Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leendertz, F. H. Articles by Junglen, S. Search for Related Content PubMed PubMed Citation Articles by Leendertz, F. H. Articles by Junglen, S.

 Previous Article  |  Next Article 

Journal of Virology, August 2008, p. 7741-7744, Vol. 82, No. 15
0022-538X/08/$08.00+0     doi:10.1128/JVI.00549-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Interspecies Transmission of Simian Foamy Virus in a Natural Predator-Prey System

Fabian H. Leendertz,^1,2* Florian Zirkel,¹ Emmanuel Couacy-Hymann,³ Heinz Ellerbrok,¹ Vladimir A. Morozov,⁴ Georg Pauli,¹ Claudia Hedemann,¹ Pierre Formenty,⁵ Siv Aina Jensen,^1,6 Christophe Boesch,² and Sandra Junglen^1,2

Robert Koch Institute, Nordufer 20, 13353 Berlin, Germany,¹ Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany,² Lanada/Lcpa, Bingerville, Côte d'Ivoire,³ Institute of Human Virology, University of Maryland, 725 W. Lombard Street, Baltimore, Maryland 21201,⁴ Ebola Taï Forest Project, World Health Organization, WHO Office, Abidjan, Côte d'Ivoire,⁵ Norwegian School of Veterinary Science, P.O. Box 8146 dep., N-0033 Oslo, Norway⁶

Received 12 March 2008/ Accepted 16 May 2008

Top ABSTRACT TEXT REFERENCES

 
Simian foamy viruses (SFV) are ancient retroviruses of primates and have coevolved with their host species for as many as 30 million years. Although humans are not naturally infected with foamy virus, infection is occasionally acquired through interspecies transmission from nonhuman primates. We show that interspecies transmissions occur in a natural hunter-prey system, i.e., between wild chimpanzees and colobus monkeys, both of which harbor their own species-specific strains of SFV. Chimpanzees infected with chimpanzee SFV strains were shown to be coinfected with SFV from colobus monkeys, indicating that apes are susceptible to SFV superinfection, including highly divergent strains from other primate species.

Top ABSTRACT TEXT REFERENCES

 
Simian foamy viruses (SFV) and their nonhuman primate hosts demonstrate coevolution (20). Despite the fact that SFV strains have been described for most Old World primate species, no human-specific foamy virus has yet been identified (16). However, zoonotic transmissions of SFV from various nonhuman primates to zookeepers and central African hunters or others having close contact with nonhuman primates are known to occur (5, 8-10, 21, 22). Such viruses have sequences that show a close relationship to SFV sequences from several nonhuman primate species (Fig. 1). Until now, it has been unclear whether such interspecies transmission can also take place when the hunter is naturally infected with its own species-specific SFV. Wild chimpanzees that regularly hunt and consume western red colobus monkeys (4) provide such a situation.

View larger version (16K): [in this window] [in a new window]

FIG. 1. Phylogenetic tree of 389-bp fragments of the SFV integrase-encoding regions of SFVcpz, SFVwrc, and other representative SFV strains. The tree was generated using the neighbor joining method (PHYLIP 3.572 package). Bootstrap resampling with 1,000 replicates was employed to place approximate confidence limits on individual branches. Percentages of bootstrap support for internal nodes are shown for values above 50. Dots represent SFV strains for the corresponding species, indicated by the vertical bar. Stars represent foamy viruses found in humans. For sequences generated in this study, exact names are given. Names of chimpanzees with double infection with SFVcpz and SFVwrc are in boldface and enlarged. An SFV spider monkey sequence (X83298) was used as an outgroup. Other sequences used were SFV sequences from African monkeys (Allenopithecus nigroviridis, AM492842; Colobus guereza, AY278791; Cercocebus atys, AF049079; Papio ursinus, AY686179; Cercopithecus neglectus, AY278782; Mandrillus sphinx, AY583781), Asian monkeys (Macaca silenus, AY686201; Macaca cyclopis, X83290; Macaca tonkeana, DQ354075 and DQ354089; Rhesus sp., X83292), and great apes (Pongo sp., AM492904 and AY686203; Gorilla sp., AY195688 and AY27879; Pan paniscus, AF049086 and AJ627550; Pan troglodytes vellerosus, AY639141 and AY639122; Pan troglodytes schweinfurthii, AY195675, AY195676, EU1027480, EU1027409, and EU1027490; Pan troglodytes troglodytes, AY639126, AY639123, and AY639128; Pan troglodytes verus, AY195685, X83297, X83296, AY195682, DQ142644, DQ142659 to 142666, EU248952 to EU248954) and foamy virus sequences from humans (AY195698, AY278776, and X83294).

Wild chimpanzees (Pan troglodytes verus) and western red colobus monkeys (Piliocolobus badius) sharing a rainforest habitat, the Taï National Park, Côte d'Ivoire, were tested for SFV infection. The chimpanzees have been under human observation for more than 25 years and are known individually as a result of a project focusing on wild chimpanzee behavior. Tissue samples were obtained from 14 chimpanzees that had died of anthrax, respiratory disease, or other causes (12, 14, 15). Samples of blood, collected in EDTA, from nine red colobus monkeys were obtained under anesthesia, and organ samples were collected from the remains of a further two that had been killed and eaten by chimpanzees (15). All represented adult animals.

Using the SFV primers for the integrase gene (19), previous analyses revealed that 12 of the 14 chimpanzees harbored SFV strains (SFV_cpz) corresponding to strains described for the chimpanzee subspecies Pan troglodytes verus (details will be published elsewhere). Also 11 red colobus monkeys were tested positive for SFV using the same primers and standard conditions (96°C for 5 min; 40 cycles 96°C for 1 min, 56°C [first PCR] or 60°C [nested PCR] for 30 s, 72°C for 1 min; and a final elongation step at 72°C for 10 min). PCR products were purified using the QIAquick PCR purification kit (Qiagen) and sequenced directly in both directions without interim cloning.

Phylogenetic analysis using the neighbor joining method (BioEdit, PHYLIP 3.572 package) of these 389-bp sequences was performed (18). Bootstrap resampling with 1,000 replicates was employed to place approximate confidence limits on individual branches. The tree revealed a species-specific SFV lineage (SFV_wrc) unique to red colobus monkeys. Based on sequences derived from SFV_wrc, species-specific primers were designed for a first-round PCR (SFVwrc 1s, 5' CATACAATTACCACTCCAAGCCT; SFVwrc 2as, 5' CAGACAAATCCAGTCATACCATC; 473 bp). Consecutively, two seminested PCRs combining primer SFVwrc 1s with SFVwrc 3s (5' CTCAGTACTGGTGGCCAAATCTTAGA; 220 bp) and SFVwrc 2as with SFVwrc 4as (5' CCAGTCATACCATCGACTACTACAAGG; 423 bp) were performed. SFV sequences were amplified from spleen DNA of 2 of the 14 wild chimpanzees by using the SFV_wrc-specific primers. All PCR products were sequenced, aligned, and compared to the public database using BLAST NCBI (Table 1). High similarity of the sequences derived from the chimpanzees using the SFV_wrc primers and the colobus monkey sequences was seen (similarity of 98 to 99%). In contrast, the SFV chimpanzee sequences derived through PCRs using the generic SFV primers were only distantly related (78 to 81%), pointing to a double infection with two different SFV isolates.

View this table: [in this window] [in a new window]

TABLE 1. Chimpanzees from the Taï National Park (Côte d'Ivoire) analyzed for SFVcpz and SFVwrc infection

Sequences were aligned using BioEdit, and phylogenetic analyses using the neighbor joining method as well as the maximum likelihood algorithms (PHYLIP 3.572 package; data not shown) revealed two well-separated clusters of colobus and chimpanzee SFV strains. Sequences obtained from chimpanzee samples using SFV_wrc-specific primers showed that 2 of the 14 chimpanzees already infected with SFV_cpz were simultaneously infected with SFV_wrc (Fig. 1). Two chimpanzees were SFV_cpz negative; however, these were infants, and it has been shown that seroconversion usually occurs when primates get older (3, 11). These two chimpanzees were also negative for SFV_wrc. It should be noted that chimpanzee and colobus samples were collected at different times on different occasions and handled separately at all times and that extensive precautions were taken to avoid cross-contamination during DNA preparation and PCR analysis.

The two dually infected chimpanzees harbored unique SFV_wrc strains, indicating the introduction of SFV_wrc on independent occasions, rather than onward transmission of SFV_wrc among chimpanzees. Several studies have shown that exposure to saliva is a predominant route of SFV transmission (6, 7, 10, 21). It is thus likely that the two chimpanzees acquired SFV_wrc in the context of predation, as especially the males are frequent hunters and may be bitten by their prey. In addition, male chimpanzees consume significantly more monkey meat than females and chew entire bones, a habit that may cause lesions in the oral cavity (4). The two SFV_wrc-positive chimpanzees were both males, known to hunt frequently. We had previously demonstrated infection of these chimpanzees with another retrovirus, the simian T-cell leukemia virus type 1 (STLV-1), as a result of red colobus monkey consumption. However, in that study no preexisting infection with a chimpanzee-specific STLV was found (13). Noninvasive methods, such as those described by others (15a), will allow specific and more-extensive molecular epidemiological screenings of entire chimpanzee populations for SFV_cpz and for strains specific to other primate species. Others have, for example, shown the presence of one Cercopithecus SFV among 177 SFV-positive chimpanzee fecal samples (15a). However, generic integrase primers were used for this study. The use of species-specific foamy virus primers would most likely reveal a higher prevalence of SFV from other monkey species in the predator chimpanzee. Such screenings will provide further insight into interspecies SFV transmission and will help to identify risk factors associated with SFV transmission, such as hunting frequency and feeding strategies documented in the behavior studies. Our results demonstrate that, in addition to the presence of a species-specific SFV in a given host, transmission of other SFV from other species can occur in a natural primate predator-prey system, resulting in infections with divergent SFV isolates.

Moreover, prior infection with SFV_cpz does not seem to exclude infection with other SFV strains, a finding that may have important implications for foamy viruses as vaccine vectors (2). Coinfection has the potential to generate recombinants if the coinfecting viruses replicate in the same cell, possibly resulting in new pathological properties of viruses, as has been shown for simian immunodeficiency virus (1). Further studies are needed to specifically test for strain recombination and the existence of recombinant SFV lineages in wild chimpanzees. At this point, the phylogeny of the chimpanzee SFV_cpz strains described here clearly supports the cospeciation hypothesis suggested by others (20).

The high prevalence of SFV_cpz may be explained by intense social interactions, such as biting, whereas the low prevalence of SFV_wrc in the chimpanzees suggests that SFV_wrc is not or is rarely transmitted between the chimpanzees. This points to a dead-end infection of the superinfecting strain, as observed (albeit with a limited number of cases) in humans infected with SFV strains from nonhuman primates (5, 17, 21). Again, noninvasive methods will help address these issues, using wild chimpanzees as a model to investigate the fate of species-specific and new SFV in a host.

Nucleotide sequence accession numbers. New sequences of integrase-encoding regions of SFV strains were deposited in GenBank under accession numbers EU545383 to EU545395.

 
We thank the Ivorian authorities for their long-term support, in particular the Ministry of the Environment and Forests, as well as the Ministry of Research, the directorship of the Taï National Park, and the Swiss Research Centre in Abidjan.

We thank Steven Norley and Beatrice Hahn for helpful discussions and copy editing and Julia Tesch and Angelina Kus for technical support with sequencing.

 
* Corresponding author. Mailing address: NG2, Emerging Zoonoses, Robert Koch Institute, Nordufer 20, 13353 Berlin, Germany. Phone: 493045472592. Fax: 493045472181. E-mail: LeendertzF{at}rki.de

Published ahead of print on 28 May 2008.

Top ABSTRACT TEXT REFERENCES

 

1
1. Bailes, E., F. Gao, F. Bibollet-Ruche, V. Courgnaud, M. Peeters, P. A. Marx, B. H. Hahn, and P. M. Sharp. 2003. Hybrid origin of SIV in chimpanzees. Science 300:1713.[Free Full Text]
2
2. Bastone, P., F. Romen, W. Liu, R. Wirtz, U. Koch, N. Josephson, S. Langbein, and M. Lochelt. 2007. Construction and characterization of efficient, stable and safe replication-deficient foamy virus vectors. Gene Ther. 14:613-620.[CrossRef][Medline]
3
3. Blewett, E. L., D. H. Black, N. W. Lerche, G. White, and R. Eberle. 2000. Simian foamy virus infections in a baboon breeding colony. Virology 278:183-193.[CrossRef][Medline]
4
4. Boesch, C., and H. Boesch-Achermann. 2000. The chimpanzees of the Taï forest: behavioural ecology and evolution. Oxford University Press, Oxford, United Kingdom.
5
5. Boneva, R. S., W. M. Switzer, T. J. Spira, V. B. Bhullar, V. Shanmugam, M. E. Cong, L. Lam, W. Heneine, T. M. Folks, and L. E. Chapman. 2007. Clinical and virological characterization of persistent human infection with simian foamy viruses. AIDS Res. Hum. Retrovir. 23:1330-1337.[CrossRef][Medline]
6
6. Brooks, J. I., E. W. Rud, R. G. Pilon, J. M. Smith, W. M. Switzer, and P. A. Sandstrom. 2002. Cross-species retroviral transmission from macaques to human beings. Lancet 360:387-388.[CrossRef][Medline]
7
7. Calattini, S., F. Wanert, B. Thierry, C. Schmitt, S. Bassot, A. Saib, N. Herrenschmidt, and A. Gessain. 2006. Modes of transmission and genetic diversity of foamy viruses in a Macaca tonkeana colony. Retrovirology 3:23.[CrossRef][Medline]
8
8. Calattini, S., E. B. Betsem, A. Froment, P. Mauclere, P. Tortevoye, C. Schmitt, R. Njouom, A. Saib, and A. Gessain. 2007. Simian foamy virus transmission from apes to humans, rural Cameroon. Emerg. Infect. Dis. 13:1314-1320.[Medline]
9
9. Heneine, W., W. M. Switzer, P. Sandstrom, J. Brown, S. Vedapuri, C. A. Schable, A. S. Khan, N. W. Lerche, M. Schweizer, D. Neumann-Haefelin, L. E. Chapman, and T. M. Folks. 1998. Identification of a human population infected with simian foamy viruses. Nat. Med. 4:403-407.[CrossRef][Medline]
10
10. Jones-Engel, L., G. A. Engel, M. A. Schillaci, A. Rompis, A. Putra, K. G. Suaryana, A. Fuentes, B. Beer, S. Hicks, R. White, B. Wilson, and J. S. Allan. 2005. Primate-to-human retroviral transmission in Asia. Emerg. Infect. Dis. 11:1028-1035.[Medline]
11
11. Jones-Engel, L., K. A. Steinkraus, S. M. Murray, G. A. Engel, R. Grant, N. Aggimarangsee, B. P. Y.-H. Lee, C. May, M. A. Schillaci, C. Somgrid, T. Sutthipat, L. Vojtech, J. Y. Zhao, and M. L. Linial. 2007. Sensitive assays for simian foamy viruses reveal a high prevalence of infection in commensal, free-ranging Asian monkeys. J. Virol. 81:7330-7337.[Abstract/Free Full Text]
12
12. Köndgen, S., H. Kühl, P. K. N'goran, P. D. Walsh, S. Schenk, N. Ernst, R. Biek, P. Formenty, K. Mätz-Rensing, B. Schweiger, S. Junglen, H. Ellerbrok, A. Nitsche, T. Briese, W. I. Lipkin, G. Pauli, C. Boesch, and F. H. Leendertz. 2008. Pandemic human viruses cause decline of endangered great apes. Curr. Biol. 18:260-264.[CrossRef][Medline]
13
13. Leendertz, F. H., S. Junglen, C. Boesch, P. Formenty, E. Couacy-Hymann, V. Courgnaud, G. Pauli, and H. Ellerbrok. 2004. High variety of different simian T-cell leukemia virus type 1 strains in chimpanzees (Pan troglodytes verus) of the Taï National Park, Côte d'Ivoire. J. Virol. 78:4352-4356.[Abstract/Free Full Text]
14
14. Leendertz, F. H., H. Ellerbrok, C. Boesch, E. Couacy-Hymann, K. Mätz-Rensing, R. Hakenbeck, C. Bergmann, P. Abaza, S. Junglen, Y. Moebius, L. Vigilant, P. Formenty, and G. Pauli. 2004. Anthrax kills wild chimpanzees in a tropical rainforest. Nature 430:451-452.[CrossRef][Medline]
15
15. Leendertz, F. H., G. Pauli, K. Maetz-Rensing, W. Boardman, C. Nunn, H. Ellerbrok, S. A. Jensen, S. Junglen, and C. Boesch. 2006. Pathogens as drivers of population declines: the importance of systematic monitoring in great apes and other threatened mammals. Biol. Conserv. 131:325-337.[CrossRef]
15
16. Liu, W., M. Worobey, Y. Li, B. F. Keele, F. Bibollet-Ruche, P. Goepfert, M. L. Santiago, J.-B.L. Ndjango, C. Neel, S. L. Clifford, C. Sanz, S. Kamenya, M. L. Wilson, A. E. Pusey, N. Gross-Camp, C. Boesch, V. Smith, K. Zamma, M. A. Huffman, J. Mitani, D. P. Watts, M. Peeters, G. M. Shaw, W. M. Switzer, P. M. Sharp, B. H. Hahn. Molecular ecology and natural history of simian foamy virus infection in wild-living chimpanzees. PloS Pathog., in press.
16
17. Meiering, C. D., and M. L. Linial. 2001. Historical perspective of foamy virus epidemiology and infection. Clin. Microbiol. Rev. 14:165-176.[Abstract/Free Full Text]
17
18. Murray, S. M., and M. L. Linial. 2006. Foamy virus infection in primates. J. Med. Primatol. 35:225-235.[CrossRef][Medline]
18
19. Saitou, N., and M. Nei. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
19
20. Schweizer, M., and D. Neumann-Haefelin. 1995. Phylogenetic analysis of primate foamy viruses by comparison of pol sequences. Virology 207:577-582.[CrossRef][Medline]
20
21. Switzer, W. M., M. Salemi, V. Shanmugam, F. Gao, M. E. Cong, C. Kuiken, V. Bhullar, B. E. Beer, D. Vallet, A. Gautier-Hion, Z. Tooze, F. Villinger, E. C. Holmes, and W. Heneine. 2005. Ancient co-speciation of simian foamy viruses and primates. Nature 434:376-380.[CrossRef][Medline]
21
22. Switzer, W. M., V. Bhullar, V. Shanmugam, M. E. Cong, B. Parekh, N. W. Lerche, J. L. Yee, J. J. Ely, R. Boneva, L. E. Chapman, T. M. Folks, and W. Heneine. 2004. Frequent simian foamy virus infection in persons occupationally exposed to nonhuman primates. J. Virol. 78:2780-2789.[Abstract/Free Full Text]
22
23. Wolfe, N. D., W. M. Switzer, J. K. Carr, V. B. Bhullar, V. Shanmugam, U. Tamoufe, A. T. Prosser, J. N. Torimiro, A. Wright, E. Mpoudi-Ngole, F. E. McCutchan, D. L. Birx, T. M. Folks, D. S. Burke, and W. Heneine. 2004. Naturally acquired simian retrovirus infections in central African hunters. Lancet 363:932-937.[CrossRef][Medline]

---

Journal of Virology, August 2008, p. 7741-7744, Vol. 82, No. 15
0022-538X/08/$08.00+0     doi:10.1128/JVI.00549-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Goldberg, T. L., Sintasath, D. M., Chapman, C. A., Cameron, K. M., Karesh, W. B., Tang, S., Wolfe, N. D., Rwego, I. B., Ting, N., Switzer, W. M. (2009). Coinfection of Ugandan Red Colobus (Procolobus [Piliocolobus] rufomitratus tephrosceles) with Novel, Divergent Delta-, Lenti-, and Spumaretroviruses. J. Virol. 83: 11318-11329 [Abstract] [Full Text]  
• Moesta, A. K., Abi-Rached, L., Norman, P. J., Parham, P. (2009). Chimpanzees Use More Varied Receptors and Ligands Than Humans for Inhibitory Killer Cell Ig-Like Receptor Recognition of the MHC-C1 and MHC-C2 Epitopes. J. Immunol. 182: 3628-3637 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leendertz, F. H. Articles by Junglen, S. Search for Related Content PubMed PubMed Citation Articles by Leendertz, F. H. Articles by Junglen, S.