This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boyce, M.
Right arrow Articles by Roy, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boyce, M.
Right arrow Articles by Roy, P.

 Previous Article  |  Next Article 

Journal of Virology, September 2008, p. 8339-8348, Vol. 82, No. 17
0022-538X/08/$08.00+0     doi:10.1128/JVI.00808-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Development of Reverse Genetics Systems for Bluetongue Virus: Recovery of Infectious Virus from Synthetic RNA Transcripts{triangledown}

Mark Boyce, Cristina C. P. Celma, and Polly Roy*

Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, United Kingdom

Received 15 April 2008/ Accepted 30 May 2008


arrow
ABSTRACT
 
Bluetongue virus (BTV), an insect-vectored emerging pathogen of both wild ruminants and livestock, has had a severe economic impact in agriculture in many parts of the world. The investigation of BTV replication and pathogenesis has been hampered by the lack of a reverse genetics system. Recovery of infectious BTV is possible by the transfection of permissive cells with the complete set of 10 purified viral mRNAs derived in vitro from transcribing cores (M. Boyce and P. Roy, J. Virol. 81:2179-2186, 2007). Here, we report that in vitro synthesized T7 transcripts, derived from cDNA clones, can be introduced into the genome of BTV using a mixture of T7 transcripts and core-derived mRNAs. The replacement of genome segment 10 and the simultaneous replacement of segments 2 and 5 encoding the two immunologically important outer capsid proteins, VP2 and VP5, are described. Further, we demonstrate the recovery of infectious BTV entirely from T7 transcripts, proving that synthetic transcripts synthesized in the presence of cap analogue can functionally substitute for viral transcripts at all stages of the BTV replication cycle. The generation of BTV with a fully defined genome permits the recovery of mutations in a defined genetic background. The ability to generate specific mutants provides a new tool to investigate the BTV replication cycle as well as permitting the generation of designer vaccine strains, which are greatly needed in many countries.


arrow
INTRODUCTION
 
Bluetongue disease causes high morbidity and can cause up to 75% mortality in domestic livestock (5). Bluetongue virus (BTV), the etiological agent of the disease, is transmitted between hosts by several species of biting midges of the Culicoides genus, which determine its geographic range (27). The virus has a global distribution and is endemic in many tropical and subtropical regions including the United States, Central America, parts of South America, Africa, Southeast Asia, and northern Australia, with a more recent emergence into Europe (5, 8, 14-16, 22, 25, 31, 39, 40; also press release from the World Organisation for Animal Health, Paris, France, 25 August 2006, http://www.oie.int/eng/press/en_060823.htm).

BTV belongs to the Orbivirus genus of the Reoviridae family and has a segmented genome consisting of 10 linear double-stranded RNA (dsRNA) molecules (33, 36). The genome segments are classified from segment 1 to segment 10 in decreasing order of size. The virus particle has a layered structure, the outer layer of which is lost before the remaining core particle enters the cytoplasm of the host cell (13, 34, 35). While the viral genomic dsRNAs never leave the core particle, the core particle itself is transcriptionally active, synthesizing and extruding multiple capped single-stranded mRNA copies of each viral genome segment into the host cell cytoplasm (13, 34, 35). These transcripts have the dual roles of encoding the viral proteins and serving as templates for the synthesis of the new viral dsRNA genome segments present in progeny virus particles. We have recently shown that the transfection of in vitro synthesized viral mRNAs from core particles into permissive cells is sufficient to initiate an infection (1).

The introduction of defined mutations into the genomes of many viruses has enabled rational approaches to the molecular dissection of viral gene products and noncoding sequences. Among RNA viruses, initially viruses with a positive-sense genome were recovered from plasmid DNA, such as bacteriophage Qβ and poliovirus (23, 32). Later, viruses with negative-sense genomes such as measles virus, influenza virus, and bunyaviruses were recovered entirely from cDNA clones (2, 18, 19, 24). In recent years the introduction of plasmid-derived sequence into the dsRNA genomes of the Reoviridae has become possible for the Orthoreovirus genus and, to a limited extent, for the Rotavirus genus (9, 10, 26). Here, we report the first manipulation of a member of the Orbivirus genus (BTV) at the sequence level, using a new approach among dsRNA virus reverse genetics systems based entirely on in vitro synthesized RNA transcripts. The approach taken extends the discovery that BTV transcripts are infectious on transfection of permissive cells (1) by the addition of one or more plasmid-derived T7 transcripts. The reassortment method described is applicable to any genome segment of BTV and requires the construction of a single clone or PCR product for each genome segment being recovered. We report the introduction of a marker sequence into the genome of BTV and the simultaneous replacement of the serotype-specific protein VP2 and the entry protein VP5 with proteins from a different serotype. Furthermore, the recovery of BTV entirely from plasmid-derived T7 transcripts was investigated and found to be viable means of generating BTV with a fully defined genome. This method permits the recovery of mutants in a consistent genetic background with no screening required to remove wild-type virus.


arrow
MATERIALS AND METHODS
 
Cell lines and virus. BSR cells (a clone of BHK-21) were cultured in Dulbecco's modified Eagle's medium supplemented with 5% (vol/vol) fetal bovine serum (FBS) at 35°C in 5% CO2. BTV stocks were generated by infecting BSR cells at a multiplicity of infection of 0.1 and harvesting the medium at 3 to 4 days postinfection. Viral stocks were stored at 4°C.

Purification of BTV core particles. BSR cultures were infected with BTV at a multiplicity of infection of 0.02 to 0.1. Transcriptionally active BTV-1 core particles were purified as previously described and stored at 4°C (1).

Synthesis and purification of BTV mRNA in vitro. BTV core particles were incubated at 40 µg/ml at 30°C for 5 to 6 h in BTV core transcription buffer (100 mM Tris-HCl, pH 8.0, 4 mM ATP, 2 mM GTP, 2 mM CTP, 2 mM UTP, 500 µM S-adenosylmethionine, 6 mM dithiothreitol, 9 mM MgCl2, 0.5U/µl RNasin Plus [Promega]). BTV core-derived mRNAs were purified using a previously described method and stored at –80°C (1).

Reverse transcription-PCR (RT-PCR) amplification of BTV-1 genome segments. cDNA copies of each BTV type 1 (BTV-1) genome segment were amplified from viral dsRNA in a sequence-independent manner using the method of full-length amplification of cDNAs (FLAC) (12). Briefly, the hairpin anchor primer was ligated to viral dsRNA as described previously, followed by cDNA synthesis from gel-purified genome segments with SuperScript III (Invitrogen) at a concentration of 10 U/µl and 55°C for 1 h. PCR amplification was performed using 5' phosphorylated FLAC 2 primer (5'GAGTTAATTAAGCGGCCGCAGTTTAGAATCCTCAGAGGTC3') with KOD Hot Start DNA Polymerase (Novagen). PacI and NotI sites are in bold type.

T7 plasmid clones used for the synthesis of BTV transcripts. cDNA plasmid clones were constructed for BTV-10 genome segment 10 (pNS3BsmBI), segment 5 (pVP5BsmBI), and segment 2 (pVP2BsmBI), and for all 10 segments of the BTV-1 genome. A mutant version of the BTV-10 segment 10 clone containing an introduced HaeII site (pNS3Hae) and a mutant version of the BTV-1 segment 8 clone containing an introduced BglII site (pBTV1S8Bgl) were also constructed. The functional cassette in each plasmid clone contained a T7 promoter and a BsmBI, BsaI, or BpiI site, with the BTV genome segment located between these elements. The BTV genome segment in each clone was positioned relative to the other two sequence elements such that the T7 transcript derived from plasmid digested with BsmBI, BsaI, or BpiI was predicted to have exactly the same sequence as the mRNA strand of the corresponding BTV genome segment (Fig. 2A).


Figure 2
View larger version (58K):
[in this window]
[in a new window]

 
FIG. 2. Reassortant progeny genomes containing the plasmid-derived BTV-10 segment 10. (A) T7 plasmids contain the full-length BTV genome segment flanked by a T7 promoter and a BsmBI, BsaI, or BpiI restriction enzyme site which defines the BTV 3' end sequence during transcription. The sequences at the 5' and 3' ends of the BTV genome segment and the flanking sequences are indicated; T7 promoter (italicized), the conserved BTV genome segment 5' and 3' end sequences (bold), and the BsmBI site (underlined) are shown. (B) Genomic dsRNA run on a 9% nondenaturing polyacrylamide gel, extracted from BTV recovered from the cotransfection of BSR cells with BTV-10 segment 10 T7 transcript and core-derived BTV-1 transcripts. Reassortants are shown in lanes 1, 2, and 5, with arrows indicating the faster-migrating BTV-10 segment 10 genome segment. Lanes 3 and 4 show results for wild-type BTV-1. BTV-1 dsRNA and BTV-10 dsRNA marker lanes are indicated. (C to E) Sequence electropherograms of segment 10 RT-PCR products. Segment 10 target sequences from total viral dsRNA were amplified by RT-PCR using primers BTV10_S10_259F and BTV10_S10_611R. Amplified targets were sequenced using BTV10_S10_259F. (C) BTV-10. (D) BTV-1 containing the introduced BTV-10 segment 10. (E) BTV-1.

Synthesis of BTV transcripts from cDNA plasmid clones. T7 plasmid clones were digested with BsmBI, BsaI, or BpiI and then extracted once with phenol-chloroform and once with chloroform. Each digested plasmid was precipitated with isopropanol in the presence of 0.15 M sodium acetate. DNA pellets were washed twice in 70% (vol/vol) ethanol and dissolved at 1 µg/µl in 10 mM Tris-HCl, pH 8.0. Transcripts with a 5' cap analogue were generated from the digested T7 plasmid clones using a mMESSAGE mMACHINE T7 Ultra Kit (Ambion), using a 4:1 ratio of anti-reverse cap analogue to rGTP. T7 BTV transcripts were extracted once with phenol-chloroform, followed by one extraction with chloroform. Unincorporated ribonucleoside triphosphates were removed by size fractionation using Microspin G-25 columns (GE Healthcare) according to the manufacturer's instructions. The T7 BTV transcripts were precipitated with an equal volume of isopropanol in the presence of 0.15 M sodium acetate. RNA pellets were washed twice in 70% (vol/vol) ethanol, dissolved in sterile diethylpyrocarbonate-treated water, and stored at –80°C.

Denaturing agarose gel electrophoresis. Purified BTV single-stranded RNA (ssRNA) was analyzed by electrophoresis on 1% agarose in morpholinepropanesulfonic acid electrophoresis buffer in the presence of formaldehyde using standard techniques (29).

Transfection of cultured cells to recover BTV with one or two cDNA-derived genome segments. BTV mRNAs derived from transcribing cores were mixed with one or more T7 BTV transcripts in Opti-MEM I in the presence of 0.1 U/µl RNasin Plus (Promega). The RNA mixture was incubated at 20°C for 30 min before being mixed with Lipofectamine 2000 reagent (Invitrogen) (see below). Confluent BSR monolayers in six-well plates were transfected with 1.5 µg of BTV mRNA mixed with 0.75 µg of each T7 BTV transcript using Lipofectamine 2000 reagent according to the manufacturer's instructions. At 4 h posttransfection the culture medium was replaced with a 6-ml overlay consisting of minimal essential medium, 2% FBS, and 1.5% (wt/vol) agarose type VII (Sigma). Assays were incubated at 35°C in 5% CO2 for 72 to 96 h to allow plaques to appear.

Transfection of cultured cells to recover BTV entirely from cDNA-derived genome segments. A total of 300 to 400 ng of each T7 BTV transcript was mixed as described above to produce a complete genome set of T7 BTV transcripts. Transfection of BSR monolayers was performed as described above.

Preparation of dsRNA from transfection-derived BTV plaques. Each plaque was picked into 500 µl of Dulbecco's modified Eagle's medium-5% FBS, and 200 µl was used to infect 1.5 x 106 BSR cells. Infected cells were incubated at 35°C in 5% CO2 for 72 to 96 h to allow amplification of the BTV. Viral dsRNA was purified from infected BSR cells as previously described (1).

Screening transfection-derived BTV plaques for reassortants containing the introduced genome segments. Where the genome segment being introduced migrated at a different rate on polyacrylamide gels, screening was done by electrophoresis of the dsRNA on 9% polyacrylamide gels in Tris-glycine buffer (pH 8.3). Gels were poststained for 30 min with ethidium bromide. Where screening was not possible on the basis of the migration rate, RT-PCR followed by restriction endonuclease digestion was used to discriminate between reassortants and wild-type BTV. cDNA was synthesized from 100 ng of heat-denatured viral dsRNA with SuperScript III (Invitrogen), using forward and reverse primers flanking the target region, at 55°C for 1 h. The target region was PCR amplified using Taq DNA polymerase with the same forward and reverse primers and digested with restriction endonucleases. Products were resolved by electrophoresis in agarose gels containing ethidium bromide in Tris-borate-EDTA buffer. Sequence analysis of RT-PCR products was done using dye terminators on ABI 3730XL sequencing machines using the Value Read service of MWG Biotech (30).

Construction of pNS3Hae and pBTV1S8Bgl. pNS3BsmBI was altered to contain an additional HaeII site by site-directed mutagenesis using primers S10_mt_Hae_409F and S10_mt_Hae_409R by the method of Weiner et al. (37). Similarly the wild-type BTV-1 S8 clone was altered to introduce a BglII site using primers 5'BTV1_S8_BglII and 3'BTV1_S8_BglII. Clones were screened for the presence of the introduced site by HaeII or BglII digestion, and the expression cassette was sequenced to identify clones containing no adventitious mutations using the Value Read service of MWG Biotech.

Primers. Mutagenic primers used to generate pNS3Hae from pNS3BsmBI were the following: S10_mt_Hae_409F (5'CTACTAGTGGCTGCTGTGGTAGCGCTGCTGACATCAGTTTG3') and S10_mt_Hae_409R (5'CAAACTGATGTCAGCAGCGCTACCACAGCAGCCACTAGTAG3'). Mutagenic primers used to generate pBTV1S8Bgl from the wild-type BTV-1 S8 clone were 5'BTV1_S8_BglII (5'GATTTACCAGGTGTGATGAGATCTAACTACGATGTTCGTGAAC3') and 3'BTV1_S8_BglII (5'CGAACATCGTAGTTAGATCTCATCACACCTGGTAAATCGGGC3'). The mutagenic bases are underlined, and the restriction sites are in bold type.

Primers for the RT-PCR amplification and sequencing of BTV-10 segment 10 were the following: BTV10_S10_238F (5'-GGAGAAGGCTGCATTCGCATCG-3'), BTV10_S10_654R (5'-CTCATCCTCACTGCGTCATTATATGATTGTTTTTTCATCACTTC-3'), BTV10_S10_259F (5'-GGAGAAGGCTGCATTCGCATCG-3'), and BTV10_S10_611R (5'-CTCATCCTCACTGCGTCATTATATGATTGTTTTTTCATCACTTC-3').

Primers for RT-PCR amplification from BTV-10 segment 5 were BTV10_M5_724F (5'-ATGACAGCAGACGTGCTAGAGGCGGCATC-3') and BTV10_M5_1590R (5'-GCGTTCAAGCATTTCGTAAGAAGAG-3').

Primers for RT-PCR amplification from BTV-10 segment 2 were BTV10_L2_727F (5'-CCGTACGAACGATTTATATCCAGC-3') and BTV10_L2_1523R (5'-TACTAATTCAGAACGCGCGCC-3').

Primers for RT-PCR amplification of BTV-1 segment 8 were NS2_Bam_T7_F (5'-CGGGATCCTAATACGACTCACTATAGTTAAAAAATCCTTGAGTCA-3') and NS2_Bam_R (5'-CATGGGATCCGGACCGTCTCCGTAAGTGTAAAATCCCC-3'). The primer used for sequencing BTV-1 segment 8 was BTV1_S8_627R (5'CAGCTTCTCCAATCTGCTGG3').


arrow
RESULTS
 
Reassortment of genome segments by cotransfection with BTV mRNA from two serotypes. The recovery of infectious BTV from core-derived transcripts through the transfection of permissive cells has been demonstrated (1). With the aim of producing a reverse genetics system for BTV, the introduction of genome segments from one BTV serotype into another was investigated as an intermediate step prior to the introduction of cDNA-derived genome segments. Infectious core-derived transcripts were prepared from BTV-1 and BTV-9 as previously described (1). The transcripts from the two serotypes were either generated simultaneously in the same transcription reaction or prepared separately and then mixed. Confluent BSR monolayers were transfected with the transcript mixtures, and virus was amplified from the resulting plaques. The dsRNA was purified from each amplified plaque, and the origin of genome segments was determined by electrophoresis on nondenaturing polyacrylamide gels, which allow the discrimination of some genome segments from different isolates. When cosynthesized transcripts from BTV-1 and BTV-9 were used, progeny viruses were generated that had genome segments from both parental sources of transcripts (reassortants). In Fig. 1A, lane 1 contains a reassortant which has segment 1 and segment 4 of BTV-1 in a genetic background of segments which migrate as BTV-9. Similarly, lane 2 contains a reassortant with the segment 3 of BTV-9 in a BTV-1 genetic background, and lane 3 contains a reassortant with segment 1 of BTV-9 in a BTV-1 genetic background. When BTV-1 and BTV-9 transcripts were prepared separately and mixed prior to transfection, reassortant progeny viruses were also generated, indicating that cosynthesis of transcripts is not necessary for reassortment to occur (Fig. 1B). The frequency at which reassortant progeny were generated was approximately 7 to 10% for both types of transcripts used. These data demonstrated that cotransfection with a mixture of viral transcripts is a viable strategy for the introduction of genome segments from a separate source into the BTV genome.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 1. Reassortant progeny genomes recovered from the cotransfection of BSR cells with core-derived transcripts from two serotypes of BTV. Genomic dsRNA was run on 9% nondenaturing polyacrylamide gels. (A) dsRNA from rescued BTV derived by the cotransfection of BSR cells with cotranscribed BTV-1 and BTV-9 transcripts. Lanes 1 to 3, plaque-purified viruses containing genome segments from both parental transcript preparations. Arrows indicate segments from the parent which has contributed the least number of segments. BTV-1 dsRNA and BTV-9 dsRNA marker lanes are indicated. (B) dsRNA from rescued BTV derived by the cotransfection of BSR cells with BTV-1 and BTV-9 transcripts mixed after preparation. Lanes 1 and 2, plaque-purified viruses containing genome segments from both parental transcript preparations. Arrows indicate segments from the parent which has contributed the least number of segments. BTV-1 dsRNA and BTV-9 dsRNA marker lanes are indicated.

The introduction of a BTV segment derived from a cDNA clone into the BTV-1 genome. The targeted replacement of a genome segment with a T7 transcript derived from a cDNA clone was subsequently investigated as a model for the introduction of cloned sequences into the BTV genome. The introduction of the BTV-10 segment 10 T7 transcript into the genome of BTV-1 was chosen to allow the rapid screening of plaques based on the fast migration rate of segment 10 of BTV-10 compared to BTV-1 on polyacrylamide gels. The BTV-10 segment 10 T7 transcript was produced from pNS3BsmBI, which has a T7 promoter to generate the correct 5' end sequence and a BsmBI site to generate the correct 3' end sequence (Fig. 2A). BTV-1 transcripts produced from transcribing core particles were mixed with the BTV-10 segment 10 T7 transcript and used to transfect confluent BSR monolayers. A 5:1 molar ratio of T7 transcript to the corresponding core-derived mRNA was found to be best and was used in all experiments. Increasing the ratio of T7 transcript to BTV-1 transcripts reduced the total number of plaques recovered (data not shown). Typically ~50 plaques were recovered from each well following the transfection of a six-well dish with 1.5 µg of core-derived transcripts plus 0.75 µg of T7 transcript. Virus was amplified from these plaques, and the dsRNA was purified. The origin of genome segment 10 was initially determined by electrophoresis of the dsRNA on polyacrylamide gels. dsRNA genome profiles containing the faster migrating segment 10 from BTV-10 were obtained with a sufficiently high frequency (15 to 80%) to make screening of plaques a viable option (Fig. 2B). The identity of segment 10 was confirmed using RT-PCR, followed by sequencing of a region showing variation between type 1 and type 10 (Fig. 2C, D, and E). These data demonstrated the recovery of the plasmid-derived BTV-10 segment 10 into the genome of viable BTV-1.

BTV naturally produces reassorted progeny genomes when a cell is infected with two different strains (7). To exclude the possibility that natural reassortment between two viruses was the origin of the segment 10 reassortants, a BTV-10 segment 10 clone containing an introduced silent HaeII site (pNS3Hae) as a marker was made by the site-directed mutagenesis of pNS3BsmBI. BSR monolayers were transfected with a mixture of BTV-1 core-derived mRNAs and the BTV-10 segment 10 T7 transcript containing the introduced mutation, derived from pNS3Hae. The recovery of virus containing this mutant BTV-10 segment 10 sequence was initially screened for by its increased migration rate on polyacrylamide gels (Fig. 3A). The introduction of the HaeII site into segment 10 of the BTV genome was confirmed by RT-PCR of dsRNA from plaque-purified virus followed by HaeII digestion (Fig. 3B) and by sequencing of the RT-PCR product (Fig. 3C and D). By sequencing a full-length RT-PCR product, segment 10 was determined to be the same as the segment encoded in pNS3Hae throughout its length (data not shown).


Figure 3
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 3. Reassortant progeny genomes containing the plasmid-derived BTV-10 segment 10 with an introduced marker mutation. (A) Genomic dsRNA from plaques containing BTV-10 segment 10 with an introduced HaeII site and run on a 9% nondenaturing polyacrylamide gel. Lanes 1 to 3, viral dsRNA from three plaque-purified reassortants containing the faster-migrating BTV-10 segment 10. BTV-1 dsRNA and BTV-10 dsRNA marker lanes are indicated. (B) HaeII digestion of segment 10 RT-PCR products. HaeII-digested RT-PCR products were amplified from genomic dsRNA using segment 10 primers BTV10_S10_259F and BTV10_S10_611R and separated on 2% agarose gels. U, undigested RT-PCR product; D, HaeII-digested RT-PCR product. Lanes 1, no template; lanes 2, BTV-10; lanes 3, reassortant with BTV-10 segment 10 introduced; lanes 4, reassortant with HaeII site-containing BTV-10 segment 10 introduced; lanes 5, BTV-1; lane M, StyI-digested phage {lambda} DNA markers, with sizes indicated in bp. Sizes of RT-PCR product and digest fragments are indicated on the left in bp. (C and D) Sequence electropherograms of segment 10 RT-PCR products. Segment 10 target sequences from total viral dsRNA were amplified by RT-PCR using primers BTV10_S10_238F and BTV10_S10_654R. Amplified targets were sequenced using BTV10_S10_ 238F. Panel C shows a reassortant with BTV-10 segment 10 introduced. Panel D shows a reassortant with an HaeII site-containing BTV-10 segment 10 introduced. The arrow indicates the introduced point mutation.

The simultaneous introduction of two BTV-10 segments derived from cDNA clones into the BTV-1 genome. To assess the possibility of simultaneously altering two genome segments, the introduction of the outer capsid protein encoding segments (segments 2 and 5) from BTV-10 into a background of BTV-1 genome segments was investigated. Replacement of these genome segments with the segments from another serotype would enable the serotype of the virus to be altered. T7 transcripts derived from segments 2 and 5 of BTV-10 were prepared from pVP2BsmBI and pVP5BsmBI, respectively, and mixed with BTV-1 core-derived mRNAs at a 5:1 ratio of each T7 transcript to the corresponding core-derived transcript. Confluent BSR cell monolayers were transfected with the RNA mixture, and dsRNA was prepared from the recovered plaques. The origins of segments 2 and 5 were initially assessed by their migration rate on polyacrylamide gels (Fig. 4A). Both segments 2 and 5 from BTV-10 were recovered together at high frequency (20 to 80%). The change of serotype from serotype 1 to serotype 10 was confirmed by a plaque size reduction assay using anti-BTV-10 rabbit serum (data not shown). Further, the identity of the segments was confirmed by RT-PCR followed by restriction digestion (Fig. 4B and C). The complete sequences of segment 2 and segment 5 were determined to be those of BTV-10 by RT-PCR amplification and sequencing (data not shown). No progeny (0 out of 19 plaques from three independent experiments) were recovered that contained only segment 2 or only segment 5 from BTV-10, suggesting that viruses containing segment 2 from one parent and segment 5 from the other parent are either of reduced viability or are generated at a lower frequency than the double reassortants. This phenomenon was further supported when the introduction of segment 2 or segment 5 from BTV-10 into BTV-1 was attempted singly, and no reassortant progeny were recovered (data not shown).


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
FIG. 4. Double reassortant progeny genomes containing the plasmid-derived BTV-10 segments 2 and 5. (A) Genomic dsRNA from BTV recovered from the cotransfection of BSR cells with the BTV-10 segment 5 T7 transcript, the BTV-10 segment 2 T7 transcript, and core-derived BTV-1 transcripts. Genomic dsRNA from progeny plaques run on a 9% nondenaturing polyacrylamide gel. Lanes 1 to 3, viral dsRNA from three plaque-purified reassortants. Arrows indicate the slower-migrating BTV-10 segment 2 and segment 5. BTV-1 dsRNA and BTV-10 dsRNA marker lanes are indicated. (B and C) Restriction digest analysis of segment 2 and segment 5 RT-PCR products. Target regions from segment 2 and segment 5 were RT-PCR amplified from genomic dsRNA, digested with restriction enzymes specific to the BTV-10 segment, and separated on 1.5% agarose gels. Panel B shows SacI digestion of segment 2 RT-PCR products. SacI has specificity for segment 2 of serotype 10, with two sites in the target sequence. RT-PCR products were amplified from genomic dsRNA using segment 2 primers BTV10_L2_727F and BTV10_L2_1523R. U, undigested RT-PCR product; D, SacI-digested RT-PCR product. Note that the primer pair does not amplify BTV-1 segment 2 due to the low homology of this segment among different serotypes. Lanes 1, BTV-1; lanes 2, BTV-10; lanes 3, reassortant with BTV-10 segments 2 and 5 introduced. StyI-digested phage {lambda} DNA marker sizes in bp are indicated on left. Sizes of RT-PCR product and digest fragments are indicated on the right in bp. Panel C shows DraI digestion of segment 5 RT-PCR products. DraI has specificity for segment 5 of serotype 10, with two sites present in the target sequence. RT-PCR products amplified from genomic dsRNA using segment 5 primers BTV10_M5_724F and BTV10_M5_1590R. U, undigested RT-PCR product; D, DraI-digested RT-PCR product. Templates in RT-PCRs are as indicated for panel B. Sizes of RT-PCR product and digest fragments are indicated on right in bp.

The recovery of BTV entirely from T7 transcripts. While the above method is a viable reverse genetics system that allows the manipulation of BTV genome segments, the requirement to screen for reassortant plaques among wild-type plaques could hinder the recovery of slow-growing mutants. The ideal reverse genetics system would permit the assembly of infectious virus entirely from T7 transcripts. To maximize the probability of having a viable clone for every genome segment, RT-PCR amplification of each genome segment was performed with dsRNA of BTV-1 using the sequence-independent FLAC method developed for dsRNA templates (12). Each RT-PCR product was cloned into pUC19 (38), and the complete sequence of each clone was compared with the complete sequence of each RT-PCR product in order to determine whether a representative molecule had been cloned in each case (data not shown). Alternative clones were sequenced when coding changes or any differences within 200 nucleotides of the ends of the cloned genome segment were present. Once a complete set of 10 clones was obtained, each genome segment was PCR amplified using the high-fidelity KOD Hot Start DNA Polymerase (Novagen) to introduce a T7 promoter directly upstream of the genome segment and a restriction enzyme site directly downstream (Fig. 2A). These functional cassettes were also cloned in pUC19. T7 transcripts synthesized using the restriction-digested plasmid clones were determined to be of the expected size when resolved on 1% denaturing agarose gels (Fig. 5).


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 5. T7 Transcripts of BTV-1 genome segments. Denaturing 1% agarose gel electrophoresis of BTV-1 T7 transcripts generated from restriction endonuclease-digested clones. M, 1 µg of ssRNA markers (Promega), with sizes indicated in nucleotides. (A) Lane 1, segment 1; lane 2, segment 3; lane 3, segment 5; lane 4, segment 7; lane 5, segment 9. (B) Lane 1, segment 2; lane 2, segment 4; lane 3, segment 6; lane 4, segment 8; lane 5, segment 10.

T7 transcripts made from restriction-digested plasmids were mixed in equal amounts of 0.3 to 0.4 µg of each in a total of 3 to 4 µg and used to transfect confluent BSR monolayers. Transfected monolayers were overlaid with agarose, and plaques appeared at 3 to 6 days posttransfection (Fig. 6A). dsRNA from amplified plaques was compared with BTV-1 stock virus on polyacrylamide gels and found to be indistinguishable, confirming that BTV-1 had been recovered (Fig. 6B). Titration of BTV-1 derived from T7 transcripts exhibited equivalent titers to that of wild-type virus (1 x 107 to 3 x 107 PFU/ml), demonstrating that BTV-1 derived from the 10 T7 transcripts has no gross replication defects when cultured in BSR cells. To substantiate further that BTV could be derived from T7 transcripts, a mutant of the BTV-1 segment 8 T7 clone was made that contained an introduced silent BglII site, pBTV1S8Bgl. Plaques were recovered from transfections with a complete set of T7 transcripts where the segment 8 BglII marker transcript replaced the wild-type S8 transcript (Fig. 7A). dsRNA from amplified plaques was found to be indistinguishable from BTV-1 stock virus on polyacrylamide gels (Fig. 7B). Plaques were amplified by infection of BSR cells, and the S8 segment was amplified by RT-PCR using primers NS2_Bam_R and NS2_Bam_T7_F. Digestion of the RT-PCR product demonstrated that a BglII site had been introduced (Fig. 7C). The RT-PCR products were sequenced using the BTV1_S8_627R primer confirming the introduction of the marker sequence (Fig. 7D). These data demonstrate that it is possible to recover BTV from a complete genomic set of T7 transcripts and introduce viable mutations using this system.


Figure 6
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 6. The recovery of infectious BTV by transfection with 10 T7 transcripts. (A) Transfected BSR monolayers overlaid with agarose. Well 1, BSR transfected with 4 µg of BTV-1 T7 transcripts; well 2, BSR not transfected. Monolayers were fixed and stained with crystal violet 5 days after transfection. (B) Genomic dsRNA run on a 9% nondenaturing polyacrylamide gel, extracted from BTV recovered from the transfection of BSR monolayers as described in panel A. Lane 1, BTV-1 stock virus; lanes 2 and 3, BTV-1 from separate plaques derived from transfection with T7 transcripts.


Figure 7
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 7. The recovery of infectious BTV containing a marker mutation using 10 T7 transcripts. (A) Transfected BSR monolayers overlaid with agarose. Well 1, BSR transfected with 3 µg of BTV-1 T7 transcripts including a segment 8 transcript with an introduced BglII site; well 2, BSR not transfected. Monolayers were fixed and stained with crystal violet 5 days after transfection. (B) Genomic dsRNA run on a 9% nondenaturing polyacrylamide gel was extracted from BTV recovered from the transfection of BSR monolayers as described in panel A. Lane 1, BTV-1 stock virus; lanes 2 and 3, BTV-1 from separate plaques derived from transfection with T7 transcripts. (C) BglII digestion of segment 8 RT-PCR products. BglII-digested RT-PCR products amplified from genomic dsRNA using segment 8 primers NS2_Bam_T7_F and NS2_Bam_R and separated on 1% agarose gels. U, undigested RT-PCR product; D, BglII-digested RT-PCR product. Lanes 1, wild-type BTV-1; lanes 2 to 6, five separate plaques derived from transfection including the segment 8 BglII mutant transcript; lanes 7, no template. StyI-digested phage {lambda} DNA marker sizes (in bp) are indicated on left. Sizes of RT-PCR products and digest fragments are indicated on the right (in bp). (D) Sequence electropherogram of the segment 8 RT-PCR product from transfection including the segment 8 BglII mutant transcript. Segment 8 target sequence from total viral dsRNA was amplified by RT-PCR using the primers described in panel A. The amplified target was sequenced using BTV1_S8_627R. Arrows indicate the introduced point mutations.


arrow
DISCUSSION
 
The two approaches described represent alternative reverse genetics systems for BTV using either a mixture of authentic viral transcripts and T7 transcripts or a complete genomic set of T7 transcripts. These systems extend the discovery that BTV transcripts are infectious when used to transfect permissive cells (1) and demonstrate that in vitro synthesized T7 transcripts with a cap analogue at the 5' end can functionally substitute for transcripts synthesized by core particles.

The recovery of progeny virus with genome segments originating from two separate core-derived mRNA preparations established the principle of introducing exogenous transcripts into the genome of BTV by mixing with authentic viral transcripts (Fig. 1B). The observation that mixing the mRNA preparations after transcription was effective in producing reassortants allowed for the possibility of using plasmid-derived transcripts in combination with core-derived mRNAs to introduce targeted mutations into the BTV genome. The introduction of the BTV-10 segment 10 transcript into the genome of BTV-1 was investigated to determine whether the facile introduction of plasmid-derived transcripts into infectious BTV could be achieved. A 5:1 molar ratio of T7 transcript to the corresponding core-derived mRNA was found to give a high frequency of reassortant plaques while maintaining the total recovery of plaques at a practical number. The observation that higher ratios of T7 transcript reduced the total plaque count may be due to negative effects on virus replication caused by overexpression of one gene in comparison to other genes. Alternatively, the reduced recovery may derive from the fact that only a portion of T7 transcripts generated in the presence of a cap analogue have the cap analogue incorporated at the 5' end. Additionally, the uncapped transcripts have a 5' triphosphate moiety that is known to be a pathogen-associated molecular pattern recognized by RIG-I that may lead to the induction of antiviral responses (3, 6, 20, 21). This model system showed that using an excess of the T7 transcript generated reassortant plaques at a frequency that made the screening of individual plaques practical (15 to 80%). The variation in this efficiency may reflect variation in the quality or the degree of capping of different T7 transcript preparations. The initial screening of plaques by the rate of migration of the segment 10 dsRNA on polyacrylamide gels (Fig. 2) was confirmed by sequencing of the RT-PCR product (Fig. 2). The high efficiency of reassortment between the T7 transcript and authentic viral transcripts meant that a selectable marker approach was not required. The introduction of the HaeII site marker mutation into segment 10 of BTV confirmed that reassortants were derived from the in vitro synthesized segment 10 T7 transcript (Fig. 3). The HaeII-containing segment 10 was recovered with a similar efficiency to wild-type BTV-10 segment 10. Neither segment 10 reassortant virus demonstrated any gross replication deficiencies compared to wild-type BTV-1 (data not shown). This shows that genome segment 10 from BTV-10 is functionally compatible with a background of BTV-1 genome segments both at the levels of RNA packaging and replication and NS3/NS3A protein function.

The simultaneous reassortment of two T7 transcripts into the BTV genome to replace the antigenically important outer capsid proteins of BTV-1 with those from BTV-10 cDNA clones was shown to be possible using an excess of both T7 transcripts (Fig. 4). Progeny plaques containing the BTV-10 segments 2 and 5 were recovered at a 20 to 80% frequency, but no reassortants were isolated containing only segment 2 or segment 5 from BTV-10. This demonstrates that together segments 2 and 5 of BTV-10 can functionally substitute for the corresponding BTV-1 genome segments and suggests that there is incompatibility between segment 2 and segment 5 from these two serotypes at some level. The encoded proteins, VP2 and VP5, are highly variable due their exposure to immune selective pressure on the surface of the virus particle. Our favored explanation is that the VP2 and VP5 proteins have coevolved and that the three dimensional structure of VP2 from one serotype is not necessarily compatible with the VP5 from another serotype. This is consistent with the previously reported incompatibility of the VP2 and VP5 proteins from some serotype combinations observed in the generation of BTV virus-like particles (11, 28). Incompatibility of segment 2 and segment 5 in some serotype combinations at an RNA packaging level is another possibility. The simultaneous introduction of both outer capsid proteins from another serotype allows the possibility of producing vaccine strains to different serotypes based on a consistent genetic background. The high amino acid sequence divergence between the VP2 proteins of BTV-1 and BTV-10 (40% amino acid identity) suggests that the assembly of varied VP2-VP5 pairs onto the conserved core of the BTV virion will be possible.

The recovery of BTV-1 from a complete set of T7 transcripts was investigated to determine whether virus with a fully defined genome could be recovered from cDNA clones. Transfection of BSR monolayers with the 10 T7 transcripts was found to lead to the production of plaques (Fig. 6). The recovery of a BglII marker mutation into the S8 segment confirmed that the virus recovered was derived from the T7 transcripts used in the transfections (Fig. 7). The recovery of infectious BTV from T7 transcripts alone demonstrates that T7 transcripts synthesized in the presence of cap analogue are functionally equivalent to authentic viral transcripts at all stages of the replication cycle. The T7 transcripts must be translated and selected during genome packaging and must act as templates for negative-strand synthesis if virions are to be generated. Furthermore, after negative-strand synthesis, the resulting dsRNA genome segment must be competent for transcription in the next round of infection. The recovery of BTV from T7 transcripts leads to the recovery of ~100-fold fewer plaques than when an equivalent quantity of core-derived viral transcripts is used. The lower efficiency may derive from the fact that only a portion of T7 transcripts generated in the presence of a cap analogue have the cap analogue incorporated at the 5' end. In addition to being poorly translated, the uncapped transcripts may be defective during RNA packaging, negative-strand synthesis, or transcription in the next round of infection. Additionally the induction of antiviral responses to the 5' triphosphate via RIG-I may influence the recovery of virus (3, 6, 20, 21). Alternatively, the technical issues associated with generating 10 ssRNA molecules with the conserved terminal sequences intact may contribute to the lower recovery observed with T7 transcripts. The presence of transcripts shorter than full-length that derive from incomplete transcription or the degradation of full-length transcripts is a minor component in every T7 transcript preparation (Fig. 5). These transcripts may be expected to reduce the efficiency of recovery of infectious virus through their incorporation into assembling virions.

The recovery of BTV entirely from plasmid-derived transcripts allows the generation of BTV mutants with a consistent genetic background. This approach will be useful in the recovery mutants, which are expected to have a slow replication phenotype, as the screening of plaques for the desired mutant among wild-type plaques is not required. In such cases there would be no background of faster-replicating virus, which may hamper the recovery of the slower-replicating mutants. This approach could also be used to recover primary/low-passage isolates of BTV, avoiding gradual alteration of these strains to cell culture conditions. The recovery of reassortants containing one plasmid-derived genome segment requires the construction of a single clone or PCR product and is applicable to any genome segment. This single-construct approach can be used to investigate individual viral genes without the need to construct a full set of 10 clones. As Reoviridae members have a common replication strategy, both the reassortment and T7-only reverse genetics approaches may be applicable to a wide range of viruses which lack a reverse genetics system. The use of in vitro synthesized T7 transcripts in both approaches obviates the requirement to supply T7 RNA polymerase by infection with a recombinant poxvirus, which may interfere with the replication of the virus being recovered.

Alternative reverse genetics strategies have been used successfully for other genera in the Reoviridae (9, 10, 26). The first reverse genetics system was a helper virus system for the mammalian orthoreoviruses (26). This approach combined reovirus infection of permissive cells and transfection with viral dsRNA, viral mRNA, a T7 transcript, and in vitro translated viral mRNA. Another helper virus approach has allowed the replacement of a rotavirus outer capsid protein with the corresponding protein from another serotype (10). The expression of the introduced genome segment was driven in vivo by the recombinant T7 vaccinia virus system, and selective pressure against the equivalent helper virus protein was provided by the use of antibody selection. Most recently mammalian orthoreovirus has been recovered using a plasmid-based system similar to the T7-driven systems first used with negative-strand viruses (9). In this case expression of all 10 genome segments was driven in vivo by the recombinant T7 vaccinia virus system. All the successful reverse genetics strategies for members of the family have several notable features in common. (i) The genome segments derived from cDNA clones are provided as message sense transcripts in the transfected cell. (ii) The cDNA-derived transcripts used have the same 5' end and 3' end sequences as the corresponding viral transcript. The 5' ends are generated through the use of a T7 promoter with the appropriate sequence, and the 3' ends are generated through the use of the hepatitis delta ribozyme in vivo or a restriction enzyme site in vitro. All genome segments in Reoviridae members have short conserved sequences at their extreme 5' and 3' ends the functions of which are still being elucidated. (iii) Like the authentic viral transcripts, the cDNA-derived transcripts are capped, either in vitro with a cap analogue or in vivo through the cross-capping activity associated with the vaccinia T7 RNA polymerase recombinant (4). To achieve infectious virus recovery, gene expression must be sufficient to allow the assembly of progeny core particles, which themselves are transcriptionally active and lead to an amplification of gene expression. A high level of gene expression is needed to assemble these incomplete virions, and without the presence of the cap structure at the 5' end of the cDNA-derived transcripts, their stability and level of translation would be greatly reduced (17).

Reverse genetics, as with other viruses, can contribute to the understanding of BTV in several research areas. The ability to recover specific mutations into the genome of BTV using either system provides not only a novel tool for the molecular dissection of BTV and related orbiviruses but also the opportunity to develop specifically attenuated vaccines to these viruses. The investigation of BTV protein function to date has mainly been based on recombinant protein expression. The ability to introduce specific mutations into the genes of BTV will further our understanding of the functions of the viral proteins in replicating virus and allow the corroboration of functions already assigned. The cis-acting RNA sequences that control the replication, packaging, and expression of Orbivirus genomes remain unmapped and are poorly understood. Reverse genetics allows mapping of these regulatory sequences and can assist in the investigation of how they act. The replacement of outer capsid proteins can be used to generate vaccine strains to different serotypes based on a common genetic background. Moreover, it will be possible to identify determinants of pathogenicity of BTV and related orbiviruses and design multiply attenuated vaccine strains.


arrow
ACKNOWLEDGMENTS
 
This work was partly supported by the Biotechnology and Biological Sciences Research Council, United Kingdom, and partly by the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: London School of Hygiene and Tropical Medicine, Keppel St., London, WC1E 7HT, United Kingdom. Phone: 44 20 79272324. Fax: 44 20 79272839. E-mail: polly.roy{at}lshtm.ac.uk Back

{triangledown} Published ahead of print on 18 June 2008. Back


arrow
REFERENCES
 
    1
  1. Boyce, M., and P. Roy. 2007. Recovery of infectious bluetongue virus from RNA. J. Virol. 81:2179-2186.[Abstract/Free Full Text]
  2. 2
  3. Bridgen, A., and R. M. Elliott. 1996. Rescue of a segmented negative-strand RNA virus entirely from cloned complementary DNAs. Proc. Natl. Acad. Sci. USA 93:15400-15404.[Abstract/Free Full Text]
  4. 3
  5. Cui, S., K. Eisenacher, A. Kirchhofer, K. Brzozka, A. Lammens, K. Lammens, T. Fujita, K. K. Conzelmann, A. Krug, and K. P. Hopfner. 2008. The C-terminal regulatory domain is the RNA 5'-triphosphate sensor of RIG-I. Mol. Cell 29:169-179.[CrossRef][Medline]
  6. 4
  7. Fuerst, T. R., and B. Moss. 1989. Structure and stability of mRNA synthesized by vaccinia virus-encoded bacteriophage T7 RNA polymerase in mammalian cells. Importance of the 5' untranslated leader. J. Mol. Biol. 206:333-348.[CrossRef][Medline]
  8. 5
  9. Gorman, B. M. 1990. The bluetongue viruses. Curr. Top. Microbiol. Immunol. 162:1-19.[Medline]
  10. 6
  11. Hornung, V., J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S. Akira, K. K. Conzelmann, M. Schlee, S. Endres, and G. Hartmann. 2006. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314:994-997.[Abstract/Free Full Text]
  12. 7
  13. Kahlon, J., K. Sugiyama, and P. Roy. 1983. Molecular basis of bluetongue virus neutralization. J. Virol. 48:627-632.[Abstract/Free Full Text]
  14. 8
  15. Kirkland, P. D., N. Zhang, R. A. Hawkes, Z. Li, F. Zhang, R. J. Davis, D. A. Sanders, H. Li, K. Zhang, J. Ben, G. F. He, C. L. Hornitzky, and N. T. Hunt. 2002. Studies on the epidemiology of bluetongue virus in China. Epidemiol. Infect. 128:257-263.[CrossRef][Medline]
  16. 9
  17. Kobayashi, T., A. A. R. Antar, K. W. Boehme, P. Danthi, E. A. Eby, K. M. Guglielmi, G. H. Holm, E. M. Johnson, M. S. Maginnis, S. Naik, W. B. Skelton, J. D. Wetzel, G. J. Wilson, J. D. Chappell, and T. S. Dermody. 2007. A Reverse genetics system for dsRNA viruses. Cell Host Microbe 1:147-157.[CrossRef][Medline]
  18. 10
  19. Komoto, S., J. Sasaki, and K. Taniguchi. 2006. Reverse genetics system for introduction of site-specific mutations into the double-stranded RNA genome of infectious rotavirus. Proc. Natl. Acad. Sci. USA 103:4646-4651.[Abstract/Free Full Text]
  20. 11
  21. Loudon, P. T., T. Hirasawa, S. Oldfield, M. Murphy, and P. Roy. 1991. Expression of the outer capsid protein VP5 of two bluetongue viruses, and synthesis of chimeric double-shelled virus-like particles using combinations of recombinant baculoviruses. Virology 182:793-801.[Medline]
  22. 12
  23. Maan, S., S. Rao, N. S. Maan, S. J. Anthony, H. Attoui, A. R. Samuel, and P. P. Mertens. 2007. Rapid cDNA synthesis and sequencing techniques for the genetic study of bluetongue and other dsRNA viruses. J. Virol. Methods 143:132-139.[CrossRef][Medline]
  24. 13
  25. Martin, S. A., and H. J. Zweerink. 1972. Isolation and characterization of two types of bluetongue virus particles. Virology 50:495-506.[CrossRef][Medline]
  26. 14
  27. Mehlhorn, H., V. Walldorf, S. Klimpel, B. Jahn, F. Jaeger, J. Eschweiler, B. Hoffmann, and M. Beer. 2007. First occurrence of Culicoides obsoletus-transmitted Bluetongue virus epidemic in Central Europe. Parasitol. Res. 101:219-228.[CrossRef][Medline]
  28. 15
  29. Mertens, P. P. C., H. Attoui, and D. H. Bamford (ed.). 2007. Bluetongue outbreaks. In The RNAs and proteins of dsRNA viruses. http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/outbreaks.htm#top.
  30. 16
  31. Mertens, P. P. C., and H. Attoui (ed.). 2007. Summary of the molecular epidemiology of Bluetongue virus in Europe since 1998: introductions, origins and movements of individual virus strains. In The RNAs and proteins of dsRNA viruses. http://www.iah.bbsrc.ac.uk/dsRNA_virus_proteins/ReoID/BTV-mol-epidem.htm.
  32. 17
  33. Muthukrishnan, S., G. Both, Y. Furuichi, and A. Shatkin. 1975. 5'-Terminal 7-methylguanosine in eukaryotic mRNA is required for translation. Nature 255:33-37.[CrossRef][Medline]
  34. 18
  35. Neumann, G., and Y. Kawaoka. 2004. Reverse genetics systems for the generation of segmented negative-sense RNA viruses entirely from cloned cDNA. Curr. Top. Microbiol. Immunol. 283:43-60.[Medline]
  36. 19
  37. Neumann, G., M. A. Whitt, and Y. Kawaoka. 2002. A decade after the generation of a negative-sense RNA virus from cloned cDNA—what have we learned? J. Gen. Virol. 83:2635-2662.[Abstract/Free Full Text]
  38. 20
  39. Pichlmair, A., O. Schulz, C. P. Tan, T. I. Naslund, P. Liljestrom, F. Weber, and C. Reis e Sousa. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 314:997-1001.[Abstract/Free Full Text]
  40. 21
  41. Plumet, S., F. Herschke, J. M. Bourhis, H. Valentin, S. Longhi, and D. Gerlier. 2007. Cytosolic 5'-triphosphate ended viral leader transcript of measles virus as activator of the RIG I-mediated interferon response. PLoS ONE 2:e279.[CrossRef]
  42. 22
  43. Purse, B. V., P. S. Mellor, D. J. Rogers, A. R. Samuel, P. P. C. Mertens, and M. Baylis. 2005. Climate change and the recent emergence of bluetongue in Europe. Nat. Rev. Microbiol. 3:171-181.[CrossRef][Medline]
  44. 23
  45. Racaniello, V. R., and D. Baltimore. 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214:916-919.[Abstract/Free Full Text]
  46. 24
  47. Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber, C. Dotsch, G. Christiansen, and M. A. Billeter. 1995. Rescue of measles viruses from cloned DNA. EMBO J. 14:5773-5784.[Medline]
  48. 25
  49. Ravishankar, C., G. Krishnan Nair, M. Mini, and V. Jayaprakasan. 2005. Seroprevalence of bluetongue virus antibodies in sheep and goats in Kerala State, India. Rev. Sci. Technol. 24:953-958.[Medline]
  50. 26
  51. Roner, M. R., and W. K. Joklik. 2001. Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome. Proc. Natl. Acad. Sci. USA 98:8036-8041.[Abstract/Free Full Text]
  52. 27
  53. Roy, P. 1991. Towards the control of emerging Bluetongue disease. Oxford Virology Publications, London, United Kingdom.
  54. 28
  55. Roy, P., D. H. L. Bishop, H. LeBlois, and B. J. Erasmus. 1994. Long-lasting protection of sheep against bluetongue challenge after vaccination with virus-like particles: evidence for homologous and partial heterologous protection. Vaccine 12:805-811.[CrossRef][Medline]
  56. 29
  57. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  58. 30
  59. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.[Abstract/Free Full Text]
  60. 31
  61. Stott, J. L., B. I. Osburn, R. Bushnell, E. C. Loomis, and K. R. Squire. 1985. Epizootiological study of bluetongue virus infection in California livestock: an overview. Prog. Clin. Biol. Res. 178:571-582.[Medline]
  62. 32
  63. Taniguchi, T., M. Palmieri, and C. Weissmann. 1978. QB DNA-containing hybrid plasmids giving rise to QB phage formation in the bacterial host. Nature 274:223-228.[CrossRef][Medline]
  64. 33
  65. Verwoerd, D. W. 1969. Purification and characterization of bluetongue virus. Virology 38:203-212.[CrossRef][Medline]
  66. 34
  67. Verwoerd, D. W., H. J. Els, E. M. De Villiers, and H. Huismans. 1972. Structure of the bluetongue virus capsid. J. Virol. 10:783-794.[Abstract/Free Full Text]
  68. 35
  69. Verwoerd, D. W., and H. Huismans. 1972. Studies on the in vitro and the in vivo transcription of the bluetongue virus genome. Onderstepoort J. Vet. Res. 39:185-191.[Medline]
  70. 36
  71. Verwoerd, D. W., H. Louw, and R. A. Oellermann. 1970. Characterization of bluetongue virus ribonucleic acid. J. Virol. 5:1-7.[Abstract/Free Full Text]
  72. 37
  73. Weiner, M. P., G. L. Costa, W. Schoelttin, J. Cline, E. Mathur, and J. C. Bauer. 1994. Site-directed mutagenesis of double stranded DNA by the polymerase chain reaction. Gene 151:119-123.[CrossRef][Medline]
  74. 38
  75. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119.[CrossRef][Medline]
  76. 39
  77. Zhang, N., N. J. MacLachlan, K. R. Bonneau, J. Zhu, Z. Li, K. Zhang, F. Zhang, L. Xia, and W. Xiang. 1999. Identification of seven serotypes of bluetongue virus from the People's Republic of China. Vet. Rec. 145:427-429.[Abstract/Free Full Text]
  78. 40
  79. Zientara, S., C. Sailleau, G. Dauphin, C. Roquier, E. M. Remond, F. Lebreton, S. Hammoumi, E. Dubois, C. Agier, G. Merle, and E. Breard. 2002. Identification of bluetongue virus serotype 2 (Corsican strain) by reverse-transcriptase PCR reaction analysis of segment 2 of the genome. Vet. Rec. 150:598-601.[Abstract/Free Full Text]


Journal of Virology, September 2008, p. 8339-8348, Vol. 82, No. 17
0022-538X/08/$08.00+0     doi:10.1128/JVI.00808-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Grigoras, I., Timchenko, T., Katul, L., Grande-Perez, A., Vetten, H.-J., Gronenborn, B. (2009). Reconstitution of Authentic Nanovirus from Multiple Cloned DNAs. J. Virol. 83: 10778-10787 [Abstract] [Full Text]  
  • Matsuo, E., Roy, P. (2009). Bluetongue Virus VP6 Acts Early in the Replication Cycle and Can Form the Basis of Chimeric Virus Formation. J. Virol. 83: 8842-8848 [Abstract] [Full Text]  
  • Celma, C. C. P., Roy, P. (2009). A Viral Nonstructural Protein Regulates Bluetongue Virus Trafficking and Release. J. Virol. 83: 6806-6816 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boyce, M.
Right arrow Articles by Roy, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boyce, M.
Right arrow Articles by Roy, P.