This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruton, R. K.
Right arrow Articles by Grand, R. J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruton, R. K.
Right arrow Articles by Grand, R. J. A.

 Previous Article  |  Next Article 

Journal of Virology, September 2008, p. 8476-8486, Vol. 82, No. 17
0022-538X/08/$08.00+0     doi:10.1128/JVI.00248-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Identification of a Second CtBP Binding Site in Adenovirus Type 5 E1A Conserved Region 3{triangledown}

Rachel K. Bruton,1,{dagger} Peter Pelka,2,{dagger} Katie L. Mapp,1 Gregory J. Fonseca,2 Joseph Torchia,3 Andrew S. Turnell,1 Joe S. Mymryk,2 and Roger J. A. Grand1*

Cancer Research UK Institute for Cancer Studies, University of Birmingham, Birmingham B15 2TT, United Kingdom,1 Departments of Oncology and Microbiology and Immunology, University of Western Ontario, London, Ontario, Canada,2 Departments of Oncology, London Regional Cancer Program, and Biochemistry, University of Western Ontario, London, Ontario, Canada3

Received 4 February 2008/ Accepted 27 May 2008


arrow
ABSTRACT
 
C-terminal binding protein (CtBP) binds to adenovirus early region 1A (AdE1A) through a highly conserved PXDLS motif close to the C terminus. We now have demonstrated that CtBP1 also interacts directly with the transcriptional activation domain (conserved region 3 [CR3]) of adenovirus type 5 E1A (Ad5E1A) and requires the integrity of the entire CR3 region for optimal binding. The interaction appears to be at least partially mediated through a sequence (161RRNTGDP167) very similar to a recently characterized novel CtBP binding motif in ZNF217 as well as other regions of CR3. Using reporter assays, we further demonstrated that CtBP1 represses Ad5E1A CR3-dependent transcriptional activation. Ad5E1A also appears to be recruited to the E-cadherin promoter through its interaction with CtBP. Significantly, Ad5E1A, CtBP1, and ZNF217 form a stable complex which requires CR3 and the PLDLS motif. It has been shown that Ad513SE1A, containing the CR3 region, is able to overcome the transcriptional repressor activity of a ZNF217 polypeptide fragment in a GAL4 reporter assay through recruitment of CtBP1. These results suggest a hitherto-unsuspected complexity in the association of Ad5E1A with CtBP, with the interaction resulting in transcriptional activation by recruitment of CR3-bound factors to CtBP1-containing complexes.


arrow
INTRODUCTION
 
Adenovirus early region 1A (AdE1A) expression is essential for productive viral infection and for adenovirus-mediated transformation of mammalian cells in culture (21). AdE1A is transcribed into two major mRNA species of 13S and 12S sedimentation coefficients. Following translation, the amino acid sequences of these proteins are identical except for the presence of a transcriptional activation domain located toward the C terminus of the larger molecule (5, 24, 25).

During viral infection or cellular transformation, AdE1A produces its biological effects through a complex series of protein-protein interactions with host cell targets. Almost all of the binding sites on AdE1A are located either in the N-terminal {alpha}-helical domain or in those regions highly conserved between E1As from different virus serotypes (2, 3). AdE1A has been shown to bind in excess of 30 cellular proteins (5, 25). Most of these are involved in transcriptional regulation, the interactions facilitating the progression of infected cells into S phase, and subsequent expression of viral early genes. These binding partners include a family of acetyltransferases, CBP and p300 and pCAF, which bind to the N-terminal region and conserved region 1 (CR1) of E1A. In contrast, members of the Rb family of transcriptional corepressors interact with CR1 and CR2 (1, 19, 20, 34). Adenovirus 5 (Ad5) E1A (Ad5E1A) CR3 corresponds to the sequence unique to the larger 13S protein and is predominantly involved in the regulation of transcription by binding cellular components, such as TBP, ATF2, TBP-associated factors (TAFs), Med23, and proteasome components (7, 26, 27, 35, 42, 59). These interactions are generally required for the expression of adenovirus early region genes. CR3 contains a zinc finger motif with the metal ion chelated to four cysteine residues (17) and is highly conserved in E1As of all virus serotypes (3). Detailed mutational analysis of Ad5 CR3 has shown that the region can be divided into three subdomains. Domain one is used for promoter targeting of E1A through interaction with transcription factors, such as activating transcription factors (ATFs), c-Jun, SP1, and TAFs (9, 10, 26, 36, 37). A second subdomain interacts directly through TBP (35), and a third subdomain of CR3 provides a binding site for the Med 23 component of the Mediator complex (7, 58).

An additional well-characterized interaction of AdE1A is with the C-terminal binding proteins 1 and 2 (CtBP1 and -2), which bind to a highly conserved PXDLS motif close to the C terminus of E1A (6, 44). This interaction appears to facilitate viral infection (28). In transformation assays, it has been shown that the effect of CtBP's interaction with AdE1A is context dependent, such that loss of CtBP binding increases the frequency of transformation by mutant AdE1A and activated ras whereas frequency of transformation by AdE1A and AdE1B is markedly reduced (6, 18, 51, 52).

CtBP is a ubiquitous transcriptional corepressor interacting with a large array of PXDLS-containing proteins, in addition to E1A (for example, see references 16, 46, 54, 55, and 61; reviewed in references 10 to 14 and 56). In Drosophila melanogaster, dCtBP binds to both short- and long-range repressors and is of importance in segmentation and ultimately development (reviewed in reference 11). A CtBP-containing complex has been purified that includes the histone deacetylases (HDACs) 1 and 2, the histone methyltransferase G9A, and lysine demethylase 1 (LSD1) (47, 48, 53). CtBP has also been shown to associate directly with the histone acetyltransferase proteins CBP/p300 (32, 63). Collectively, these studies suggest that CtBP represses transcription by recruiting specific proteins, which in turn modify the chromatin environment.

The vertebrate genome contains two CtBP genes—CtBP1 and CtBP2. In addition, isoforms, RIBEYE and CtBP1-S (also known as CtBP3/BARS), have also been isolated (13). CtBP1 and CtBP2 are highly homologous, and both are similar to the 2-hydroxy-acid dehydrogenase family of proteins (44). CtBP1 has 2-hydroxy-acid dehydrogenase activity and binds NAD(H) (33). Although the functional significance of this activity with respect to its repressor function is unclear, it has been suggested that the interaction with NAD(H) promotes CtBP1 oligomerization and binding to PXDLS-containing proteins (4, 62). Finally, there are functional differences between CtBP1 and CtBP2 in that CtBP1–/– mice are viable whereas CtBP2–/– animals are embryonic lethal (30).

The interaction site on CtBP1 and CtBP2 for PXDLS-containing proteins (and peptides) has been mapped to the N-terminal region. Upon binding, the PXDLS motif becomes buried in a hydrophobic cleft close to the surface (33, 39, 40). Interestingly, a second binding site on CtBP has recently been identified that appears to bind an RRTGXP (RRT) motif present in the zinc finger 217 (ZNF217) protein (40). This second site of interaction on CtBP has been localized to a surface groove distinct from the PXDLS binding cleft (40). ZNF217 contains a PXDLS-like motif, as well as the novel RRT binding sequence, and so it might be supposed that it could interact with both constituents of a CtBP dimer, perhaps modulating other interactions. ZNF217 is a candidate oncogene which is amplified and overexpressed in multiple cancers, such as breast and colon carcinoma (22). It contains eight C2-H2 zinc fingers and belongs to the large family of Krüppel-like transcription factors (38). Protein purification studies have found ZNF217 as a constituent of several related transcriptional corepressor complexes containing the repressor CoREST, HDACs 1 and 2, LSD1, and CtBP (15, 29, 48, 60).

In the present study, we have reinvestigated the relationship of AdE1A and CtBP and have shown that CtBP1 binds to the CR3 region of Ad5E1A, regulating its transcriptional activity. This interaction is quite distinct from that involving the PXDLS motif in exon 2 of AdE1A. In addition, Ad513SE1A forms a multiprotein complex with CtBP1 and ZNF217 and is able to modulate ZNF217 repression properties. These results suggest that the interaction of AdE1A with CtBP1 may have effects on transcriptional activation by recruitment of CR3-bound activators to CtBP1.


arrow
MATERIALS AND METHODS
 
Cells. A549 cells derive from a human small cell lung carcinoma, HCT116 and HT29 cells from human colorectal carcinomas, HeLa cells from a cervical carcinoma, and U2OS cells from an osteosarcoma. Cells were grown in Dulbecco's modified Eagle medium containing 8% fetal calf serum. A549 cells were transfected using Lipofectamine 2000 (Invitrogen) for the small intefering RNA (siRNA) experiment. The primers used for reduction of CtBP expression were as previously described (8). Cells were transfected with the siRNAs using Lipofectamine and left for 3 days. They were then transfected with pcDNA3 GAL4-DBD (100 ng) or pcDNA-GAL4-CR3 (100 ng) and a GAL4-responsive luciferase reporter (1 µg). Luciferase activity was measured after 24 h. For derepression and activation of ZNF217-induced transcriptional silencing, U2OS cells were transfected with 300 ng of the reporter plasmid, 300 ng of the appropriate GAL4-ZNF217 (amino acids 751 to 1048) fusion plasmid, and 300 ng of the specified E1A plasmid using the Superfect transfection reagent (Qiagen). Luciferase activity was measured 48 h after transfection. For immunoprecipitation experiments, HeLa cells were transfected with the appropriate Ad5E1A construct, hemagglutinin (HA)-tagged ZNF217, and FLAG-tagged CtBP1 using Superfect, left for 48 h, and then immunoprecipitated.

Ad5E1A mutants. The well-characterized Ad5E1A mutants used in the coimmunoprecipitation studies have been previously described. A novel deletion mutant has a deletion in the CtBP binding site in CR4 (amino acids 279 to 283). The RTP mutant was made by PCR amplification of the 5' end of Ad5E1A 13S using a pair of oligonucleotides (sense, CGACGAATTCATGAGACATATTATCTGC; antisense, CATAATATCTGCGTCCCCCGCATTCGCCCGGTGATAATG) and the 3' end of 13S E1A using another pair of oligonucleotides (sense, TATCACCGGGCGAATGCGGGGGACGCAGATATTATG; antisense, ACTGTCGACTTATGGCCTGGGACGTTTACAGCTC), introducing the mutations at positions 161 (R->A), 164 (T->A), and 167 (P->A). The two resulting PCR products were mixed with addition of two additional oligonucleotides (sense, CGACGAATTCATGAGACATATTATCTGC; antisense, ACTGTCGACTTATGGCCTGGGACGTTTACAGCT) to generate a full-length 13S E1A triple mutant, which was cloned at the EcoRI/XhoI sites of pcDNA3.1. CR3 was PCR amplified from the 13S RTP mutant using the oligonucleotides (sense, AGACGAATTCGGTGAGGAGTTTGTGTTA; antisense, CGCGTCGACTTAGGTAGGTCTTGCAGGCTC), and the PCR product was then cloned into the EcoRI/XhoI sites of the pGEX-4T-1 glutathione S-transferase (GST) fusion vector for expression and use in the pull-down assays.

Analytical methods. For pull-down assays from cell lysates, cells were lysed in phosphate-buffered saline containing 1% Triton X-100-2 mM EDTA by sonication. After centrifugation, lysates were incubated for 2 h with GST-proteins or polypeptides; GST-proteins were retrieved after a further 2 h, using glutathione agarose beads. After washing, bound proteins were eluted with 25 mM glutathione (pH 8.0), resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and identified by Western blotting. CtBP1 was labeled with [35S]methionine after expression using a wheat germ transcription-translation kit (Promega). For binding studies with [35S]methionine-labeled proteins, GST polypeptides (20 µg) were incubated with [35S]methionine-labeled CtBP1 for 2 h. After addition of glutathione agarose beads (70 µl) and rotation for 1 h, bound proteins were eluted with 25 mM glutathione (pH 8.0) and fractionated by SDS-PAGE. Radiolabeled proteins were visualized by fluorography and autoradiography. For immunoprecipitation, cells were harvested in phosphate-buffered saline and lysed in 0.15 M NaCl-50 mM Tris-HCl (pH 7.8)-0.5% NP-40. Cell debris was removed by centrifugation, and supernatants were immunoprecipitated with appropriate antibodies and protein A-Sepharose (12.5 µl of beads). Proteins were fractionated by SDS-PAGE and coprecipitating protein identified by Western blotting. In Western blotting studies, CtBP1 was detected with a mouse monoclonal antibody (M1/M18) and CtBP2 with a mouse monoclonal antibody (Pharmingen). Ad5E1A was detected with M58 or M73, anti-FLAG tag with a mouse monoclonal antibody (clone M5 from Sigma), the HA tag with a rat monoclonal antibody from Roche, and the Myc tag with the 9E10 monoclonal antibody.


arrow
RESULTS
 
Ad5 CR3 binds CtBP1. In a screen of CtBP binding using various GST fragments of Ad5E1A (Fig. 1a), it was observed that while the major site of association for [35S]methionine-labeled CtBP1 in GST pull-down assays was in the C-terminal region encoded by exon 2 (which contains the PLDLS motif), an additional region of interaction was detected in exon 1, specifically in CR3 (Fig. 1b). To confirm this observation, human colorectal tumor cell (HCT116 and HT29) lysates were incubated with GST-Ad5E1A fusion proteins and with GST-Ad5E1ACR3 (Fig. 1c). As expected, both CtBP1 and CtBP2 interacted strongly with 12S and 13S GST-Ad5E1A and with GST-Ad2 exon 2, since all three contain the C-terminal PLDLS motif. However, both GST-Ad5E1A exon 1 (which includes CR3) and GST-CR3 itself bound to CtBP1 and CtBP2, although generally to a lesser extent than those polypeptides containing PLDLS (Fig. 1c). It is interesting to note that in all cases CtBPs bound considerably less well to either CR3 or exon 2 than to either intact protein (Fig. 1c). In addition, in most cases CtBP1 and CtBP2 bound more strongly to exon 1 than to CR3. This may be because the additional AdE1A sequence (i.e., N-terminal to CR3) in the exon 1 polypeptides facilitated a conformation in CR3 (or in exon 2) more conducive to CtBP1 binding.


Figure 1
View larger version (59K):
[in this window]
[in a new window]

  		FIG. 1. The interaction of CtBP1 with Ad5E1A polypeptides. (a) Dimensions of the Ad5 polypeptides used in pull-down experiments. (b) [35S]methionine-labeled CtBP1 was incubated with the GST-Ad5E1A fusion proteins and polypeptides shown (20 µg). Complexes were isolated with glutathione agarose and fractionated by SDS-PAGE. Radiolabeled proteins were identified by fluorography and autoradiography. Input represents 10% of that used in the experiment. A Coomassie blue-stained version of the gel is shown in the lower panel. (c) GST-Ad5E1A proteins or polypeptides as shown (20 µg) were incubated with HCT116 or HT29 cell lysates. Protein complexes were isolated using glutathione agarose and bound CtBP1 and CtBP2 identified by Western blotting. A Ponceau S-stained Western blot, showing the amount of fusion proteins used in the pull down, is shown in the lower panel. (d) [35S]-methionine-labeled CtBP1 was incubated with the GST-Ad5E1A fusion polypeptides shown. Complexes were isolated with glutathione agarose and fractionated by SDS-PAGE. Input represents 5% of that used in the experiment. A Coomassie blue-stained version of the gel is shown in the lower panel. (e) GST-Ad5E1A polypeptides as shown were incubated with HT29 and HCT116 cell lysates as for panel c. Bound CtBPs were identified by Western blotting. (f) HeLa cells were transfected with FLAG-tagged CtBP1 and Myc-tagged GFP or Myc-tagged GFP-CR3. After 24 h, CtBP1 was immunoprecipitated (IP) and coprecipitating GFP or GFP-CR3 identified by Western blotting.

To confirm that there was no direct interaction between CtBP1 and the N-terminal region of Ad5E1A (or any other region outside CR3 and CR4), two additional GST-Ad5E1A polypeptides were examined in pull-down assays. GST-Ad512SE1A with the C-terminal PLDLS motif deleted and GST-Ad5E1A1-139 (i.e., exon 1 without CR3) failed to bind [35S]methionine-labeled CtBP1 in in vitro pull-down assays (Fig. 1d). Similarly, the same GST Ad5E1A fragments failed to bind CtBP1 or CtBP2 in pull-downs using whole-cell lysates (Fig. 1e). Further confirmation of the CR3/CtBP interaction is provided by the data shown in Fig. 1f. When a Myc-tagged green fluorescent protein (GFP)-CR3 fusion protein was transfected into HeLa cells with FLAG-CtBP1, it could be coimmunoprecipitated with CtBP1.

Binding site for CtBP1 in Ad5CR3. To determine to what extent this interaction occurs with CR3 regions from other adenovirus serotypes, [35S]methionine-labeled CtBP1 was incubated with various purified GST-CR3 regions (Fig. 2a). A strong direct interaction of CtBP1 with GST-Ad5CR3 was observed. However, binding to the CR3 regions from other virus serotypes was weaker, or it was much reduced in the case of GST-Ad3CR3. The preference for the Ad5 construct suggested that the amino acid sequence RRNTGDP (amino acids 161 to 167), which is very similar to the recently determined, novel CtBP binding site found in ZNF217, RIZ, and ZNF516, may be responsible for the interaction (40). Comparable sequences in CR3 regions from non-subgroup C viruses are rather less similar in that the second arginine residue identified as necessary for ZNF217 interaction with CtBP is not present (Fig. 2b). Similarly, the proline residue is present only in the group F CR3 region.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

  		FIG. 2. Binding of CtBP1 to AdE1A conserved region 3. (a) [35S]methionine-labeled CtBP1 was incubated with the CR3 regions of AdE1As from different viral serotypes, expressed as GST fusion proteins (20 µg). Ad5, Ad9, Ad4, Ad3, Ad40, and Ad12 are representatives of the group C, D, E, B:1, F and A human adenoviruses, respectively (2, 3). Protein complexes were isolated using glutathione agarose and fractionated by SDS-PAGE. Radiolabeled proteins were identified by fluorography and autoradiography. A Coomassie blue-stained version of the gel is shown in the lower panel. (b) Comparison of the amino acid sequences of portions of CR3s from different adenovirus serotypes. The sequence of the novel CtBP binding site from ZNF217 is also shown. (c) GST-Ad5CR3 polypeptides (with various deletions) were incubated with [35S]methionine-labeled CtBP1. Protein complexes were isolated using glutathione agarose, fractionated by SDS-PAGE, and visualized by fluorography and autoradiography. Input represents 10% of that used in the experiment. A Coomassie blue-stained version of the gel is shown in the lower panel.

To examine the relationship of CtBP to Ad5E1ACR3 in more detail and to see if regions distinct from that of amino acids 161 to 167 contribute to binding, pull-down assays were carried out with a panel of GST fusion proteins encompassing various CR3 polypeptide fragments together with [35S]methionine-labeled CtBP1. It can be seen that all of the deletions in CR3 reduced binding of CtBP appreciably (Fig. 2c). We attribute this observation to the rather highly structured nature of Ad5E1ACR3. However, it is notable that the specific triple mutation of R161, T164, and P167 to alanine in the proposed novel CtBP binding site had an effect on the interaction similar to that seen for the deletions in CR3 (Fig. 2c). We conclude therefore that although this region (amino acids 161 to 167) is partially responsible for the Ad5CR3/CtBP interaction, it is not the sole specific binding site despite its strong similarity to the second CtBP binding motif in ZNF217. We suggest that there may be two contact sites in CR3 for CtBP, one involving the RRT motif and the other elsewhere in the region.

To confirm that binding of CR3 to CtBP1 does not involve the hydrophobic cleft of CtBP1 located toward the N terminus of the protein, which is the site of interaction for the PXDLS motif, pull-down assays were performed in the presence of added peptide (sequence REQTVPVDLSVKRPR) identical to the C-terminal region of Ad12E1A containing a PVDLS motif. It can be seen that the peptide inhibits the interaction between CtBP1 and GST-exon 2 (Fig. 3). However, the addition of peptide to CtBP1/CR3 mixtures had little effect on the interaction (Fig. 3). Taken together, these data and those presented in Fig. 1 show that a unique motif in Ad5CR3 binds directly to CtBP1 (and presumably CtBP2) and that this interaction is quite unrelated to the PXDLS motif in terms of both AdE1A and the binding site on CtBP. This observation raises the intriguing possibility that the 13S-encoded E1A proteins may have different effects on CtBP function than those observed with 12S.


Figure 3
View larger version (62K):
[in this window]
[in a new window]

  		FIG. 3. Ad5CR3 does not bind to the N-terminal region of CtBP1 normally associated with PXDLS-containing peptide interaction. GST-Ad5E1ACR3 and GST-Ad5E1A exon 2 were incubated with [35S]methionine-labeled CtBP1 in the presence of various concentrations of a PXDLS-containing peptide (REQTVPVDLSVKRPR) (as shown). Protein complexes were isolated using glutathione agarose and fractionated by SDS-PAGE. Radiolabeled proteins were identified by fluorography and autoradiography. A Coomassie blue-stained version of the gel is shown in the lower panel.

CtBP represses CR3 transcriptional activation. CtBP inhibits transcriptional activity of the CR1 domain of E1A (50) by binding to the PLDLS motif in the C-terminal region of E1A. Like CR1, CR3 of AdE1A is a transcriptional activation domain and is necessary for optimal expression of adenovirus early region genes (reviewed in references 3 and 31). In view of this, the effect of CtBP1 on transcriptional activation by CR3 has been assessed. It has previously been shown that when CR3 is tethered to a promoter by fusion to the DNA binding domain (DBD) of GAL4, it can strongly activate transcription. Following CtBP1 and -2 knockdown using appropriate siRNAs (as previously described [8]), A549 cells were transfected with GAL4-DBD or GAL4-CR3 in the presence of a GAL4-responsive luciferase gene. After 24 h, luciferase activity was measured. Reduction in the level of CtBP1 and CtBP2 resulted in an appreciable increase in the ability of CR3 to activate the GAL4 promoter (Fig. 4a). This result suggests that Ad5CR3 can recruit CtBP to a transcriptional template, and this interaction reduces transcriptional activation. In a further experiment, it was observed that activation of a construct comprising GAL4-DBD fused to Ad5E1A residues 1 to 82 was virtually unaffected by cotransfection of Ad5 exon 2. However, cotransfection of exon 2 considerably activated a GAL4-DBD-CR3 construct in a PLDLS motif-dependent manner (Fig. 4b). We conclude that the addition of relatively high levels of exon 2 binds to and inactivates constitutive CtBP, having a comparable effect to that of the knockdown shown in Fig. 4a. This allows an increase in the transcriptional activation properties of CR3. It appears, therefore, that while Ad5CR3 can be considered primarily a transcriptional activation domain, it is also able to recruit CtBP, which is generally considered a transcriptional corepressor, to modulate transactivation in some way.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 4. Reduction of available CtBP enhances transcriptional activity of the CR3 domain of Ad5E1A. (a) CtBP1 and CtBP2 expression was reduced in A549 cells using appropriate siRNAs (shown by Western blotting in the inset). Control cells were transfected with a nonspecific control siRNA. After 3 days, cells were transfected with pcDNA3-GAL4-DBD and a GAL4-responsive luciferase reporter or pcDNA3-GAL4 DBD-Ad5CR3 and a GAL4-responsive luciferase reporter. After 24 h, luciferase activity was measured. (b) U2OS cells were cotransfected with a GAL-luciferase reporter plasmid and either with a plasmid expressing GAL4-DBD or the indicated GAL4-DBD fusion to Ad5E1A 1 to 82 or CR3 together with a plasmid expressing Ad5E1A exon 2 or the exon 2 {Delta}PLDLS mutant. Cells were harvested 24 h after transfection, and luciferase assays were performed and normalized using β-galactosidase.

Association of AdE1A, CtBP1, and ZNF217. It has recently been demonstrated that CtBP1 binds to ZNF217 through two sites (40): a PXDLS-like (PLNLS) motif present between amino acids 686 and 690, together with a second site (746RRTGCPPAL754). We have examined the possibility that AdE1A may modulate this interaction. ZNF217 (HA tagged), CtBP1 (FLAG tagged), and Ad5E1A were cotransfected into HeLa cells. When CtBP was immunoprecipitated (with a FLAG tag antibody), appreciably more ZNF217 was coprecipitated in the presence of 13SE1A than in the presence of 12SE1A (Fig. 5a). Therefore, it appears that 13SE1A induces a much more pronounced interaction between ZNF217 and CtBP than the 12S protein. Interestingly, 12SE1A was found only to a very limited extent in complexes with CtBP and ZNF217, and 13SE1A was readily detectable associated with the same complex (Fig. 5a). It seems likely that this is due to the higher affinity of Ad513SE1A for CtBP1, as shown by the coimmunoprecipitation data presented in Fig. 5b and in the pull-down experiments shown in Fig. 1 and 2. Thus, less 12SE1A than 13S protein was coprecipitated with CtBP1. Deletion of the PXDLS motif in mutant E1A subverts the CtBP/AdE1A/ZNF217 complex to an appreciable extent, such that immunoprecipitation of CtBP coprecipitates only small amounts of ZNF217 (Fig. 5c). It is notable, however, that the 13S{Delta}PLDLS construct enhances the interaction to a limited extent whereas the 12S{Delta}PLDLS construct does not. This could be through the interaction of CtBP with 13SCR3. This result indicates that an intact PLDLS motif in E1A is required for the potentiation of the interaction between CtBP and ZNF217 and indicates that the association between ZNF217 and E1A is indirect, such that when E1A cannot bind to CtBP, it does not associate with ZNF217.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 5. Ad5E1A, CtBP1, and ZNF217 form a ternary complex. HeLa cells were transfected with constructs encoding ZNF217 (HA tagged), CtBP1 (FLAG tagged), and Ad5E1A as shown. (a) Samples were immunoprecipitated with an antibody against CtBP (FLAG tag) and Western blotted for Ad5E1A and ZNF217. Levels of expression of ZNF217, E1A, and CtBP are shown. (b) Samples cotransfected with E1A and CtBP were immunoprecipitated for CtBP (FLAG tag) and Western blotted for Ad5E1A. Levels of E1A and CtBP are shown. (c) HeLa cells were cotransfected with E1A, CtBP (FLAG tag), and ZNF217 (HA tag). Lysates were immunoprecipitated for CtBP (FLAG tag) and Western blotted for ZNF217. Levels of CtBP, ZNF217, and E1A are shown.

Adenovirus E1A influences ZNF217 GAL4-linked reporter activity. ZNF217 is a transcriptional repressor, with the repression activity being mapped to the C-terminal domain (15). This activity is probably due to recruitment of a complex comprising HDACs 1 and 2, CtBP1, and the histone demethylase LSD1, among others (15). To examine the effects of AdE1A on this activity, a construct consisting of amino acids 751 to 1048 of ZNF217 fused to GAL4-DBD was transfected into U2OS cells together with a GAL4 luciferase reporter and Ad5E1A as appropriate. After 48 h, the activity was measured. Expression of GAL4-ZNF217 repressed the transcriptional activity by approximately threefold compared to the GAL4-DBD control. Introduction of Ad512SE1A relieved the ZNF217-dependent repression, restoring luciferase activity to approximately the same level as in the absence of ZNF217 (Fig. 6a). However, expression of Ad513SE1A strongly activated luciferase activity, and the AdE1A RTP mutant (in a 13S background) had an effect comparable to that of the wild-type protein (Fig. 6a). Since AdE1A, CtBP1, and ZNF217 can exist in a ternary complex in solution, it is likely that GAL4-ZNF217 can recruit both E1A12S or E1A13S to the transcriptional reporter construct. Thus, the weak derepression observed with 12SE1A is likely linked to dissociation of CtBP1 from other components of the repression complex by its PLDLS motif. In contrast, strong activation by 13SE1A could be due to the recruitment of the transcriptional activation complex associated with AdE1ACR3 or perhaps may result from the interaction of CR3 with CtBP. When the PLDLS motif was deleted from the 13S form of Ad5E1A, there was almost a complete eradication of the effects of E1A on GAL4-ZNF217 since they no longer associated (Fig. 6b). These results show that Ad5E1A13S is recruited to a ZNF217-repressed promoter through CtBP and the PLDLS motif.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 6. Ad513SE1A relieves transcriptional repression by ZNF217. U2OS cells were transfected with pM-GAL4-DBD and a GAL4-responsive luciferase reporter or pM-GAL4-ZNF217 and a GAL4-responsive luciferase reporter. In addition, various Ad5E1A constructs were cotransfected. Luciferase activity was measured after 48 h. Transfections were normalized for efficiency of transfection using β-galactosidase. (a) Cotransfection of Ad512S and 13S E1A and the RTP substitution mutant. (b) Cotransfection of Ad513S E1A and a novel mutant with deletion of just the PLDLS motif from Ad513S E1A. "Vector" refers to cotransfection of the reporter, the indicated GAL4 fusion, and an empty plasmid. The level of expression of Ad5E1A and actin in the cells is shown in the insert panels.

Recruitment of AdE1A to the cellular E-cadherin promoter. The recruitment of Ad5E1A to a test promoter via Gal4-ZNF217 suggested that cellular promoters repressed by factors that recruit CtBP could be targeted for activation by E1A. To examine whether Ad5E1A could modulate promoter activity by recruitment through interaction with CtBP, HeLa cells were transfected with an E-cadherin reporter construct and various Ad5E1As. The E-cadherin gene is repressed by several factors that recruit CtBP, including ZEB and ZNF217 (15). Twenty-four hours after transfection activity was measured, wild-type Ad513SE1A activated transcription. This required the ability to bind CtBP, since the Ad513SE1A{Delta}PLDLS mutant did not activate (Fig. 7). Ad512SE1A also did not activate the E-cadherin reporter under these conditions, indicating an essential role for CR3 in activation. These results, using a cellular promoter and endogenous repressive factors, parallel those seen using the synthetic Gal4-ZNF217 reporter. We suggest that wild-type Ad513SE1A is recruited to the promoter through interaction with CtBP; reporter activity is then increased by the action of transcription factors associated with CR3. Deletion of the high-affinity CtBP binding site in the C terminus of E1A negates the increase in reporter activity.


Figure 7
View larger version (29K):
[in this window]
[in a new window]

  		FIG. 7. Ad513SE1A and Ad512SE1A differentially influence the E-cadherin promoter. HeLa cells were cotransfected with an E-cadherin reporter plasmid and either empty vector or vectors expressing the indicated E1As, as well as a β-galactosidase plasmid for normalization. Twenty-four hours after transfection, luciferase assays were performed and the results were normalized.


arrow
DISCUSSION
 
Interaction of Ad5CR3 with host cell transcriptional regulators is essential for expression of other viral early region proteins during infection (5, 31). Sequences in Ad5CR3 have been identified as essential for transcriptional activation, promoter targeting, and binding to proteins such as TBP and Med23 and the 20S proteasomal component S8 (reviewed in references 3 and 5). The promoter targeting region (residues 180 to 188) is a site of interaction with various sequence-specific transcription factors—for example, ATF1 to -3, c-Jun, Oct-4, SP1, and a number of TAFs (9, 37, 45). Furthermore, TBP appears to bind to amino acids between 147 and 157 and between 171 and 174 (26), whereas Med23 (also known as Sur2), a component of the Mediator complex, interacts with residues throughout CR3 but predominantly binds to amino acids 171 to 178 (7, 58). On this basis, it has been shown that regions of CR3 involved in binding to both TBP and Med23 are required for full transcriptional activation.

Evidence presented here (Fig. 1 and 2) demonstrates that CR3 also provides a site of interaction for CtBP1 and CtBP2 and that binding requires the integrity of most of the CR3 sequence. Deletions in both the N- and C-terminal and central regions disrupt this interaction. It appears that the CtBP interaction site overlaps binding sites for the transcriptional activators TBP, Med 23, multiple TAF components of TFIID, and proteasomal components (Fig. 2c). Whether individual Ad13SE1A molecules bind several of these proteins at the same time is not yet clear, but this may be the case, allowing gradations of activation. Significantly, the sequence RRNTGDP (amino acids 161 to 167 in Ad5E1A), which is homologous to the novel CtBP binding site recently identified in ZNF217 (Fig. 2b), appears to be partially responsible for the interaction with E1A (40), since the GST-CR3 fusion polypeptide in which highly conserved R, T, and P residues were mutated to alanines had reduced affinity for CtBP (Fig. 2). However, we presume that if this comprised the only specific binding site, mutation would eradicate binding completely. We suggest that there is another point of contact (binding site) for CtBP elsewhere in CR3, since all the other deletions in the region reduce binding. It is notable that all of the mutations in the CR3 polypeptides used in the pull-down study have appreciable effects on their predicted secondary structures, decreasing or increasing the extent of {alpha}-helix or β-sheet (data not shown). Thus, the loss of particular residues, as well as the marked changes in (predicted) structures, makes it very difficult to predict precise sites of interaction.

CtBP has previously been known to interact with other zinc finger-containing proteins, but this has generally been through PXDLS motifs or comparable sequences (40, 43, 57). Interaction of CtBP with sequences unrelated to PXDLS has also been observed previously. However, in these cases specific binding sites have not been defined unequivocally. Whether these other sites are homologous to the CR3 region is not clear at present. It is notable that CtBP is bound most strongly by Ad5CR3 and to a lesser extent by the regions of other serotypes. Why this is a feature predominantly of Ad5 remains to be determined, since the CR3 regions are highly conserved in all serotypes (3).

It is now well established that CtBP1 is a component of a repression complex which also contains HDACs, HPC2, a SUMO E3 ligase, LSD1, a histone demethylase, a nuclear enyol-coenzyme A hydratase, and assorted transcription factors (reviewed in reference 49). Some of the interactions are considered to be mediated through a PXDLS motif binding to an N-terminal hydrophobic cleft in CtBP, although others may be indirect. It is therefore likely that the gain in transcriptional activity of the CR3-GAL4 reporter when CtBP expression was reduced (or "negated" by excess exon 2) (Fig. 4) could be attributed to the dissociation of this repressor complex. Although recruitment of repressors to what has previously been considered to be a transcriptional activation domain may seem somewhat counterintuitive, recent studies have suggested that the level of transcriptional activation is combinatorial and is dependent on the repertoire of coactivators and corepressors targeted by a specific promoter in a context-dependent fashion. It is notable, however, that recent evidence suggests that CtBP can play a role in transcriptional activation. For example, dCtBP can activate transcription of particular wg (Drosophila Wnt) target genes while repressing others (23). Similarly, knockout of mouse CtBP2 decreases expression of Brachyury (30).

In view of the interaction between CtBP1 and Ad5CR3, the effect of Ad5E1A on the association of CtBP1 with the transcriptional repressor ZNF217 has been examined. Although ZNF217 does not appear to bind AdE1A directly (data not shown), it is clear that the viral protein facilitates the association of CtBP1 and ZNF217. This contrasts with the current model of E1A action, in which the PLDLS motif in E1A competes with cellular proteins for interaction with CtBP, leading to derepression of transcription from CtBP-repressed genes. Although this is an unexpected result, a comparable situation has been reported previously, with AdE1A increasing the association of CtBP2 with ZEB, G9a, and p300 (63). ZNF217 is a well-characterized candidate oncogene which is overexpressed in multiple human cancers (reviewed in reference 41). It has been shown to associate with transcriptional repressors, possibly through CtBP, and to repress transcription of, for example, the E-cadherin promoter (15). It is clear that the association of ZNF217 with CtBP1 is much more pronounced in the presence of Ad513SE1A than in that of the 12S protein (Fig. 5). Furthermore, it has been shown that 13SE1A binds CtBP1 with higher affinity than the 12S protein (Fig. 5b). We suggest that this increased interaction is due to a second CtBP binding site in the larger protein, located in CR3. It is possible, however, that the structural stability imparted by the zinc finger motif in the 13S protein, together with other structural constraints due to the CR3 region itself, could modify various structural elements in AdE1A such that the PXDLS motif and the surrounding amino acid sequence in exon 2 have a structure favoring tighter binding. The data presented in Fig. 5 suggest the presence of a ternary complex of CtBP1, Ad513SE1A, and ZNF217. One molecule of a CtBP1 dimer could bind AdE1A, with the other component of the dimer binding to ZNF217. Alternatively, ZNF217 could bind to CtBP1 through its RRT motif while AdE1A binds through the PLDLS sequence. A third possibility is that ZNF217 could bind CtBP1 through its PXDLS and RRT motifs while AdE1A could bind through CR3 to an as yet unknown region of CtBP1. It appears, however, that the CtBP1 binding site in CR3 is not sufficient to maintain the AdE1A/CtBP interaction in the absence of the PLDLS motif, nor to allow stabilization of ZNF217/CtBP1/AdE1A (Fig. 5). Maximal stabilization requires the presence of both PLDLS and CR3.

Significantly, the AdE1A 13S protein can strongly activate transcription via the GAL4-ZNF217 motif. This is presumably not mediated by simply dissociating ZNF217 from a CtBP repressor complex but is more likely due to recruitment of transcriptional activators through CR3 or somehow results from interaction of CR3 with CtBP. Additional weight is given to this argument by the observation that the Ad12SE1A protein reverses the repression of the reporter by GAL4-ZNF217, indicating that CtBP binding via the PLDLS motif per se, in this case, does not have a significant effect (Fig. 6). This observation is especially significant, since it indicates for the first time that different isoforms of E1A have notably different effects on CtBP function. The ability of Ad513SE1A, but not Ad512SE1A, to activate a specific CtBP-repressed promoter, in this case E-cadherin, through recruitment via CtBP is confirmed by the reporter assay presented in Fig. 7. These observations provide further evidence of the importance of the CtBP/AdE1A interaction to the widespread effects of E1A on transcriptional regulation and further confirm that various isoforms of E1A influence CtBP function differentially.

It is reasonable to suppose that AdE1A could target CtBP binding proteins such as ZNF217 during viral infection (and perhaps during transformation) to reduce its transcriptional repressor properties. Furthermore, the data presented here raise the novel possibility that the interaction of 13SE1A with CtBP could be required for strong transcriptional activation of at least a subset of genes rather than blocking CtBP-dependent repression as described for the current model of E1A function.

In summary, we have identified a novel second binding site between AdE1A and CtBP, which is localized within CR3, a transcriptional activation region unique to the larger 13SE1A product. Binding is independent of the C-terminal PXDLS motif but probably requires an RTP motif, previously identified in several cellular proteins, which confers binding to CtBP, as well as other regions of CR3. This strong CR3-dependent interaction is unique to Ad5E1A of the six adenovirus serotypes tested. Furthermore, we have demonstrated the requirement for the integrity of virtually all of CR3 for recruitment of CtBP1 and CtBP2 and have shown that this interaction reduced CR3-dependent transcriptional activation. It is probable that the action of CtBP, together with multiple activators, is required for subtlety of transcriptional regulation by E1A. Additionally, Ad513SE1A, but not the 12S protein, favors the association of CtBP1 with ZNF217. While Ad512SE1A also derepresses a ZNF217 luciferase reporter construct, Ad513S strongly activated transcription. We suggest that these interactions are required for the subtle modulation of transcriptional activation by AdE1A during viral infection.


arrow
ACKNOWLEDGMENTS
 
We are most grateful to the Breast Cancer Campaign and Cancer Research UK and the Canadian Institute of Health Research (CIHR) for financial support.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Cancer Research UK, Institute of Cancer Studies, University of Birmingham, Birmingham B15 2TT, United Kingdom. Phone: (44) 121 414 4483. Fax: (44) 121 414 4486. E-mail: r.j.a.grand{at}bham.ac.uk Back

{triangledown} Published ahead of print on 4 June 2008. Back

{dagger} These authors contributed equally to this research. Back


arrow
REFERENCES
 
    1
  1. Arany, Z., D. Newsome, E. Oldread, D. M. Livingston, and R. Eckner. 1995. A family of transcriptional adaptor proteins targeted by the E1A oncoprotein. Nature 374:81-84.[CrossRef][Medline]
    2. 2
  2. Avvakumov, N., R. Wheeler, J. S. D'Halluin, and J. S. Mymryk. 2002. Comparative sequence analysis of the largest E1A proteins of human and simian adenoviruses. J. Virol. 76:7968-7975.[Abstract/Free Full Text]
    3. 3
  3. Avvakumov, N., A. E. Kajon, R. C. Hoeben, and J. S. Mymryk. 2004. Comprehensive sequence analysis of the E1A proteins of human and simian adenoviruses. Virology 329:477-492.[Medline]
    4. 4
  4. Balasubramanian, P., L. J. Zhao, and G. Subramanian. 2003. Nicotinanide adenine dinucleotide stimulates oligomerization, interaction with adenovirus E1A and an intrinsic dehydrogenase activity of CtBP. FEBS Lett. 537:157-160.[CrossRef][Medline]
    5. 5
  5. Berk, A. J. 2005. Recent lessons in gene expression, cell cycle control and cell biology from adenovirus. Oncogene 24:7673-7685.[CrossRef][Medline]
    6. 6
  6. Boyd, J. M., T. Subramanian, U. Schaeper, M. LaRegina, S. Bayley, and G. Chinnadurai. 1993. A region in the C-terminus of adenovirus 2/5 E1a protein is required for association with a cellular phosphoprotein and important for the negative modulation of T24-ras mediated transformation, tumorigenesis and metastasis. EMBO J. 12:469-478.[Medline]
    7. 7
  7. Boyer, T. G., M. E. Martin, E. Lees, R. P. Ricciardi, and A. J. Berk. 1999. Mammalian Srb/Mediator complex is targeted by adenovirus E1A protein. Nature 399:276-279.[CrossRef][Medline]
    8. 8
  8. Bruton, R. K., M. Rasti, K. L. Mapp, N. Young, R. Z. Carter, I. A. Abramowicz, G. G. Sedgwick, D. F. Onion, M. Shuen, J. S. Mymryk, A. S. Turnell, and R. J. Grand. 2007. C-terminal binding protein interacting protein binds directly to adenovirus early region 1A through its N-terminal region and conserved region 3. J. Oncogene 26:7467-7479.[CrossRef][Medline]
    9. 9
  9. Chatton, B., J. L. Bocco, M. Guire, C. Hauss, B. Reimund, J. Goetz, and C. Kedinger. 1993. Transcriptional activation by the adenovirus larger E1A product is mediated by members of the cellular transcription factor ATF family which can directly associate with E1a. Mol. Cell. Biol. 13:561-570.[Abstract/Free Full Text]
    10. 10
  10. Chiang, C. M., and R. G. Roeder. 1995. Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267:531-536.[Abstract/Free Full Text]
    11. 11
  11. Chinnadurai, G. 2002. CtBP, an unconventional transcriptional corepressor in development and oncogenesis. Mol. Cell 9:213-224.[CrossRef][Medline]
    12. 12
  12. Chinnadurai, G. 2004. Modulation of oncogenic transformation by the human adenovirus E1A C-terminal region. Curr. Top. Microbiol. Immunol. 273:139-161.[Medline]
    13. 13
  13. Chinnadurai, G. 2006. CtBP family proteins: unique transcriptional regulators in the nucleus with diverse cytosolic functions, p. 1-17. In G. Chinnadurai (ed.), CtBP family proteins. Landes Bioscience, Austin, TX.
    14. 14
  14. Chinnadurai, G. 2007. Transcriptional regulation by C-terminal binding proteins. Int. J. Biochem. Cell. Biol. 39:1593-1607.[CrossRef][Medline]
    15. 15
  15. Cowger, J. J., Q. Zhao, M. Isovic, and J. Torchia. 2007. Biochemical characterization of the zinc-finger protein 217 transcriptional repressor complex: identification of a ZNF217 consensus recognition sequence. Oncogene 26:3378-3386.[CrossRef][Medline]
    16. 16
  16. Criqui-Filipe, C., C. Ducret, S. M. Maira, and B. Wasylyk. 1999. Net, a negative Ras-switchable TCF, contains a second inhibition domain, the CID, that mediates through interactions with CtBP and de-acetylation. EMBO J. 18:3392-3403.[CrossRef][Medline]
    17. 17
  17. Culp, J. S., L. C. Webster, D. J. Friedman, C. L. Smith, W. J. Huang, F. Y. Wu, M. Rosenberg, and R. P. Ricciardi. 1988. The 289-amino acid E1A protein of adenovirus binds zinc in a region that is important for transactivation. Proc. Natl. Acad. Sci. USA 85:6450-6454.[Abstract/Free Full Text]
    18. 18
  18. Douglas, J. L., S. Gopala Krishnan, and M. P. Quinlan. 1991. Modulation of transformation of primary epithelial cells by the second exon of the Ad5 E1A 12S gene. Oncogene 6:2093-2103.[Medline]
    19. 19
  19. Dyson, N., P. Guida, C. McCall, and E. Harlow. 1992. Adenovirus E1A makes two distinct contacts with the retinoblastoma protein. J. Virol. 66:4606-4611.[Abstract/Free Full Text]
    20. 20
  20. Eckner, R., M. E. Ewen, D. Newsome, M. Gerdes, J. A. DeCaprio, J. B. Lawrence, and D. M. Livingston. 1994. Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev. 8:869-884.[Abstract/Free Full Text]
    21. 21
  21. Endter, C., and T. Dobner. 2003. Cell transformation by human adenoviruses. Curr. Top. Microbiol. Immunol. 272:163-214.
    22. 22
  22. Ewarte-Toland, A., P. Briassouli, J. P. deKoning, J. H. Mao, J. Yuan, F. Chan, L. MacCarthy-Morrogh, B. A. Ponder, H. Nagase, J. Burn, S. Ball, M. Almeida, S. Linardopoulos, and A. Balmain. 2003. Identification of Stk6/STK15 as a low penetrance tumour susceptibility gene in mouse and human. Nat. Genet. 34:403-412.[CrossRef][Medline]
    23. 23
  23. Fang, M., J. Li, T. Blauwkamp, C. Bhambhani, N. Campbell, and K. M. Cadigan. 2006. C-terminal binding protein directly activates and represses Wnt transcriptional targets in Drosophila. EMBO J. 25:2735-2745.[CrossRef][Medline]
    24. 24
  24. Frisch, S. M., and J. S. Mymryk. 2002. Adenovirus-5 E1A: paradox and paradigm. Nat. Rev. Mol. Cell Biol. 3:441-452.[CrossRef][Medline]
    25. 25
  25. Gallimore, P. H., and A. S. Turnell. 2001. Adenovirus E1A: remodelling the host cell, a life or death experience. 20:7824-7835.
    26. 26
  26. Geisberg, J. V., W. S. Lee, A. J. Berk, and R. P. Ricciardi. 1994. The zinc finger region of the adenovirus E1A transactivating domain complexes with the TATA box binding protein. Proc. Natl. Acad. Sci. USA 91:2488-2492.[Abstract/Free Full Text]
    27. 27
  27. Geisberg, J. V., J. L. Chen, and R. P. Ricciardi. 1995. Subregions of the adenovirus E1A transactivation domain target multiple components of the TFIID complex. Mol. Cell. Biol. 15:6283-6290.[Abstract]
    28. 28
  28. Grand, R. J. A., C. Baker, P. M. Barral, R. K. Bruton, J. Parkhill, T. Szestak, and P. H. Gallimore. 2006. The significance of the CtBP-AdE1A interaction during viral infection and transformation in CtBP family proteins, p. 44-60. In G. Chinnadurai (ed.), CtBP family proteins. Landes Bioscience, Austin, TX.
    29. 29
  29. Hakimi, M. A., Y. Dong, W. S. Lane, D. W. Speicher, and R. Shiekhatter. 2003. A candidate X-linked mental retardation gene is a component of a new family of histone deacetylase-containing complexes. J. Biol. Chem. 278:7234-7239.[Abstract/Free Full Text]
    30. 30
  30. Hildebrand, J. D., and P. Soriano. 2002. Overlapping and unique roles for C-terminal binding protein 1 (CtBP1) and CtBP2 during mouse development. Mol. Cell. Biol. 22:5296-5307.[Abstract/Free Full Text]
    31. 31
  31. Jones, N. 1995. Transcriptional modulation by the adenovirus E1A gene. Curr. Top. Microbiol. Immunol. 199:59-80.[Medline]
    32. 32
  32. Kim, J. H., E. J. Cho, S. T. Kim, and H. D. Youn. 2005. CtBP represses p300 mediated transcriptional activation by direct interaction with its bromodomain. Nat. Struct. Mol. Biol. 12:423-428.[CrossRef][Medline]
    33. 33
  33. Kumar, V., J. E. Carlson, K. A. Ohgi, T. A. Edwards, D. W. Rose, C. R. Escalante, M. G. Rosenfeld, and A. K. Aggarwal. 2002. Transcription corepressor CtBP is an NAD(+) regulated dehydrogenase. Mol. Cell 10:857-869.[CrossRef][Medline]
    34. 34
  34. Kurokawa, R., D. Kalafus, M. H. Ogliastro, C. Kioussi, L. Xu, J. Torchia, M. G. Rosenfeld, and C. K. Glass. 1998. Differential use of CREB binding protein-coactivator complexes. Science 279:700-703.[Abstract/Free Full Text]
    35. 35
  35. Lee, W. S., C. C. Kao, G. O. Bryant, X. Liu, and A. J. Berk. 1991. Adenovirus E1A activation domain binds the basic repeat in the TATA box transcription factor. Cell 67:365-376.[CrossRef][Medline]
    36. 36
  36. Liu, F., and M. R. Green. 1990. A specific member of the ATF transcription factor family can mediate transcription activation by adenovirus E1A protein. Cell 61:1217-1224.[CrossRef][Medline]
    37. 37
  37. Liu, F., and M. R. Green. 1994. Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains. Nature 368:520-525.[CrossRef][Medline]
    38. 38
  38. Iuchi. 2001. Three classes of C2H2 zinc finger proteins. Cell Mol. Life Sci. 58:625-635.[CrossRef][Medline]
    39. 39
  39. Nardini, M., S. Spanó, C. Cericola, A. Pesce, A. Massaro, E. Millo, A. Luini, D. Corda, and M. Bolognesi. 2003. CtBP/BARS: a dual-function protein involved in transcription co-repression and Golgi membrane fission. EMBO J. 22:3122-3127.[CrossRef][Medline]
    40. 40
  40. Quinlan, K. G., M. Nardini, A. Verger, P. Francescato, P. Yaswen, D. Corda, M. Bolognesi, and M. Crossley. 2006. Specific recognition of ZNF217 and other zinc finger proteins at a surface groove of C-terminal binding proteins. Mol. Cell. Biol. 26:8159-8172.[Abstract/Free Full Text]
    41. 41
  41. Quinlan, K. G. R., A. Verger, P. Yaswen, and M. Crossley. 2007. Amplification of zinc finger gene 217 (ZNF217) and cancer: when good fingers go bad. Biochim. Biophys. Acta 1775:330-340.
    42. 42
  42. Rasti, M., R. J. A. Grand,, A. F. Yousef, M. Shuen, J. S. Mymryk, P. H. Gallimore, and A. S. Turnell. 2006. Roles for APIS and the 20S proteasome in adenovirus E1A-dependent transcription. EMBO J. 25:2710-2722.[CrossRef][Medline]
    43. 43
  43. Sasai, N., E. Matsuda, E. Sarashina, Y. Ishida, and M. Kawaichi. 2005. Identification of a novel BTB-zinc finger transcriptional repressor, CIBZ, that interacts with CtBP corepressor. Genes Cells 10:871-885.[Abstract/Free Full Text]
    44. 44
  44. Schaeper, U., J. M. Boyd, S. Verma, E. Uhlmann, T. Subramanian, and G. Chinnadurai. 1995. Molecular cloning and characterization of a cellular phosphoprotein that interacts with a conserved C-terminal domain of adenovirus E1A involved in negative modulation of oncogenic transformation. Proc. Natl. Acad. Sci. USA 92:10467-10471.[Abstract/Free Full Text]
    45. 45
  45. Scholer, H. R., T. Ciesiolka, and P. Gruss. 1991. A nexus between Oct-4 and E1A: implications for gene regulation in embryonic stem cells. Cell 66:291-304.[CrossRef][Medline]
    46. 46
  46. Sewalt, R. G., M. J. Gunster, J. van der Vlag, D. P. Satijm, and A. P. Otte. 1999. C-terminal binding protein is a transcriptional repressor that interacts with a specific class of vertebrate Polycomb proteins. Mol. Cell. Biol. 19:777-787.[Abstract/Free Full Text]
    47. 47
  47. Shi, Y., F. Lan, C. Matson, P. Mulligan, J. R. Whestine, P. A. Cole, R. A. Casero, and Y. Shi. 2004. Histone demethylation mediated by a nuclear amine oxidase homolog LSD1. Cell 119:941-953.[CrossRef][Medline]
    48. 48
  48. Shi, Y. J., J. Sawada, G. Sui, B. Affar, J. R. Whetstine, G. Lan, M. Ogawa, P. Luke, and Y. Nakatini. 2003. Co-ordinated histone modifications mediated by a CtBP co-repressor complex. Nature 422:735-738.[CrossRef][Medline]
    49. 49
  49. Shi, Y. J., and Y. Shi. 2006. CtBP Compressor complex—a multi-enzyme machinery that co-ordinates chromatin modifications in CtBP family proteins, p. 77-82. In G. Chinnadwai (ed.), CtBP family proteins. Landes Bioscience, Austin, TX.
    50. 50
  50. Sollerbrant, K., G. Chinnadurai, and C. Svensson. 1996. The CtBP binding domain in the adenovirus E1A protein controls CR1-dependent transactivation. Nuclei Acids Res. 24:2578-2584.[Abstract/Free Full Text]
    51. 51
  51. Subramanian, T., M. LaRegina, and G. Chinnadurai. 1989. Enhanced ras oncogene mediated cell transformation and tumourigenesis by adenovirus 2 mutants lacking the C-terminal region of Ela protein. Oncogene 4:415-420.[Medline]
    52. 52
  52. Subramanian, T., S. E. Malstrom, and G. Chinnadurai. 1991. Requirement of the C-terminal region of Ela for cell transformation in co-operation with E1b. Oncogene 6:1171-1173.[Medline]
    53. 53
  53. Subramanian, T., and G. Chinnadurai. 2003. Association of class I histone deacetylases with transcriptional corepressor CtBP. FEBS Lett. 540:255-258.[CrossRef][Medline]
    54. 54
  54. Svensson, E. C., G. S. Huggins, F. B. Dardik, C. E. Polk, and J. M. Leiden. 2000. A functionally conserved N-terminal domain of the friend of GATA-2 (FOG-2) represses GATA4-dependent transcription. J. Biol. Chem. 275:20762-20769.[Abstract/Free Full Text]
    55. 55
  55. Turner, J., and M. Crossley. 1998. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J. 17:5129-5140.[CrossRef][Medline]
    56. 56
  56. Turner, J., and M. Crossley. 2001. The CtBP family: enigmatic and enzymatic transcriptional co-repressors. Bioessays 23:683-690.[CrossRef][Medline]
    57. 57
  57. Ueda, J., M. Tachibana, T. Ikura, and Y. Shinkai. 2006. Zinc finger protein Wiz links G9a/GLP histone methyltransferases to the co-repressor molecule CtBP. J. Biol. Chem. 281:20120-20128.[Abstract/Free Full Text]
    58. 58
  58. Wang, G., and A. J. Berk. 2002. In vivo association of adenovirus large E1A protein with the human mediator complex in adenovirus-infected and -transformed cells. J. Virol. 76:9186-9193.[Abstract/Free Full Text]
    59. 59
  59. Webster, L. C., and R. P. Ricciardi. 1991. Trans-dominant mutants of E1A provide genetic evidence that the zinc finger of the trans-activating domain binds a transcription factor. Mol. Cell. Biol. 11:4287-4296.[Abstract/Free Full Text]
    60. 60
  60. You, A., J. K. Tong, C. M. Grozinger, and S. L. Schreiber. 2001. COREST is an integral component of the COREST-human histone deacetylase complex. Proc. Natl. Acad. Sci. USA 98:1454-1458.[Abstract/Free Full Text]
    61. 61
  61. Zhang, C. L., T. A. McKinsey, J. R. Lu, and E. N. Olson. 2001. Association of COOH-terminal-binding protein (CtBP) and MEF2-interacting transcription repressor (MITR) contributes to transcriptional repression of the MEF2 transcription factor. J. Biol. Chem. 276:35-39.[Abstract/Free Full Text]
    62. 62
  62. Zhang, Q., D. W. Piston, and R. H. Goodman. 2002. Regulation of corepressor function by nuclear NADH. Science 295:1895-1897.[Abstract/Free Full Text]
    63. 63
  63. Zhao, L. J., T. Subramanian, and G. Chinnadurai. 2006. Changes in C-terminal binding protein 2 (CtBP2) corepressor complex induced by E1A and modulation of E1A transcriptional activity by CtBP2. J. Biol. Chem. 281:36613-36623.[Abstract/Free Full Text]

Journal of Virology, September 2008, p. 8476-8486, Vol. 82, No. 17
0022-538X/08/$08.00+0     doi:10.1128/JVI.00248-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Pelka, P., Ablack, J. N. G., Torchia, J., Turnell, A. S., Grand, R. J. A., Mymryk, J. S. (2009). Transcriptional control by adenovirus E1A conserved region 3 via p300/CBP. Nucleic Acids Res 37: 1095-1106 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruton, R. K.
Right arrow Articles by Grand, R. J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruton, R. K.
Right arrow Articles by Grand, R. J. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»