Previous Article | Next Article 
Journal of Virology, September 2008, p. 8307-8315, Vol. 82, No. 17
0022-538X/08/$08.00+0 doi:10.1128/JVI.00520-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Preservation of FoxP3+ Regulatory T Cells in the Peripheral Blood of Human Immunodeficiency Virus Type 1-Infected Elite Suppressors Correlates with Low CD4+ T-Cell Activation
Amanda J. Chase,1
Hung-Chih Yang,1
Hao Zhang,2
Joel N. Blankson,1* and
Robert F. Siliciano1,3*
Departments of Medicine, Johns Hopkins University School of Medicine,1
Molecular Microbiology and Immunology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, Maryland,2
Howard Hughes Medical Institute, Baltimore, Maryland3
Received 8 March 2008/
Accepted 3 June 2008

ABSTRACT
Elite suppressors (ES) are untreated human immunodeficiency
virus type 1 (HIV-1)-infected individuals who maintain normal
CD4
+ T-cell counts and control viremia to levels that are below
the limit of detection of current assays. The mechanisms involved
in long-term control of viremia have not been fully elucidated.
CD4
+ CD25
+ regulatory T cells (Tregs) downmodulate chronic inflammation
by suppressing the activation and proliferation of effector
lymphocytes. We found that while Tregs were functional in ES
and patients on highly active antiretroviral therapy (HAART),
ES maintained high levels of Tregs in peripheral blood mononuclear
cells whereas patients on HAART had evidence of Treg depletion.
We also demonstrated that Tregs can serve as reservoirs for
HIV-1 in vivo. These data suggest that both direct infection
by HIV-1 and tissue redistribution are possible explanations
for declining FoxP3
+ Tregs in progressive HIV-1 infection. Furthermore,
the maintenance of Tregs may be one mechanism associated with
the nonprogressive nature of HIV-1 infection in ES.

INTRODUCTION
CD4
+ CD25
+ regulatory T cells (Tregs) are a unique population
of T cells that suppress the activation and proliferation of
effector lymphocytes (
33,
35,
46,
49,
51-
53,
55). Tregs specifically
and exclusively express FOXP3, a transcription factor that plays
a key role in their development and function (
22,
29-
30). Ligation
of CD80 or CD86 on effector cells by the cell surface molecule
CTLA-4 on Tregs results in suppression of the effector cells
(
46). Suppression of effector cells by Tregs can also be mediated
over a short range by cytokines (interleukin 10 [IL-10] and
transforming growth factor β), by direct cell contact,
or by mechanisms that "instruct" antigen-presenting cells (APCs)
to increase tryptophan metabolism to interfere with T-cell activation
(
55). The role of Tregs in human immunodeficiency virus type
1 (HIV-1) pathogenesis remains unclear. One hypothesis holds
that these cells prevent chronic immune activation and are therefore
beneficial. Alternatively, it is possible that these cells suppress
the antiviral immune response and are therefore harmful.
Several studies have shown that despite elevated CD25 expression on CD4+ T cells, there is a depletion of Tregs from peripheral blood mononuclear cells (PBMCs) in patients with progressive HIV-1 disease. These and other data have led some investigators to conclude that Tregs play a beneficial role by limiting the apoptosis of uninfected CD4+ T cells that results from high levels of chronic immune activation (6, 8, 15, 18, 32, 41, 44, 54). On the other hand, it is possible that Tregs blunt HIV-1-specific immunity, allowing for uncontrolled viral replication in lymphoid tissue. In support of this hypothesis, studies showing decreased Tregs in PBMCs and increased Tregs in lymphoid organs suggest that there may be a redistribution of these cells in patients with progressive HIV-1 infection (5, 11, 21, 31, 42).
Some HIV-1-infected individuals, termed long-term nonprogressors (LTNP), remain asymptomatic and maintain high CD4+ T-cell counts for many years without antiretroviral treatment (14, 27, 45). A subset of LTNP, termed elite suppressors (ES), maintain viral loads of <50 copies of HIV-1 RNA/ml of plasma and normal CD4+ T-cell counts without therapy (16, 38, 48). Understanding the mechanisms by which ES control viremia may help us determine the factors that affect the rate of disease progression in HIV-1-infected individuals (2, 4, 10, 19, 39, 56). Previous studies have shown that the relative absence of Tregs in the lymphoid tissue from simian immunodeficiency virus- and HIV-infected LTNP was associated with durable virologic control (11, 42).
HIV-1 causes a persistent infection characterized by immune activation and a progressive loss in the number and function of CD4+ T cells. After treatment with highly active antiretroviral therapy (HAART), CD4+ T-cell numbers recover but their function remains persistently suppressed (12, 34). Hence, progressive and nonprogressive HIV-1 disease represents a range of immunological scenarios with potentially different outcomes for Tregs (26). In addition, it has been shown that Tregs are highly susceptible to productive HIV-1 infection in vitro (28, 44). We sought to determine the frequency, functionality, and rate of infection of Tregs in the PBMCs of ES in comparison to patients on HAART.

MATERIALS AND METHODS
Human subjects.
Healthy subjects (
n = 8) were adults who were HIV-1 negative.
Three groups of HIV-1-seropositive patients were included in
the study: asymptomatic patients who maintained viral loads
of <50 copies/ml without antiretroviral therapy (ES;
n =
12), asymptomatic patients who had achieved suppression of viremia
to <50 copies/ml on a stable HAART regimen (
n = 21), and
viremic patients (
n = 7). Inclusion criteria for aviremic HIV-1
+ patients were the following: (i) on HAART for more than 1 year,
(ii) suppression of viremia to <50 copies/ml for more than
1 year, and (iii) CD4 count of >200 cells/µl (in order
to ensure that enough CD4
+ T cells could be isolated for experiments).
Inclusion criteria for viremic HIV-1
+ patients were the following:
(i) lack of prior antiretroviral therapy or lack of antiretroviral
therapy for more than 1 year prior to study entry and (ii) viremia
of >1,000 copies/ml for more than 1 year. An exclusion criteria
for all blood donors was an AIDS-defining illness within 1 year
of blood draw. Table
1 lists the pertinent clinical characteristics
of the patients studied. All subjects provided written consent,
and the protocol was approved by the Institutional Review Board
of Johns Hopkins University School of Medicine.
Isolation of CD4+ T cells from peripheral blood.
PBMCs were isolated by density gradient centrifugation. For
flow cytometry analysis and real-time reverse transcription-PCR
(RT-PCR), CD4
+ T lymphocytes were isolated via positive selection
with human CD4 MicroBeads (Miltenyi). For quantitative PCR (qPCR),
suppression, and proliferation assays, PBMCs were first negatively
selected to remove CD8
+ T cells, B cells, monocytes, and NK
cells using mouse monoclonal antibodies to appropriate cell
surface markers and magnetic beads conjugated with antibodies
to mouse immunoglobulin G (Becton-Dickinson and Dynal Biotech).
Further purification of Tregs was accomplished by sorting on
a MoFlo cell sorter (DakoCytomation).
FOXP3 analysis.
RNA was extracted from 2 x 106 peripheral blood CD4+ T cells with RNAEasy (Qiagen), and 300 ng of RNA was reverse transcribed using random hexamers and the SuperScript III First-Strand synthesis system (Invitrogen). Quantitative real-time RT-PCR was carried out using the Applied Biosystems 7300 real-time PCR system. Standard curves were generated by cloning FOXP3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) PCR products into plasmids using Platinum Pfx and the Zero Blunt TOPO PCR cloning kit (Invitrogen). The following primers were used: for GAPDH, 5'-GGAAGGTGAAGGTCGGAGTCAACG-3' (sense) and 5'-CTGTTGTCATACTTCTCATGGTTCAC-3' (antisense); for FOXP3, 5'-GCACCTTCCCAAATCCCAGT-3' (sense) and 5'-GCAGGCAAGACAGTGGAAACC-3' (antisense). In vitro transcription was performed using the MEGAscript T7 kit (Ambion). For the quantitation of FOXP3 gene expression, we used a commercially available kit (TaqMan Assay-on-Demand; Applied Biosystems). To normalize for RNA input, the sample content of GAPDH was quantified with the TaqMan reagents for GAPDH (Applied Biosystems).
Flow cytometry.
For flow cytometric characterization of Tregs, CD4+ T cells were stained with directly conjugated monoclonal antibodies specific for the CD4, CD25, CD62L, Ki67, CD69, CD45RO, CTLA-4, HLA-DR (BD Pharmingen), GITR, or FoxP3 (clone PCH101; eBioscience) protein or with appropriate isotype controls. Flow cytometric analysis was performed using the FACSCalibur system with CellQuest software (Becton Dickinson).
qPCR assay for HIV Gag DNA.
Treg-cell-associated viral DNA was measured using a qPCR assay for HIV gag using the Applied Biosystems 7300 real-time PCR system. Gag primer sequences were as follows: gagF, GGTGCGAGAGCGTCAGTATTAAG; gagR, AGCTCCCTGCTTGCCCATA; the probe was gagP, FAM-AAAATTCGGTTAAGGCCAGGGGGAAAGAA-BHQ (Biosearch Technologies). CD4+ FoxP3+ CD25+ T cells and CD4+ FoxP3– CD25– T cells (3 x 104) were sorted into wells of a 96-well plate and lysed in 30 µl of 200 µg/ml proteinase K (Roche). For viremic patients, fluorescence-activated cell sorter (FACS)-purified CD4+ CD25hi CD62Lhi Treg and CD4+ CD25– resting T cells were isolated and lysed. qPCR was performed on 5 µl of cell lysate for 45 cycles using Platinum Taq (Invitrogen). Standards were constructed for absolute quantification of Gag from sequential dilutions of a cell line which contains one copy of Gag per cell. Triplicate reactions were run and template copies calculated using ABI 7300 software.
In vitro suppression assays.
FACS-purified CD4+ CD25– CD62Lhi T cells (1 x 105; responders) were incubated with 1 µM carboxyfluorescein succinimidyl ester (CFSE) for 10 min at room temperature, washed thoroughly, and then stimulated for 6 days with 1 x 105 irradiated (3,000 rad) autologous PBMCs as APCs and 0.5 µg/ml anti-CD3 antibody in 96-well round-bottomed plates (Corning). To measure suppressive activity, 3 x 104 FACS-purified CD4+ CD25hi CD62Lhi Tregs were added at day zero. On day 6 or 7, proliferation of responders was measured by CFSE dilution using a FACSCalibur system with CellQuest software (Becton Dickinson). Percent suppression was calculated as follows: (proliferation of CD4+ CD25– CD62Lhi T cells in the presence of CD4+ CD25hi CD62Lhi T cells/proliferation of CD4+ CD25– CD62Lhi T cells in the absence of CD4+ CD25hi CD62Lhi T cells) x 100. All suppression assays were set up in triplicate, and results were expressed as a mean of triplicates.
In vitro proliferation assays.
To analyze Treg proliferative capacity, 3 x 104 FACS-purified CD4+ CD25hi CD62Lhi Tregs were added to a Transwell insert (24-well type, pore size 0.4 µm; Costar). PBMCs (2 x 106) were added to each bottom well in medium containing 0.5 µg/ml anti-CD3 antibody, 1 µg/ml anti-CD28 antibody, and 100 U/ml recombinant IL-2. Either 5 µg/ml of HIV-1 p24 (Protein Sciences) or 0.1 µg/ml staphylococcal enterotoxin B (Sigma) was added to bottom wells. Cells were incubated for 6 days, pulsed with [3H]thymidine for the final 16 h, and harvested. All proliferation assays were set up in triplicate, and results were expressed as a mean of triplicates.
Statistical analysis.
The significance for all comparisons was calculated using Student's two-tailed t test assuming unequal variance. Spearman's rank test was used to determine the correlation between two variables. Statistical significance is defined as a P value of <0.05.

RESULTS
Inverse correlation between peripheral blood FOXP3+ Treg levels and CD4+ T-cell activation in patients with progressive HIV-1 disease.
Previous studies have documented a decrease in the frequency
of Tregs from the peripheral blood of patients with progressive
disease (
6,
8,
18,
44,
54). To determine the relative abundance
of Tregs in PBMCs of ES, we used a real-time RT-PCR assay to
quantify the expression of FOXP3, the most specific marker of
Tregs (
22,
29-
30), in CD4
+ T cells. FoxP3 is important in distinguishing
Tregs from activated/effector cells within the CD25
+ T-cell
population, especially in settings of immune activation (
23-
24).
The purity of CD4
+ T cells, positively selected from PBMCs,
was consistently between 98 and 100% (data not shown). FOXP3
mRNA expression in the peripheral blood of aviremic HAART-treated
and viremic patients was significantly decreased compared to
levels in ES (
P < 0.001) (Fig.
1A). The Treg copy number
in the peripheral blood of patients with progressive disease
was also decreased compared to that for uninfected patients
(
P < 0.05). Among all HIV-1-infected patients studied, those
with higher CD4 counts tended to have higher FOXP3 copy numbers,
but the trend did not reach statistical significance (
P = 0.06)
(Fig.
1B).
Consistent with the observed decrease in FOXP3 mRNA in PBMCs
of patients on HAART, expression of the FoxP3 protein in CD4
+ T cells, as determined by intracellular staining, was significantly
decreased compared to that for ES and uninfected patients (
P < 0.01). For each patient, a pure population of CD4
+ T cells
was surface stained with CD25-fluorescein isothiocyanate, permeabilized,
and stained with FoxP3-phycoerythrin. Interestingly, for the
patients on HAART, a majority of the CD4
+ T cells staining positive
for FoxP3 came from the CD25
+ subset. However, for ES and uninfected
patients, both the CD25
– and CD25
+ subsets coexpressed
FoxP3 (Fig.
2A). In mice, it has been shown that a majority
of CD4
+ FOXP3
+ T cells have regulatory activity irrespective
of their CD25 expression (
7,
23,
43). Patients on HAART had
significantly greater frequencies of activated CD4
+ T cells
(CD4
+ HLA-DR
+) than was the case for ES and uninfected patients
(
P < 0.01). The percentage of CD4
+ T cells coexpressing CD25
was higher for HAART-treated patients than for ES patients (
P = 0.052) (Fig.
2B, top graph). FoxP3
+ Tregs from the peripheral
blood of all patient groups examined coexpressed similar levels
of HLA-DR, CD69, and Ki67 (Fig.
2B, bottom graph). Importantly,
the FOXP3 copy number was negatively correlated (
P < 0.05)
with the frequency of activated CD4
+ T cells, suggesting that
Tregs might be important in controlling immune activation (Fig.
2C).
Depletion of peripheral blood FoxP3+ Tregs in HIV-1 infection can be partially explained by direct infection.
We used qPCR to quantify the cell-associated virus in sorted
FoxP3
+ Tregs in order to determine whether direct HIV-1 infection
of Tregs could account for their depletion from the peripheral
blood of patients with progressive disease. CD4
+ FoxP3
+ CD25
+ Tregs were infected at a mean frequency of 5.7 per 10
5 cells
in patients on HAART and 0.4 per 10
5 cells in ES. This difference
in the infection rate approached statistical significance (
P = 0.07) (Fig.
3). The infection frequency of CD4
+ FoxP3
– CD25
– resting T cells from the peripheral blood of ES
was significantly lower than that observed for patients on HAART
(
P < 0.01). In viremic individuals, Tregs were infected at
a rate of 126.4 to 760.5 per 10
5 while resting CD4
+ T cells
were infected at a frequency of 169.2 to 604.3 per 10
5. Overall,
the results show that CD4
+ FoxP3
+ CD25
+ Tregs are infected by
HIV-1 in vivo but not at a higher frequency than CD4
+ FoxP3
– CD25
– resting T cells (Fig.
3). Thus, the depletion of
Tregs from the peripheral blood of patients with progressive
disease may be associated with relocation to tissue sites and/or
deficiencies in their maintenance rather than preferential infection.
Freshly isolated Tregs from aviremic HIV-1-infected patients
were stimulated in vitro to detect cells harboring replication-competent
HIV-1. Culture supernatants consistently tested negative for
virus production. While we were able to culture replication-competent
virus from Tregs from viremic patients, it is not clear whether
the replication-competent virus was derived from integrated
proviruses or unintegrated viruses from cells that had recently
been infected. The lack of virus production from Tregs in HAART-treated
patients could be due to a block in viral production after integration
that is specific to Tregs whereby the observed viral production
from Tregs in viremic patients would be coming from recently
infected cells harboring unintegrated virus (
25).
Treg functional activity in HAART-treated and ES patients.
In order to measure the functional activity of Tregs, it was necessary to isolate a pure population from PBMCs. The only known surface characteristics that distinguish Tregs from activated cells are the levels of CD25 expression and CD62L (L-selectin) (8, 9, 13, 18). In order to rule out contamination with activated/effector cells in our assays, we used expression of CD62L to sort for Tregs, because CD62L is down-regulated upon lymphocyte activation. Discrimination of Tregs from activated cells was achieved by sorting for the CD4+ CD25hi CD62Lhi population (Fig. 4). Mean FoxP3 expression by flow cytometric analysis of sorted cells was 88% (range = 82 to 93). As determined by real-time RT-PCR, there was an 8.9-fold ± 1.4-fold increase in FoxP3 expression in CD4+ CD25hi CD62Lhi Tregs versus expression in CD4+ CD25– CD62Lhi naive T cells. The gated population was enriched in its expression of CD45RO, CTLA-4, and GITR (data not shown), consistent with the known immunophenotype of Tregs (18, 44, 46).
Tregs suppress the activation and proliferation of effector
cells. To determine whether the decrease in frequency of peripheral
blood FoxP3
+ Tregs in patients on HAART was accompanied by a
decrease in the functionality of these cells, we compared the
suppressive capacity of Tregs from ES, viremic individuals,
and patients on HAART. As shown in Fig.
5A, the CD4
+ CD25
hi CD62L
hi Treg subset in all patient groups limited division of
naive cells stimulated by TCR cross-linking. There was no difference
in the suppressive function of Tregs in ES and patients on HAART,
but the suppressive activity of Tregs in viremic individuals
appeared to be somewhat diminished compared to that in both
groups (Fig.
5B).
Another way to address Treg functional differences between patient
groups is to measure Treg proliferative capacity. IL-2 is essential
to the development and survival of Tregs (
3,
17,
37). With the
provision of exogenous IL-2, Tregs can proliferate to antigen-loaded
APCs or to anti-CD3-based stimulation (
51,
53). A transwell
culture system was used to analyze cytokine-induced Treg proliferation
in response to autologous PBMCs that were stimulated with either
SEB or p24. There were no significant differences in the proliferative
capacity of peripheral blood Tregs of HAART-treated and ES patients
(Fig.
5C). Proliferation of freshly isolated CD4
+ CD25
hi CD62L
hi Tregs without stimulation was at background levels (data not
shown). Thus, analysis of Treg suppressive and proliferative
activity in HAART-treated and ES patients suggested that there
were no functional differences in their peripheral blood Treg
populations. Increased CD4
+ T-cell activation in patients on
HAART was manifested not by a decrease in Treg suppressive activity
but rather by a decrease in the number of peripheral blood Tregs
that are available to control immune activation.

DISCUSSION
Tregs are thought to play a major role in the control T-cell
self-reactivity and immune activation. Because of the common
mechanisms involved in immune activation associated with autoimmunity
and microbial exposure, Tregs can cause downmodulation of pathogen-specific
immune responses. Several groups have postulated that Tregs
help to limit the chronic immune activation associated with
HIV-1 infection and are therefore beneficial to the host (
6,
8,
15,
18,
32,
41,
44,
54). Yet other groups argue that the
suppression of HIV-1-specific effector cells can be detrimental
to the host (
1,
5,
11,
21,
31,
36,
42,
56). It remains to be
determined what plays a greater role in HIV-1 pathogenesis,
the advantageous effects of controlling immune activation or
the harmful effects caused by the limitation of an antiviral
immune response. We analyzed the frequency of Tregs in ES in
an attempt to discern whether these cells play a role in the
nonprogressive nature of the disease in this group of patients.
We used both quantitative RT-PCR and flow cytometric analysis to show that peripheral blood Tregs are preserved in ES, in contrast to their decline in patients with progressive disease, including patients on HAART. There was a negative correlation between the frequency of Tregs and the percentage of activated CD4+ T cells, suggesting that in patients in which the peripheral Treg pool is preserved, a mechanism exists to limit immune activation. In both HAART-treated and ES patients, the frequency of infection within the FoxP3+ Treg subset was lower than the frequency of infection in resting CD4+ T cells.
Some (11, 31, 42) but not all (40) prior studies have shown that Tregs migrate to lymphoid tissue in HIV-1-infected chronic progressors but not in LTNP. The observation that Tregs do not relocate to lymphoid tissue in LTNP may explain the preservation of peripheral Tregs in ES in our study. The maintanence of a peripheral Treg pool in ES could be a consequence of low levels of viral replication at lymphoid sites. A small study showed that viral loads in the intestinal mucosa of LTNP are undetectable (50); thus, Tregs may not home to this site in these patients. Further studies will be needed to determine the relative frequency of Tregs in the lymphoid tissue of ES. Our functional studies suggested that Tregs from patients on HAART retain the same degree of functional activity as Tregs from ES patients. The reported lack of tissue relocation in LTNP may suggest that accumulation of Tregs at tissue sites contributes to HIV-1 pathogenesis (5, 11, 20-21, 31, 42). Alternatively, it may be a reflection of the control of viral replication at these sites (50).
In summary, our observations indicate that peripheral Treg depletion in HIV-1 infection may be a contributing factor to the high levels of immune activation present in patients with progressive disease, since Treg depletion was not observed in ES. Tregs are not preferentially infected; thus, the question remains whether their depletion in patients with progressive disease is due to death by infection or redistribution to lymphoid tissue. Our studies emphasize that there is a delicate balance between the qualitatively superior HIV-1-specific immune response that inhibits replication of HIV-1 in ES (2, 4, 10, 19, 39, 47) and the regulatory mechanisms that prevent nonspecific immune activation in these patients. Successful therapeutic vaccines will have to induce this balance in patients with progressive HIV-1 disease.

ACKNOWLEDGMENTS
We thank the entire Siliciano laboratory (Johns Hopkins University
School of Medicine, Baltimore, MD) for insightful discussions.
This study was funded by NIH grants K08 AI51191 and R56 AI73185-01A1 (J.N.B.) and AI43222 and AI51178 (R.F.S.) and by grants from the Doris Duke Charitable Foundation (R.F.S.) and the Howard Hughes Medical Institute (R.F.S).

FOOTNOTES
* Corresponding author. Mailing address: Department of Medicine, Johns Hopkins University School of Medicine, Broadway Research Building, Room 880, 733 N. Broadway, Baltimore, MD 21205. Phone: (410) 955-7757. Fax: (410) 502-1144. E-mail for Joel Blankson:
jblanks{at}jhmi.edu. E-mail for Robert Siliciano:
rsiliciano{at}jhmi.edu 
Published ahead of print on 25 June 2008. 

REFERENCES
1 - Aandahl, E. M., J. Michaelsson, W. J. Moretto, F. M. Hecht, and D. F. Nixon. 2004. Human CD4+ CD25+ regulatory T cells control T-cell responses to human immunodeficiency virus and cytomegalovirus antigens. J. Virol. 78:2454-2459.[Abstract/Free Full Text]
2 - Addo, M. M., R. Draenert, A. Rathod, C. L. Verrill, B. T. Davis, R. T. Gandhi, G. K. Robbins, N. O. Basgoz, D. R. Stone, D. E. Cohen, M. N. Johnston, T. Flynn, A. G. Wurcel, E. S. Rosenberg, M. Altfeld, and B. D. Walker. 2007. Fully differentiated HIV-1 specific CD8+ T effector cells are more frequently detectable in controlled than in progressive HIV-1 infection. PLoS ONE 2:e321.[CrossRef]
3 - Almeida, A. R. M., N. Legrand, M. Papiernik, and A. A. Freitas. 2002. Homeostasis of peripheral CD4+ T cells: IL-2R
and IL-2 shape a population of regulatory cells that controls CD4+ T cell numbers. J. Immunol. 169:4850-4860.[Abstract/Free Full Text] 4 - Almeida, J. R., D. A. Price, L. Papagno, Z. A. Arkoub, D. Sauce, E. Bornstein, T. E. Asher, A. Samri, A. Schnuriger, I. Theodorou, D. Costagliola, C. Rouzioux, H. Agut, A. G. Marcelin, D. Douek, B. Autran, and V. Appay. 2007. Superior control of HIV-1 replication by CD8+ T cells is reflected by their avidity, polyfunctionality, and clonal turnover. J. Exp. Med. 204:2473-2485.[Abstract/Free Full Text]
5 - Andersson, J., A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G. M. Shearer, and C. A. Chougnet. 2005. Cutting edge: the prevalence of regulatory T cells in lymphoid tissue is correlated with viral load in HIV-infected patients. J. Immunol. 174:3143-3147.[Abstract/Free Full Text]
6 - Apoil, P. A., B. Puissant, F. Roubinet, M. Abbal, P. Massip, and A. Blancher. 2005. FOXP3 mRNA levels are decreased in peripheral blood CD4+ lymphocytes from HIV-positive patients. J. Acquir. Immune Defic. Syndr. 39:381-385.[CrossRef][Medline]
7 - Baecher-Allan, C., J. A. Brown, G. J. Freeman, and D. A. Hafler. 2001. CD4+CD25high Regulatory Cells in Human Peripheral Blood. J. Immunol. 167:1245-1253.[Abstract/Free Full Text]
8 - Baker, C. A., R. Clark, F. Ventura, N. G. Jones, D. Guzman, D. R. Bangsberg, and H. Cao. 2007. Peripheral CD4 loss of regulatory T cells is associated with persistent viraemia in chronic HIV infection. Clin. Exp. Immunol. 147:533-539.[Medline]
9 - Banham, A. H. 2006. Cell-surface IL-7 receptor expression facilitates the purification of FOXP3+ regulatory T cells. Trends Immunol. 27:541-544.[CrossRef][Medline]
10 - Betts, M. R., M. C. Nason, S. M. West, S. C. De Rosa, S. A. Migueles, J. Abraham, M. M. Lederman, J. M. Benito, P. A. Goepfert, M. Connors, M. Roederer, and R. A. Koup. 2006. HIV nonprogressors preferentially maintain highly functional HIV-specific CD8+ T-cells. Blood 107:4781-4789.[Abstract/Free Full Text]
11 - Boasso, A., M. Vaccari, A. Hryniewicz, D. Fuchs, J. Nacsa, V. Cecchinato, J. Andersson, G. Franchini, G. M. Shearer, and C. Chougnet. 2007. Regulatory T-cell markers, indoleamine 2,3-dioxygenase, and virus levels in spleen and gut during progressive simian immunodeficiency virus infection. J. Virol. 81:11593-11603.[Abstract/Free Full Text]
12 - Burgess, K., P. Price, I. R. James, S. F. Stone, N. M. Keane, A. Y. Lim, J. R. Warmington, and M. A. French. 2006. Interferon-gamma responses to Candida recover slowly or remain low in immunodeficient HIV patients responding to ART. J. Clin. Immunol. 26:160-167.[CrossRef][Medline]
13 - Cao, D., V. Malmstrom, C. Baecher-Allan, D. Hafler, L. Klareskog, and C. Trollmo. 2003. Isolation and functional characterization of regulatory CD25brightCD4+ T cells from the target organ of patients with rheumatoid arthritis. Eur. J. Immunol. 33:215-223.[CrossRef][Medline]
14 - Cao, Y., L. Qin, L. Zhang, J. Safrit, and D. D. Ho. 1995. Virologic and immunologic characterization of long-term survivors of human immunodeficiency virus type 1 infection. N. Engl. J. Med. 332:201-208.[Abstract/Free Full Text]
15 - Chase, A. J., A. R. Sedaghat, J. R. German, L. Gama, M. C. Zink, J. E. Clements, and R. F. Siliciano. 2007. Severe depletion of CD4+ CD25+ regulatory T cells from the intestinal lamina propria but not peripheral blood or lymph nodes during acute simian immunodeficiency virus infection. J. Virol. 81:12748-12757.[Abstract/Free Full Text]
16 - Deeks, S. G., and B. D. Walker. 2007. Human immunodeficiency virus controllers: mechanisms of durable virus control in the absence of antiretroviral therapy. Immunity 27:406-416.[CrossRef][Medline]
17 - de la Rosa, M., S. Rutz, H. Dorninger, and A. Scheffold. 2004. Interleukin-2 is essential for CD4+CD25+ regulatory T cell function. Eur. J. Immunol. 34:2480-2488.[CrossRef][Medline]
18 - Eggena, M. P., B. Barugahare, N. Jones, M. Okello, S. Mutalya, C. Kityo, P. Mugyenyi, and H. Cao. 2005. Depletion of regulatory T cells in HIV infection is associated with immune activation. J. Immunol. 174:4407-4414.[Abstract/Free Full Text]
19 - Emu, B., E. Sinclair, D. Favre, W. J. Moretto, P. Hsue, R. Hoh, J. N. Martin, D. F. Nixon, J. M. McCune, and S. G. Deeks. 2005. Phenotypic, functional, and kinetic parameters associated with apparent T-cell control of human immunodeficiency virus replication in individuals with and without antiretroviral treatment. J. Virol. 79:14169-14178.[Abstract/Free Full Text]
20 - Epple, H. J., C. Loddenkemper, D. Kunkel, H. Troeger, J. Maul, V. Moos, E. Berg, R. Ullrich, J. D. Schulzke, H. Stein, R. Duchmann, M. Zeitz, and T. Schneider. 2006. Mucosal but not peripheral FOXP3+ regulatory T cells are highly increased in untreated HIV infection and normalize after suppressive HAART. Blood 108:3072-3078.[Abstract/Free Full Text]
21 - Estes, J. D., Q. Li, M. R. Reynolds, S. Wietgrefe, L. Duan, T. Schacker, L. J. Picker, D. I. Watkins, J. D. Lifson, C. Reilly, J. Carlis, and A. T. Haase. 2006. Premature induction of an immunosuppressive regulatory T cell response during acute simian immunodeficiency virus infection. J. Infect. Dis. 193:703-712.[CrossRef][Medline]
22 - Fontenot, J. D., M. A. Gavin, and A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4:330-336.[CrossRef][Medline]
23 - Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, and A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor Foxp3. Immunity 22:329-341.[CrossRef][Medline]
24 - Fontenot, J. D., and A. Y. Rudensky. 2005. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat. Immunol. 6:331-337.[CrossRef][Medline]
25 - Grant, C., U. Oh, K. Fugo, N. Takenouchi, C. Griffith, K. Yao, T. E. Newhook, L. Ratner, and S. Jacobson. 2006. Foxp3 represses retroviral transcription by targeting both NF-
B and CREB pathways. PLoS Pathog. 2:e33.[CrossRef][Medline] 26 - Grossman, Z., M. Meier-Schellersheim, A. E. Sousa, R. M. M. Victorino, and W. E. Paul. 2002. CD4+ T-cell depletion in HIV infection: are we closer to understanding the cause? Nat. Med. 8:319-323.[CrossRef][Medline]
27 - Harrer, T., E. Harrer, S. A. Kalams, T. Elbeik, S. I. Staprans, M. B. Feinberg, Y. Cao, D. D. Ho, T. Yilma, A. M. Caliendo, R. P. Johnson, S. P. Buchbinder, and B. D. Walker. 1996. Strong cytotoxic T cell and weak neutralizing antibody responses in a subset of persons with stable nonprogressing HIV type 1 infection. AIDS Res. Hum. Retrovir. 12:585-592.[Medline]
28 - Holmes, D., G. Knudsen, S. Mackey-Cushman, and L. Su. 2007. FoxP3 enhances HIV-1 gene expression by modulating NF
B occupancy at the LTR in human T cells. J. Biol. Chem. 282:15973-15980.[Abstract/Free Full Text] 29 - Hori, S., T. Nomura, and S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057-1061.[Abstract/Free Full Text]
30 - Khattri, R., T. Cox, S. A. Yasayko, and F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4:337-342.[CrossRef][Medline]
31 - Kinter, A., J. McNally, L. Riggin, R. Jackson, G. Roby, and A. S. Fauci. 2007. Suppression of HIV-specific T cell activity by lymph node CD25+ regulatory T cells from HIV-infected individuals. Proc. Natl. Acad. Sci. USA 104:3390-3395.[Abstract/Free Full Text]
32 - Kinter, A. L., M. Hennessey, A. Bell, S. Kern, Y. Lin, M. Daucher, M. Planta, M. McGlaughlin, R. Jackson, S. F. Ziegler, and A. S. Fauci. 2004. CD25+CD4+ regulatory T cells from the peripheral blood of asymptomatic HIV-infected individuals regulate CD4+ and CD8+ HIV-specific T cell immune responses in vitro and are associated with favorable clinical markers of disease status. J. Exp. Med. 200:331-343.[Abstract/Free Full Text]
33 - Kumar, V. 2004. Homeostatic control of immunity by TCR peptide-specific Tregs. J. Clin. Investig. 114:1222-1226.[CrossRef][Medline]
34 - Lederman, H. M., P. L. Williams, J. W. Wu, T. G. Evans, S. E. Cohn, J. A. McCutchan, S. L. Koletar, R. Hafner, E. Connick, F. T. Valentine, M. J. McElrath, N. J. Roberts, Jr., and J. S. Currier. 2003. Incomplete immune reconstitution after initiation of highly active antiretroviral therapy in human immunodeficiency virus-infected patients with severe CD4+ T-cell depletion. J. Infect. Dis. 188:1794-1803.[CrossRef][Medline]
35 - Levings, M. K., R. Sangregorio, and M. G. Roncarolo. 2001. Human CD25+CD4+ T regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. J. Exp. Med. 193:1295-1302.[Abstract/Free Full Text]
36 - Lim, A., D. Tan, P. Price, A. Kamarulzaman, H. Y. Tan, I. James, and M. A. French. 2007. Proportions of circulating T cells with a regulatory cell phenotype increase with HIV-associated immune activation and remain high on antiretroviral therapy. AIDS 21:1525-1534.[CrossRef][Medline]
37 - Malek, T. R., A. Yu, V. Vincek, P. Scibelli, and L. Kong. 2002. CD4 regulatory T cells prevent lethal autoimmunity in IL-2Rβ-deficient mice: implications for the nonredundant function of IL-2. Immunity 17:167-178.[CrossRef][Medline]
38 - Migueles, S. A., M. S. Sabbaghian, W. L. Shupert, M. P. Bettinotti, F. M. Marincola, L. Martino, C. W. Hallahan, S. M. Selig, D. Schwartz, J. Sullivan, and M. Connors. 2000. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proc. Natl. Acad. Sci. USA 97:2709-2714.[Abstract/Free Full Text]
39 - Migueles, S. A., A. C. Laborico, W. L. Shupert, M. S. Sabbaghian, R. Rabin, C. W. Hallahan, D. Van Baarle, S. Kostense, F. Miedema, M. McLaughlin, L. Ehler, J. Metcalf, S. Liu, and M. Connors. 2002. HIV-specific CD8+ T cell proliferation is coupled to perforin expression and is maintained in nonprogressors. Nat. Immunol. 3:1061-1068.[CrossRef][Medline]
40 - Mozos, A., M. Garrido, J. Carreras, M. Plana, A. Diaz, L. Alos, E. Campo, F. Garcia, and A. Martinez. 2007. Redistribution of FOXP3-positive regulatory T cells from lymphoid tissues to peripheral blood in HIV-infected patients. J. Acquir. Immune Defic. Syndr. 46:529-537.[CrossRef][Medline]
41 - Ndhlovu, L. C., C. P. Loo, G. Spotts, D. F. Nixon, and F. M. Hecht. 2008. FOXP3 expressing CD127lo CD4+ T cells inversely correlates with CD38+ CD8+ T cell activation levels in primary HIV-1 infection. J. Leukoc. Biol. 83:254-262.[Abstract/Free Full Text]
42 - Nilsson, J., A. Boasso, P. A. Velilla, R. Zhang, M. Vaccari, G. Franchini, G. M. Shearer, J. Andersson, and C. Chougnet. 2006. HIV-1 driven regulatory T cell accumulation in lymphoid tissues is associated with disease progression in HIV/AIDS. Blood 108:3808-3817.[Abstract/Free Full Text]
43 - Nishimura, E., T. Sakihama, R. Setoguchi, K. Tanaka, and S. Sakaguchi. 2004. Induction of antigen-specific immunologic tolerance by in vivo and in vitro antigen-specific expansion of naturally arising Foxp3+CD25+CD4+ regulatory T cells. Int. Immunol. 16:1189-1201.[Abstract/Free Full Text]
44 - Oswald-Richter, K., S. M. Grill, N. Shariat, M. Leelawong, M. S. Sundrud, D. W. Haas, and D. Unutmaz. 2004. HIV infection of naturally occurring and genetically reprogrammed human regulatory T-cells. PLoS Biol. 2:e198.[CrossRef][Medline]
45 - Pilgrim, A. K., G. Pantaleo, O. J. Cohen, L. M. Fink, J. Y. Zhou, J. T. Zhou, D. P. Bolognesi, A. S. Fauci, and D. C. Montefiori. 1997. Neutralizing antibody responses to human immunodeficiency virus type 1 in primary infection and long-term-nonprogressive infection. J. Infect. Dis. 176:924-932.[Medline]
46 - Read, S., V. Malmstrom, and F. Powrie. 2000. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25+CD4+ regulatory cells that control intestinal inflammation. J. Exp. Med. 192:295-302.[Abstract/Free Full Text]
47 - Saez-Cirion, A., C. Lacabaratz, O. Lambotte, P. Versmisse, A. Urrutia, F. Boufassa, F. Barre-Sinoussi, J. F. Delfraissy, M. Sinet, G. Pancino, A. Venet, and Agence Nationale de Recherches sur le Sida EP36 HIV Controllers Study Group. 2007. HIV controllers exhibit potent CD8 T cell capacity to suppress HIV infection ex vivo and peculiar cytotoxic T lymphocyte activation phenotype. Proc. Natl. Acad. Sci. USA 104:6776-6781.[Abstract/Free Full Text]
48 - Saez-Cirion, A., G. Pancino, M. Sinet, A. Venet, O. Lambotte, and ANRS EP36 HIV Controllers study group. 2007. HIV controllers: how do they tame the virus? Trends Immunol. 28:532-540.[Medline]
49 - Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, and M. Toda. 1995. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor
-chains (CD25). J. Immunol. 155:1151-1164.[Abstract] 50 - Sankaran, S., M. Guadalupe, E. Reay, M. D. George, J. Flamm, T. Prindiville, and S. Dandekar. 2005. Gut mucosal T cell responses and gene expression correlate with protection against disease in long-term HIV-1-infected nonprogressors. Proc. Natl. Acad. Sci. USA 102:9860-9865.[Abstract/Free Full Text]
51 - Shevach, E. M. 2002. CD4+ CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2:389-400.[Medline]
52 - Taams, L. S., M. Vukmanovic-Stejic, J. Smith, P. J. Dunne, J. M. Fletcher, F. J. Plunkett, S. B. Ebeling, G. Lombardi, M. H. Rustin, J. W. Bijlsma, F. P. Lafeber, M. Salmon, and A. N. Akbar. 2002. Antigen-specific T cell suppression by human CD4+CD25+ regulatory T cells. Eur. J. Immunol. 32:1621-1630.[CrossRef][Medline]
53 - Thornton, A. M., and E. M. Shevach. 1998. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J. Exp. Med. 188:287-296.[Abstract/Free Full Text]
54 - Tsunemi, S., T. Iwasaki, T. Imado, S. Higasa, E. Kakishita, T. Shirasaka, and H. Sano. 2005. Relationship of CD4+CD25+ regulatory T cells to immune status in HIV-infected patients. AIDS 19:879-886.[Medline]
55 - von Boehmer, H. 2005. Mechanisms of suppression by suppressor T cells. Nat. Immunol. 6:338-344.[CrossRef][Medline]
56 - Weiss, L., V. Donkova-Petrini, L. Caccavelli, M. Balbo, C. Carbonneil, and Y. Levy. 2004. Human immunodeficiency virus-driven expansion of CD4+CD25+ regulatory T cells, which suppress HIV-specific CD4 T-cell responses in HIV-infected patients. Blood 104:3249-3256.[Abstract/Free Full Text]
Journal of Virology, September 2008, p. 8307-8315, Vol. 82, No. 17
0022-538X/08/$08.00+0 doi:10.1128/JVI.00520-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Moreno-Fernandez, M. E., Zapata, W., Blackard, J. T., Franchini, G., Chougnet, C. A.
(2009). Human Regulatory T Cells Are Targets for Human Immunodeficiency Virus (HIV) Infection, and Their Susceptibility Differs Depending on the HIV Type 1 Strain. J. Virol.
83: 12925-12933
[Abstract]
[Full Text]
-
Saez-Cirion, A., Sinet, M., Shin, S. Y., Urrutia, A., Versmisse, P., Lacabaratz, C., Boufassa, F., Avettand-Fenoel, V., Rouzioux, C., Delfraissy, J.-F., Barre-Sinoussi, F., Lambotte, O., Venet, A., Pancino, G., for the ANRS EP36 HIV Controllers Study Group,
(2009). Heterogeneity in HIV Suppression by CD8 T Cells from HIV Controllers: Association with Gag-Specific CD8 T Cell Responses. J. Immunol.
182: 7828-7837
[Abstract]
[Full Text]