 40), although the mechanism for this effect remains unclear.

In the present work, we set out to investigate the potential role the ubiquitin proteasome system may play in Vif-induced G2 disturbance and whether the presence or absence of the APOBEC3 family members is required for the observed arrest.

Vif-induced G2 accumulation is independent of APOBEC3 D/E, F, and G expression. We constructed isogenic, envelope-defective HIV-1 (DHIV) mutants that differed in the vif and/or vpr open reading frame (Fig. 1A). DHIV-VifVpr encodes both wild-type (wt) Vif and wt Vpr. DHIV-Vpr encodes wt Vpr and is defective for Vif due to a premature stop codon at position 86 (STOP86), which was introduced by site-directed mutagenesis. DHIV-Vif encodes wt Vif and a truncated, inactive Vpr protein that was the result of a frameshift mutation at codon 64 (Fig. 1A, FS64), as described previously (29). DHIV-{Delta}Vif{Delta}Vpr combines both of the above mutations (STOP86 in Vif and FS64 in Vpr). The nef gene was replaced with a cDNA for the murine Thy1.2 glycoprotein, whose expression facilitates the discrimination of infected versus uninfected cells and the costaining for DNA content (28). The presence or absence of nef had no influence on the cell cycle profile of cells infected with DHIV or with full-length viruses (data not shown).


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 1. Vif and Vpr induce cell cycle accumulation in G2 in an additive manner. (A) Schematic diagram of an envelope-defective vector system. The nef open reading frame was replaced by that of the murine Thy1 (muThy1) glycoprotein. Production of infectious virus was achieved by cotransfection with an expression vector for the vesicular stomatitis virus glycoprotein G. Point mutations in Vif and Vpr used in this study are shown. DHIV-VifVpr encodes wt Vif and Vpr. DHIV-Vif encodes wt Vif and a truncated, nonfunctional Vpr (FS64). DHIV-Vpr encodes wt Vpr and truncated, nonfunctional Vif (STOP86). (B) SupT1-transformed lymphocytes were infected with various defective vectors as indicated, and at 48 h postinfection, the cell cycle profile of infected cells was stained for muThy1.2 and DNA content; electronic gating for muThy1.2-positive cells allowed for analysis of infected cells. DHIV-{Delta}Vif{Delta}Vpr encodes both nonfunctional Vif and Vpr. (C) HEK293T cells were transfected by calcium phosphate precipitation with empty vector or with an expression vector for the indicated APOBEC3 variants fused to an amino-terminal V5 epitope tag. At 24 h posttransfection, cells were infected with the indicated viral vectors. At 48 h post infection, cells were stained for DNA content and analyzed as described in the legend to panel B. Transfection efficiencies, as estimated by green fluorescent protein from an internal control construct in each transfection, were equal to or greater than 90%. (D) APOBEC3 expression from cells shown in panel C was verified by Western blotting using an antibody to the V5 tag.

The cell cycle profiles of infected cells (Fig. 1B) showed that DHIV induced 57% of cells to arrest in G2, DHIV-Vpr induced 48%, and DHIV-Vif induced 32%. DHIV-{Delta}Vif{Delta}Vpr virus induced a minor change in the cell cycle profile (19% of cells were induced to arrest by DHIV-{Delta}Vif{Delta}Vpr infection compared to 13% by mock infection [Fig. 1B]). The multiplicities of infection (MOIs) for the above and also for subsequent experiments in this study were carefully set between 1 and 2, such that the percentage of infected cells was between 60 and 80%.

Since Vif has previously been shown to induce the degradation of APOBEC3 D/E, F, and G (8, 35, 43, 45), we asked whether the presence or absence of APOBEC3 D/E, F, or G would influence the cell cycle alteration. HEK293T cells are naturally negative for APOBEC3 D/E, F, and G (8, 45). Using transient transfection, we generated HEK293T cells expressing APOBEC3 D/E, F, G, or empty vector (8, 45), and then these cells were infected with various DHIV mutants and assayed for their cell cycle profiles (Fig. 1C). Expression of APOBEC3 proteins was verified by Western blotting using a V5-specific antibody (Fig. 1D). The results indicated that Vif can induce G2 accumulation irrespective of the presence or absence of APOBEC3D/E, F, and G. A similar experiment was performed using increasing amounts of APOBEC3 expression vectors, and the results confirmed that the overexpression of APOBEC3 proteins failed to relieve Vif-induced cell cycle alteration (see Fig. S1 in the supplemental material).

Vif-induced G2 accumulation requires a Cul5-based E3 ligase. The notion that APOBEC3 D/E, F, and G are not associated with Vif-induced G2 delay does not exclude the possibility that ubiquitination and degradation of other target proteins may mediate cell cycle disruption. Therefore, we wished to determine whether the ubiquitin ligase machinery was required. We predicted that if the Cul5/ElonginB/C ligase is required, then mutations in Vif that disrupt Cul5 or Elongin B/C interactions would ablate Vif's ability to induce G2 delay. We introduced the mutations C114S and L145A, which disrupt the interactions of Vif with Cul5 and with Elongin B/C, respectively (23, 25, 42), into DHIV-Vif to produce the DHIV-Vif(C114S) and DHIV-Vif(L145A) vectors and infected SupT1 cells. As shown in Fig. 2A, infections with DHIV-Vif(C114S) or DHIV-Vif(L145A) resulted in little or no cell cycle delay, compared to infection with DHIV-Vif. As negative controls, mock infection and infection with DHIV-{Delta}Vif{Delta}Vpr also failed to induce G2 accumulation. Expression levels for Vif were confirmed by Western blotting (Fig. 2B). Vif(C114S) was expressed at levels similar to those of wt Vif, whereas Vif(L145A) showed lower expression levels. The lower level of expression of Vif(L145A) could explain its inability to cause detectable G2 delay. To rule out this possibility, we performed an additional experiment in which increasing MOIs of DHIV-Vif(L145A) were used to infect cells. Cell cycle analysis of these infections revealed that even under conditions where Vif(L145A) was expressed to levels similar to those of wt Vif, G2 delay was not observed (see Fig. S2A and B in the supplemental material).


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 2. G2 accumulation by Vif is dependent on residues required for interaction with Cul5 and Elongin B/C. (A) Defective vectors with the indicated point mutations were used to infect SupT1 cells, and, 48 h later, cells were analyzed for cell cycle profile. (B) Expression levels for Vif were confirmed by Western blotting. (C) HeLa cells were transfected with nonspecific or Cul5-specific siRNA, using Oligofectamine (Invitrogen, Carlsbad, CA). The target sequence for Cul5 siRNA was CAGCTGGTTATTGGAGTAAGA (Qiagen). Cell extracts from the siRNA transfections were assayed for Cul5, using Western blotting. (D) At 24 h after siRNA transfection, cells were infected with the indicated viruses.

To independently confirm the requirement of the Cul5 E3 ligase complex, we used RNA interference to knock down Cul5 (Fig. 2C) prior to infection. Because short interfering RNA (siRNA) transfection into lymphocytes is inefficient and results in high levels of cell death, these experiments were conducted with HeLa cells. HeLa cells are efficiently transfected with siRNAs. HeLa cells were transfected with a Cul5-specific or a nonspecific siRNA, infected with DHIV 24 h later, and then stained for DNA content at 48 h postinfection (Fig. 2C). Vif-induced G2 accumulation was reduced in the absence of Cul5, both for the virus expressing Vif alone (DHIV-Vif) and for the virus expressing Vif and Vpr (DHIV-VifVpr). Treatment with Cul5 siRNA was specific for the effect of Vif, since it had no effect on cell cycle delay induced by DHIV-Vpr (which expresses Vpr and not Vif), presumably because Vpr recruits a Cul4 ubiquitin ligase (10).

These results indicate that the interaction with Cul5 E3 ligase is required for cell cycle disruption by Vif. Since the presence or absence of APOBEC3D/E, F, or G did not influence Vif-induced G2 delay, we hypothesize that Vif affects the cell cycle through the Cul5-mediated ubiquitination and degradation of an unknown substrate.

Overexpression of ubiquitin (K48R) ablates Vif activities. The addition of ubiquitin can modify not only protein stability but also function and localization. When polyubiquitin chains use a lysine 48 (UbK48) linkage on the ubiquitin molecule, the attached target proteins are usually degraded (4). Conversely, the use of UbK63 linkages affects intracellular localization but not stability (4). Overexpression of a dominant-negative ubiquitin mutant, Ub(K48R) (10, 24), that blocks the formation of lysine 48-linked polyubiquitin chain conjugates overcomes proteasomal degradation. To monitor the effects of Ub(K48R) overexpression, we cotransfected Vif with APOBEC3G-V5-six-His (8, 45) and either wt Ub or Ub(K48R) into HEK293T cells. Steady-state expression levels of the APOBEC3G-V5-six-His protein were monitored by Western blot analysis (Fig. 3A). Overexpression of Ub(K48R) restored detectable levels of APOBEC3G in the presence of Vif, indicating that Ub(48R) works as expected to block polyubiquitination and proteasomal degradation of APOBEC3G. In parallel, we overexpressed wt Ub or Ub(K48R) in HEK293T cells and exposed the cells to DHIV-Vif. Expression of Ub(K48R), but not wt Ub, relieved Vif-induced G2 accumulation (Fig. 3B). These results confirm that Vif induces ubiquitination and degradation of a cellular target which is required for efficient transition from G2 to M and that this protein is different from APOBEC3D/E, G, and F.


Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 3. Induction of G2 accumulation by Vif is relieved by overexpression of a dominant-negative ubiquitin construct. (A) HeLa cells were transfected with an expression vector for either wt ubiquitin or the dominant-negative mutant Ub(K48R), along with APOBEC3G-V5-six-His and Vif. At 48 h, cells were lysed, and the levels of APOBEC3G-V5-six-His were assayed by Western blotting, using an anti-V5 tag antibody (Invitrogen). (B) HeLa cells were transfected with either wt Ub or Ub(K48R), and 24 h later, they were mock infected or infected with DHIV-Vif. At 48 h postinfection, cells were assayed for cell cycle profile.

The APOBEC3G and F binding sites of Vif are required for G2 accumulation. We wished to determine whether regions of Vif that are known to be required for binding to the APOBEC3F and APOBEC3G proteins would also be required for the induction of G2 accumulation. Previous reports have identified two regions of Vif, termed "F" (residues 14 to 17) and "G" (residues 40 to 44), as being important for Vif's ability to interact with and induce the degradation of APOBEC3F and APOBEC3G, respectively (32, 37). A previous report demonstrated that the substitution of D14A in region F disrupted the ability of Vif to target APOBEC3F for degradation but did not affect the interaction with or degradation of APOBEC3G (32). We found that the D14A mutation abrogated Vif's ability to induce G2 accumulation (Fig. 4). Similarly, the mutation of tyrosine at position 44 (Y44A) located within region G and identified as being important in the ability of Vif to interact with and induce the degradation of APOBEC3G, but not F (32), failed to induce G2 accumulation (Fig. 4). Therefore, we propose that the region of Vif that interacts with a putative cellular factor involved in cell cycle progression requires elements from domains F and G.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 4. Mutations in Vif that disable APOBEC3 interaction also suppress cell cycle disruption. (A) Defective vectors with the indicated point mutations were used to infect SupT1 cells, and, 48 h later, cells were analyzed for cell cycle profile. (B) Expression levels for Vif were confirmed by Western blotting.

We specifically chose the Vif mutations D14A and Y44A, as described by Russell and Pathak (32), because individually they do not inactivate Vif. Thus, Vif(D14A) fails to degrade APOBEC3F and also fails to cause G2 accumulation but is active in the degradation of APOBEC3G (32). Conversely, Vif(Y44A) is inactive against degrading APOBEC3G and in inducing G2 delay but remains active in degrading APOBEC3F (32).

Vif induces a G2 delay but does not prevent cell division. The abnormal accumulation of cells induced by Vif could be due to a blockade or, alternatively, to a delay in the cell cycle. In the case of a blockade, cells expressing Vif would be expected to remain in G2 and would not divide again. A delay would mean that cells are ultimately able to enter mitosis and divide. To determine whether Vif-induced accumulation of cells in G2 underlies a delay versus an arrest, we resorted to incubating Vif-expressing cells with carboxy fluorescein succinimidyl ester (CFSE), followed by flow cytometric analysis at 24, 48 and 72 h postinfection. Staining with CFSE is permanent and results in green fluorescence. CFSE labeling gets diluted to approximately half its value each time cells divide and provides a useful method for estimating the number of cell divisions in a given population (30). Costaining cells with anti-Thy1-phycoerythrin (PE) (for DHIV-infected cells) allowed us to electronically gate infected cells. As shown in Fig. 5A, mock-infected cells or cells infected with DHIV-{Delta}Vif{Delta}Vpr and DHIV-Vif showed identical proliferation profiles at 24, 48, and 72 h postinfection, with similar mean fluorescence intensity values. To create a positive control, we incubated cells with doxorubicin; doxorubicin-treated cells divided slowly for the first 48 h and stopped dividing by 72 h.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 5. Vif-induced G2 accumulation does not impair cell division and is relieved by caffeine. (A) SupT1 cells were stained with CFSE and then infected with the indicated DHIV vectors or treated with doxorubicin. At 24-h intervals, cells were stained with anti-Thy1-PE antibody. Cells positive for the Thy1 marker were electronically gated and evaluated for the loss of green fluorescence, as an indicator of cell division. Numbers indicate the mean fluorescence intensity for the corresponding curves. (B) SupT1 cells were infected with the indicated viral vectors in the presence or absence of 4 mM caffeine. At 48 h postinfection, the cell cycle profile was assessed.

Vif-induced G2 delay is relieved by caffeine and correlates with RPA-32 phosphorylation. HIV-1 Vpr was previously reported to manipulate a Cul4a E3 ligase, leading to replication stress and activation of the serine/threonine kinase, the ataxia telangiectasia and Rad3-related (ATR) protein. To test the potential role of the ATR/ATM kinases in Vif-induced G2 accumulation, we infected SupT1 cells with DHIV, DHIV-Vpr, or DHIV-Vif and then treated the cells with 4 mM caffeine, a known inhibitor of ATM and ATR and other phosphatidylinositol kinase-like kinases (PIKK) and a potent blocker of Vpr function (31, 47). Infected cells were subsequently stained with propidium iodide, and cell cycle profiles were analyzed (Fig. 5B). We found that caffeine completely abrogated Vif-induced G2 delay, indicating that Vif likely induces G2 arrest through the activation of a PIKK.

To more closely examine the mechanism by which Vif induces G2 delay, we analyzed the phosphorylation of three PIKK targets: the checkpoint kinases 1 and 2 (Chk1 and Chk2), which are targets for ATR and ATM, respectively, and the 32-kDa subunit of the replication protein A (RPA-32), a target for both ATM and ATR. As shown in Fig. 6, infection with DHIV-Vif, but not with DHIV-{Delta}Vif{Delta}Vpr, induced phosphorylation of RPA-32. Strikingly, however, neither Chk1 nor Chk2 showed detectable phosphorylation over that of the background level, indicating that their corresponding kinases, ATR and ATM, respectively, are not in an activated state in Vif-expressing cells. The ability of caffeine to relieve cell cycle accumulation in G2, together with the phosphorylation of RPA-32, indicate that a PIKK is responsible for the delay. Since Chk1 and Chk2 do not appear to be phosphorylated, we argue that a PIKK other than ATR or ATM may be responsible for the effects of Vif on the cell cycle. A logical candidate would be the DNA-dependent protein kinase (7, 36), although other PIKK, such as hSMG-1 (1) and mTOR (44), may also be possible candidates.


Figure 6
View larger version (113K):
[in this window]
[in a new window]

 
FIG. 6. The mechanism of Vif-induced G2 delay. SupT1 cells were infected with the indicated DHIV vectors or treated with doxorubicin (Doxorub), and, at 48 h postinfection, the phosphorylation of various checkpoint proteins was assessed by Western blotting. DMSO, dimethyl sulfoxide.

The ability of Vif and Vpr to trigger cell cycle disruption is intriguing. For Vpr, many years of investigation have shown that cell cycle arrest correlates with transactivation of the viral promoter (13, 46) and induction of apoptosis by the virus (2, 3). It is also formally possible that Vpr-induced cell cycle arrest does not represent a primary function or effect of Vpr and that it is, instead, a by-product that results from manipulation of the Cul4/DDB1/DCAF1 ligase. If this were the case, then manipulation of the Ub ligase would accomplish a primary function that is unknown at this time. With regard to Vif, it is difficult to speculate whether the induction of cell cycle perturbation is a primary function or a by-product. Sakai et al. demonstrated that both Vpr and Vif were required for HIV-1 to induce full-blown cytopathicity in vitro (33). Therefore, Vif-induced cell cycle delay could be a major contributor to virus-mediated cell death. SV5 pV presents a similar dilemma, since the effect of pV that appears to be biologically relevant is the elimination of interferon signaling, and the consequences of cell cycle disruption, if any, remain uncertain. Further investigation of both the mechanism and the downstream consequences of cell cycle disruption by these viral proteins will likely provide valuable clues in the near future.


arrow
ACKNOWLEDGMENTS
 
The pCDNA-hVif plasmid was obtained through the NIH AIDS Research and Reference Reagent Program from Stephan Bour and Klaus Strebel. APOBEC3 D/E, F, and G, which have a C-terminal V5-six-His tag, were acquired through the NIH AIDS Research and Reference Reagent Program from B. Matija Peterlin and Yong-Hui Zheng. The ubiquitin constructs, encoding wild-type ubiquitin and Ub(K48R), were a gift from Michele Pagano (NYU). We thank Kathleen Boris-Lawrie for critical reading of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pathology, University of Utah School of Medicine, 15 North Medical Drive East no. 2100, Room 2520, Salt Lake City, Utah 84112. Phone: (801) 581-8655. Fax: (801) 587-7799. E-mail: vicente.planelles{at}path.utah.edu Back

{triangledown} Published ahead of print on 2 July 2008. Back

{ddagger} Supplemental material for this article may be found at http://jvi.asm.org/. Back

{dagger} These authors contributed equally. Back


arrow
REFERENCES
 
    1
  1. Abraham, R. T. 2004. The ATM-related kinase, hSMG-1, bridges genome and RNA surveillance pathways. DNA Repair (Amst.) 3:919-925.[CrossRef][Medline]
  2. 2
  3. Andersen, J. L., J. L. DeHart, E. S. Zimmerman, O. Ardon, B. Kim, G. Jacquot, S. Benichou, and V. Planelles. 2006. HIV-1 Vpr-induced apoptosis is cell cycle dependent and requires Bax but not ANT. PLoS Pathog. 2:e127.[CrossRef][Medline]
  4. 3
  5. Andersen, J. L., E. S. Zimmerman, J. L. DeHart, S. Murala, O. Ardon, J. Blackett, J. Chen, and V. Planelles. 2005. ATR and GADD45alpha mediate HIV-1 Vpr-induced apoptosis. Cell Death Differ. 12:326-334.[CrossRef][Medline]
  6. 4
  7. Angot, A., A. Vergunst, S. Genin, and N. Peeters. 2007. Exploitation of eukaryotic ubiquitin signaling pathways by effectors translocated by bacterial type III and type IV secretion systems. PLoS Pathog. 3:e3.[CrossRef][Medline]
  8. 5
  9. Ardon, O., E. S. Zimmerman, J. L. Andersen, J. L. DeHart, J. Blackett, and V. Planelles. 2006. Induction of G2 arrest and binding to cyclophilin A are independent phenotypes of human immunodeficiency virus type 1 Vpr. J. Virol. 80:3694-3700.[Abstract/Free Full Text]
  10. 6
  11. Belzile, J. P., G. Duisit, N. Rougeau, J. Mercier, A. Finzi, and E. A. Cohen. 2007. HIV-1 Vpr-mediated G2 arrest involves the DDB1-CUL4A(VPRBP) E3 ubiquitin ligase. PLoS Pathog. 3:e85.[CrossRef][Medline]
  12. 7
  13. Block, W. D., Y. Yu, and S. P. Lees-Miller. 2004. Phosphatidyl inositol 3-kinase-like serine/threonine protein kinases (PIKKs) are required for DNA damage-induced phosphorylation of the 32 kDa subunit of replication protein A at threonine 21. Nucleic Acids Res. 32:997-1005.[Abstract/Free Full Text]
  14. 8
  15. Dang, Y., X. Wang, W. J. Esselman, and Y. H. Zheng. 2006. Identification of APOBEC3DE as another antiretroviral factor from the human APOBEC family. J. Virol. 80:10522-10533.[Abstract/Free Full Text]
  16. 9
  17. DeHart, J. L., and V. Planelles. 2008. Human immunodeficiency virus type 1 Vpr links proteasomal degradation and checkpoint activation. J. Virol. 82:1066-1072.[Free Full Text]
  18. 10
  19. DeHart, J. L., E. S. Zimmerman, O. Ardon, C. M. Monteiro-Filho, E. R. Arganaraz, and V. Planelles. 2007. HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system. Virol. J. 4:57.[CrossRef][Medline]
  20. 11
  21. Ehmann, G. L., T. I. McLean, and S. L. Bachenheimer. 2000. Herpes simplex virus type 1 infection imposes a G(1)/S block in asynchronously growing cells and prevents G(1) entry in quiescent cells. Virology 267:335-349.[CrossRef][Medline]
  22. 12
  23. Felsani, A., A. M. Mileo, and M. G. Paggi. 2006. Retinoblastoma family proteins as key targets of the small DNA virus oncoproteins. Oncogene 25:5277-5285.[CrossRef][Medline]
  24. 13
  25. Goh, W. C., M. E. Rogel, C. M. Kinsey, S. F. Michael, P. N. Fultz, M. A. Nowak, B. H. Hahn, and M. Emerman. 1998. HIV-1 Vpr increases viral expression by manipulation of the cell cycle: a mechanism for selection of Vpr in vivo. Nat. Med. 4:65-71.[CrossRef][Medline]
  26. 14
  27. Hayashi, M. L., C. Blankenship, and T. Shenk. 2000. Human cytomegalovirus UL69 protein is required for efficient accumulation of infected cells in the G1 phase of the cell cycle. Proc. Natl. Acad. Sci. USA 97:2692-2696.[Abstract/Free Full Text]
  28. 15
  29. Hayes, S., P. Shiyanov, X. Chen, and P. Raychaudhuri. 1998. DDB, a putative DNA repair protein, can function as a transcriptional partner of E2F1. Mol. Cell. Biol. 18:240-249.[Abstract/Free Full Text]
  30. 16
  31. Holmes, R. K., M. H. Malim, and K. N. Bishop. 2007. APOBEC-mediated viral restriction: not simply editing? Trends Biochem. Sci. 32:118-128.[CrossRef][Medline]
  32. 17
  33. Horvath, C. M. 2004. Weapons of STAT destruction. Interferon evasion by paramyxovirus V protein. Eur. J. Biochem. 271:4621-4628.[Medline]
  34. 18
  35. Hrecka, K., M. Gierszewska, S. Srivastava, L. Kozaczkiewicz, S. K. Swanson, L. Florens, M. P. Washburn, and J. Skowronski. 2007. Lentiviral Vpr usurps Cul4-DDB1[VprBP] E3 ubiquitin ligase to modulate cell cycle. Proc. Natl. Acad. Sci. USA 104:11778-11783.[Abstract/Free Full Text]
  36. 19
  37. Jowett, J. B., V. Planelles, B. Poon, N. P. Shah, M. L. Chen, and I. S. Chen. 1995. The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 + M phase of the cell cycle. J. Virol. 69:6304-6313.[Abstract]
  38. 20
  39. Le Rouzic, E., N. Belaidouni, E. Estrabaud, M. Morel, J. C. Rain, C. Transy, and F. Margottin-Goguet. 2007. HIV1 Vpr arrests the cell cycle by recruiting DCAF1/VprBP, a receptor of the Cul4-DDB1 ubiquitin ligase. Cell Cycle 6:182-188.[Medline]
  40. 21
  41. Lin, G. Y., and R. A. Lamb. 2000. The paramyxovirus simian virus 5 V protein slows progression of the cell cycle. J. Virol. 74:9152-9166.[Abstract/Free Full Text]
  42. 22
  43. Margottin, F., S. P. Bour, H. Durand, L. Selig, S. Benichou, V. Richard, D. Thomas, K. Strebel, and R. Benarous. 1998. A novel human WD protein, h-beta TrCp, that interacts with HIV-1 Vpu connects CD4 to the ER degradation pathway through an F-box motif. Mol. Cell 1:565- 574.[CrossRef][Medline]
  44. 23
  45. Mehle, A., J. Goncalves, M. Santa-Marta, M. McPike, and D. Gabuzda. 2004. Phosphorylation of a novel SOCS-box regulates assembly of the HIV-1 Vif-Cul5 complex that promotes APOBEC3G degradation. Genes Dev. 18:2861-2866.[Abstract/Free Full Text]
  46. 24
  47. Mehle, A., B. Strack, P. Ancuta, C. Zhang, M. McPike, and D. Gabuzda. 2004. Vif overcomes the innate antiviral activity of APOBEC3G by promoting its degradation in the ubiquitin-proteasome pathway. J. Biol. Chem. 279:7792-7798.[Abstract/Free Full Text]
  48. 25
  49. Mehle, A., E. R. Thomas, K. S. Rajendran, and D. Gabuzda. 2006. A zinc-binding region in Vif binds Cul5 and determines cullin selection. J. Biol. Chem. 281:17259-17265.[Abstract/Free Full Text]
  50. 26
  51. Op De Beeck, A., F. Anouja, S. Mousset, J. Rommelaere, and P. Caillet-Fauquet. 1995. The nonstructural proteins of the autonomous parvovirus minute virus of mice interfere with the cell cycle, inducing accumulation in G2. Cell Growth Differ. 6:781-787.[Abstract]
  52. 27
  53. Op De Beeck, A., and P. Caillet-Fauquet. 1997. Viruses and the cell cycle. Prog. Cell Cycle Res. 3:1-19.[Medline]
  54. 28
  55. Planelles, V., A. Haislip, E. S. Withers-Ward, S. A. Stewart, Y. Xie, N. P. Shah, and I. S. Chen. 1995. A new reporter system for detection of retroviral infection. Gene Ther. 2:369-376.[Medline]
  56. 29
  57. Planelles, V., J. B. Jowett, Q. X. Li, Y. Xie, B. Hahn, and I. S. Chen. 1996. Vpr-induced cell cycle arrest is conserved among primate lentiviruses. J. Virol. 70:2516-2524.[Abstract]
  58. 30
  59. Renno, T., A. Attinger, S. Locatelli, T. Bakker, S. Vacheron, and H. R. MacDonald. 1999. Cutting edge: apoptosis of superantigen-activated T cells occurs preferentially after a discrete number of cell divisions in vivo. J. Immunol. 162:6312-6315.[Abstract/Free Full Text]
  60. 31
  61. Roshal, M., B. Kim, Y. Zhu, P. Nghiem, and V. Planelles. 2003. Activation of the ATR-mediated DNA damage response by the HIV-1 viral protein R. J. Biol. Chem. 278:25879-25886.[Abstract/Free Full Text]
  62. 32
  63. Russell, R. A., and V. K. Pathak. 2007. Identification of two distinct human immunodeficiency virus type 1 Vif determinants critical for interactions with human APOBEC3G and APOBEC3F. J. Virol. 81:8201-8210.[Abstract/Free Full Text]
  64. 33
  65. Sakai, K., J. Dimas, and M. J. Lenardo. 2006. The Vif and Vpr accessory proteins independently cause HIV-1-induced T cell cytopathicity and cell cycle arrest. Proc. Natl. Acad. Sci. USA 103:3369-3374.[Abstract/Free Full Text]
  66. 34
  67. Schrofelbauer, B., Y. Hakata, and N. R. Landau. 2007. HIV-1 Vpr function is mediated by interaction with the damage-specific DNA-binding protein DDB1. Proc. Natl. Acad. Sci. USA 104:4130-4135.[Abstract/Free Full Text]
  68. 35
  69. Sheehy, A. M., N. C. Gaddis, J. D. Choi, and M. H. Malim. 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646-650.[CrossRef][Medline]
  70. 36
  71. Shimura, T., M. M. Martin, M. J. Torres, C. Gu, J. M. Pluth, M. A. DeBernardi, J. S. McDonald, and M. I. Aladjem. 2007. DNA-PK is involved in repairing a transient surge of DNA breaks induced by deceleration of DNA replication. J. Mol. Biol. 367:665-680.[CrossRef][Medline]
  72. 37
  73. Simon, V., V. Zennou, D. Murray, Y. Huang, D. D. Ho, and P. D. Bieniasz. 2005. Natural variation in Vif: differential impact on APOBEC3G/3F and a potential role in HIV-1 diversification. PLoS Pathog. 1:e6.[CrossRef][Medline]
  74. 38
  75. Song, B., K. C. Yeh, J. Liu, and D. M. Knipe. 2001. Herpes simplex virus gene products required for viral inhibition of expression of G1-phase functions. Virology 290:320-328.[CrossRef][Medline]
  76. 39
  77. Tan, L., E. Ehrlich, and X. F. Yu. 2007. DDB1 and Cul4A are required for human immunodeficiency virus type 1 Vpr-induced G2 arrest. J. Virol. 81:10822-10830.[Abstract/Free Full Text]
  78. 40
  79. Wang, J., J. M. Shackelford, C. R. Casella, D. K. Shivers, E. L. Rapaport, B. Liu, X. F. Yu, and T. H. Finkel. 2007. The Vif accessory protein alters the cell cycle of human immunodeficiency virus type 1 infected cells. Virology 359:243-252.[Medline]
  80. 41
  81. Wen, X., K. M. Duus, T. D. Friedrich, and C. M. de Noronha. 2007. The HIV1 protein Vpr acts to promote G2 cell cycle arrest by engaging a DDB1 and Cullin4A-containing ubiquitin ligase complex using VprBP/DCAF1 as an adaptor. J. Biol. Chem. 282:27046-27057.[Abstract/Free Full Text]
  82. 42
  83. Wichroski, M. J., K. Ichiyama, and T. M. Rana. 2005. Analysis of HIV-1 viral infectivity factor-mediated proteasome-dependent depletion of APOBEC3G: correlating function and subcellular localization. J. Biol. Chem. 280:8387-8396.[Abstract/Free Full Text]
  84. 43
  85. Wiegand, H. L., B. P. Doehle, H. P. Bogerd, and B. R. Cullen. 2004. A second human antiretroviral factor, APOBEC3F, is suppressed by the HIV-1 and HIV-2 Vif proteins. EMBO J. 23:2451-2458.[CrossRef][Medline]
  86. 44
  87. Yang, Q., and K. L. Guan. 2007. Expanding mTOR signaling. Cell Res. 17:666-681.[CrossRef][Medline]
  88. 45
  89. Zheng, Y. H., D. Irwin, T. Kurosu, K. Tokunaga, T. Sata, and B. M. Peterlin. 2004. Human APOBEC3F is another host factor that blocks human immunodeficiency virus type 1 replication. J. Virol. 78:6073-6076.[Abstract/Free Full Text]
  90. 46
  91. Zhu, Y., H. A. Gelbard, M. Roshal, S. Pursell, B. D. Jamieson, and V. Planelles. 2001. Comparison of cell cycle arrest, transactivation, and apoptosis induced by the simian immunodeficiency virus SIVagm and human immunodeficiency virus type 1 vpr genes. J. Virol. 75:3791-3801.[Abstract/Free Full Text]
  92. 47
  93. Zimmerman, E. S., M. P. Sherman, J. L. Blackett, J. A. Neidleman, C. Kreis, P. Mundt, S. A. Williams, M. Warmerdam, J. Kahn, F. M. Hecht, R. M. Grant, C. M. de Noronha, A. S. Weyrich, W. C. Greene, and V. Planelles. 2006. Human immunodeficiency virus type 1 Vpr induces DNA replication stress in vitro and in vivo. J. Virol. 80:10407-10418.[Abstract/Free Full Text]


Journal of Virology, September 2008, p. 9265-9272, Vol. 82, No. 18
0022-538X/08/$08.00+0     doi:10.1128/JVI.00377-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DeHart, J. L.
Right arrow Articles by Planelles, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DeHart, J. L.
Right arrow Articles by Planelles, V.