This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lucchesi, W.
Right arrow Articles by Farrell, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucchesi, W.
Right arrow Articles by Farrell, P. J.

 Previous Article  |  Next Article 

Journal of Virology, August 2008, p. 7456-7466, Vol. 82, No. 15
0022-538X/08/$08.00+0     doi:10.1128/JVI.00223-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Differential Gene Regulation by Epstein-Barr Virus Type 1 and Type 2 EBNA2{triangledown}

Walter Lucchesi,1 Gareth Brady,1 Oliver Dittrich-Breiholz,2 Michael Kracht,3 Rainer Russ,4 and Paul J. Farrell1*

Department of Virology, Faculty of Medicine, Imperial College London, Norfolk Place, London W2 1PG, United Kingdom,1 Institute of Biochemistry, Medical School Hannover, Carl-Neuberg Strasse 1, D-30625 Hannover, Germany,2 Rudolf-Buchheim-Institut für Pharmakologie, Frankfurter Strasse 107, D-35392 Giessen, Germany,3 Genedata AG, Maulbeerstrasse 46, CH-4058 Basel, Switzerland4

Received 1 February 2008/ Accepted 7 May 2008


arrow
ABSTRACT
 
A transfection assay with a lymphoblastoid cell line infected with Epstein-Barr virus was used to compare the abilities of type 1 and type 2 EBNA2 to sustain cell proliferation. The reduced proliferation in cells expressing type 2 EBNA2 correlated with loss of expression of some cell genes that are known to be targets of type 1 EBNA2. Microarray analysis of EBNA2 target genes identified a small number of genes that are more strongly induced by type 1 than by type 2 EBNA2, and one of these genes (CXCR7) was shown to be required for proliferation of lymphoblastoid cell lines. The Epstein-Barr virus LMP1 gene was also more strongly induced by type 1 EBNA2 than by type 2, but this effect was transient. Type 1 and type 2 EBNA2 were equally effective at arresting cell proliferation of Burkitt's lymphoma cell lines lacking Epstein-Barr virus and were also shown to cause apoptosis in these cells. The results indicate that differential gene regulation by Epstein-Barr virus type 1 and type 2 EBNA2 may be the basis for the much weaker B-cell transformation activity of type 2 Epstein-Barr virus strains compared to type 1 strains.


arrow
INTRODUCTION
 
Epstein-Barr virus (EBV) infects human B cells, giving rise in cell culture to lymphoblastoid cell lines (LCLs) in which the latent viral genome is maintained. In this infection, known as latency III (33), all the EBNA and LMP viral proteins are expressed together with various noncoding small RNAs (EBER and miRNAs). The EBV genes expressed in latency III cause the proliferation and survival of the LCL cells (49). In latency III, EBNA2 acts as a transcription factor to induce expression of the viral LMP genes and many cell genes (25). EBNA2 is known to be required for the continued proliferation of LCLs, because an LCL (EREB2.5) engineered to express an estrogen receptor EBNA2 fusion protein in the absence of wild-type EBNA2 was dependent on estrogen for EBNA2 function and cell proliferation (24). In the tumor cells of the EBV-associated cancer Burkitt's lymphoma (BL), where EBV infection is described as latency I (33), EBNA2 is not expressed, with proliferation being caused primarily by the deregulation of c-MYC caused by a chromosome translocation characteristic of BL (7). Some BL cells in culture adapt to acquire a latency III pattern similar to that found in LCLs, but the Akata BL cell line retains latency I EBV gene expression in culture.

Natural sequence variation of EBV isolates has been described at many locations in the genome (3, 11, 12, 50), but the most prominent and biologically significant of these identified so far is the variation in EBNA2. EBV strains are classified as type 1 or 2 (also known as type A and B) according to the sequence of their EBNA2 gene (25). The protein sequences of type 1 and type 2 EBNA2 are only 55% identical, a remarkable difference in view of the very low degree of variation in most other genes in the EBV genome. Type 1 strains are found worldwide and efficiently immortalize human B cells to give LCLs, but type 2 strains are much less effective at producing LCLs (32). Type 2 EBV strains are almost equally abundant as type 1 strains in Africa and some other regions of the world but are much less frequent than type 1 in Europe and the United States. A recombinant EBV type 2 strain in which the EBNA2 coding sequences were replaced with type 1 EBNA2 acquired the efficient immortalization of B cells characteristic of type 1 EBV (9), showing that EBNA2 variation is the key difference, although additional variation in EBNA3 family genes and EBNA-LP linked to type 1 and type 2 has been described (29, 34).

The mechanism by which type 1 EBNA2 acts as a transcription factor has been studied in detail. EBNA2 contains a transcription activation domain but does not bind directly to DNA, instead binding to certain cell proteins that mediate the DNA binding in promoter regions (25). The most studied of these proteins is RBP-Jk (CBF1), but the cell transcription factors PU.1 and AP2 can also mediate its effects on some promoters. The LMP2A gene is a clear example of a promoter that is regulated by EBNA2 via RBP-Jk (52). In contrast, PU.1 and AP2 are also important for regulation of the promoter for LMP1 by EBNA2 (18, 19, 22, 27, 35, 36). In addition, EBNA2 can modify chromatin structure through recruitment of SWI/SNF (46-48). Although there has been extensive investigation of the mechanism of EBNA2 induction on transfected model promoters and reporter plasmids, the relative significance of the SWI/SNF complex activity and transcription activator/repressor recruitment on promoters at their natural locations in human chromosomes remains to be determined.

The sequences of type 1 and type 2 EBNA2 are quite similar in the parts of the proteins known to mediate binding to RBP-Jk and in the activation domain; the main sequence variation occurs elsewhere in the protein. Almost all published studies of EBNA2 mechanism have used type 1 EBNA2, but the abilities of type1 and type 2 EBNA2 to induce gene expression has been compared on the promoters for LMP1 (43, 44) and CD23 (43).

In addition to the EBV LMP promoters and the Cp EBNA promoter, EBNA2 regulates many genes in the human genome. These EBNA2 target genes were initially studied individually, but several recent microarray studies have identified large numbers of genes regulated by EBNA2 type 1. Various approaches to identification of EBNA2 target genes have been described, using either LCLs with conditionally active EBNA2 (37, 51) or the effect of conditionally active EBNA2 in EBV-negative BL cell lines (28). In a previous study (37) we sought to identify direct targets of EBNA2 regulation in the EREB2.5 LCL by inducing EBNA2 function in the presence of protein synthesis inhibitors. RNAs that were induced were considered to be directly regulated by EBNA2 in the sense that their induction did not depend on protein synthesis of intermediate genes. We have investigated the roles of some of these EBNA2 targets in detail, for example, RUNX3 and phosphatidylinositol 3-kinase p55{alpha} (37, 38).

In contrast to LCLs where EBNA2 induces c-MYC, in latency I or EBV-negative BL cells EBNA2 downregulates expression of the translocated c-MYC allele and causes cell cycle arrest (21). Although type 2 EBNA2 is relatively frequent in Africa and many BL cell lines contain type 2 EBV, only type 1 EBNA2 has so far been analyzed in the context of c-MYC regulation in BL cells. In this study we investigated functional differences between type 1 and type 2 EBNA2, studying the effects of physiologically normal levels of EBNA2 or ER-EBNA2 protein on regulation of cell genes and the EBV LMP1 gene. A previous report (9) showed approximately equal expression of LMP1 in comparable LCL cells expressing type 1 or type 2 EBNA2. We confirm this but reveal a different time response of LMP1 expression and identify several cell genes that are differentially regulated by type 1 and type 2 EBNA2, including a gene required for LCL proliferation. The results suggest mechanisms that might explain the different abilities of type 1 and type 2 EBV to convert B cells into LCLs.


arrow
MATERIALS AND METHODS
 
EBNA2 plasmids. For clarity in this paper, the name pER-EBNA2 T1 will be used for p554-4 (24), and pEBNA2 T1 will be used for p554 (24); both plasmids were kindly provided by B. Kempkes. Analogous plasmids containing type 2 EBNA2 were constructed. For construction of pER-EBNA2 T2 (also known as pERT2), EBNA2 type 2 was amplified by Pfu PCR from genomic DNA extracted from AG876 cells. The amplified product was cloned and sequenced to verify its identity to the published AG876 EBNA2 sequence (10, 12). Adaptors included in the PCR primers allowed replacement of the ER-EBNA2 sequence in pER-EBNA2 T1 with ER-EBNA2 T2. A similar strategy was used to clone pEBNA2 T2 (also known as pAG1) using the same AG876 EBNA2 DNA to replace the EBNA2 sequence of pEBNA2 T1.

To make plasmids for in vitro translation of type 1 or type 2 EBNA2, EBNA2 sequences were Pfu PCR amplified from pER-EBNA2 T1 or T2 using primers with overhanging sequences carrying XbaI (5') and EcoRI (3') restriction sites. The amplified products were cloned into pSP64 (Promega). In vitro transcription and translation were performed using the TnT reticulocyte lysate system (Promega) with SP6 polymerase, using 1 µg of template vector and 2 µl of 10-mCi/ml [35S]methionine, in a 50-µl final reaction mixture. Dilutions of the type 1 and type 2 in vitro translations were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted, and the filter was exposed on a phosphorimager. The same filter was then used for immunoblotting with PE2 antibody, and the EBNA2 was detected by enhanced chemiluminescence. Type 1 EBNA2 contains 10 Met residues and type 2 has 9; the images were compared using ImageQuant 5.0 software.

Cell culture. BL cell lines and the LCL EREB2.5 (24) were grown at 37°C in RPMI 1640 with 10% fetal calf serum and 50 units/ml penicillin-streptomycin. For EREB2.5 cells, RPMI 1640 medium lacking phenol red but containing 1 µM β-estradiol was used. 293 cells were grown in Dulbecco modified Eagle medium with 10% fetal calf serum and penicillin-streptomycin.

For estrogen starvation and induction of EREB2.5 cells (see Fig. 4A), the cells were washed twice in unsupplemented RPMI and resuspended at 5 x 105 cells/ml in medium without estrogen. After 4 days, cells were counted again and reincubated in fresh medium without estrogen. On the fifth day, protein synthesis inhibitors (50 µg/ml cycloheximide and 25 µg/ml anisomycin) were added if required prior to addition of 1 µM estrogen or ethanol as a solvent control. The induction with estrogen was continued for 4 h in the 37°C incubator. Cells were harvested by washing twice in unsupplemented medium before protein extraction.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 4. (A) Left panels, estrogen-starved EREB2.5 cells (E2.5) were treated with estrogen for 4 h, and RNA was extracted and analyzed by RT-PCR for CXCR7 mRNA using the indicated primer combinations (right panels) to detect alternately spliced forms. Middle panels, estrogen-starved EREB2.5 cells (E2.5) or AK31:EBNA1/ER-EBNA2 type 1 or type 2 cells (AK31) were pretreated with protein synthesis inhibitors for 1 hour (AK31) or 2 h (E2.5), and the cells were then treated with or without estrogen for 4 h in the presence of protein synthesis inhibitors (as in the microarray experiment in Fig. 2). RNA was extracted and analyzed by RT-PCR for CXCR7 mRNA using the indicated primer combinations (right panels). Lanes M, size markers (100-bp ladder). (B) RT-PCR assay for CXCR7 or ADAMDEC1 mRNA in EREB2.5 cells at 7 or 10 days after transfection with EBNA2 T1 or T2 vector and withdrawal of estrogen as for Fig. 1. CXCR7 primers were those shown in the upper panels of panel A. GAPDH mRNA was also assayed to ensure equal input RNA in the samples. (C) RT-PCR assay for CXCR7 mRNA in a panel of LCLs with the primers used in upper panels of panel A. GAPDH mRNA was also assayed as a control.

Transfection, [3H]thymidine labeling, and RNA interference (RNAi). For Amaxa transfection of EREB2.5 cells, 5 x 106 cells growing in medium with estrogen were collected by centrifugation and resuspended in 100 µl of supplemented solution T (Amaxa Biosystems) at room temperature. Five micrograms of plasmid DNA was added, and the mixture was transferred to an Amaxa cuvette and subjected to nucleofection using Amaxa program A-23. A 500-µl volume of warmed medium was then added to the cuvette, and cells were transferred to 6 ml of warmed medium. Estrogen was omitted from the culture medium after transfection for the experiments shown in Fig. 1 and 4C.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

  		FIG. 1. (A) EREB2.5 cells which had been growing normally in estrogen were washed to remove estrogen and transfected with EBNA2 T1 or T2 vector expressing EBNA2 type 1 or type 2 protein. Cells were cultured in the absence of estrogen and pulse-labeled at the times indicated with [3H]thymidine. (B) Phase-contrast images of cells from panel A at 7 days after transfection of EBNA2 plasmid, showing proliferating cells only with type 1 EBNA2. The lower panel shows a Western blot for EBNA2 in three LCLs after 3 months of outgrowth. (C) Western blots of extracts from the same transfections assayed in panel A at 3 or 4 days after transfection as indicated for EBNA2, LMP1, IRF4, RUNX3, and actin as a loading control. (D) Comparison of detection of in vitro-translated type 1 and type 2 EBNA2 by Western blotting with PE2 antibody. Relative detection by Western blotting (WB) is similar to that by [35S]Met labeling during the in vitro translation.

For [3H]thymidine labeling, cells suspended in 200 µl medium were aliquoted into wells of 96-well plates and incubated for 2 h at 37°C in the presence of 1µCi of [3H]thymidine. Cells were harvested onto filters using a cell harvester (Skatron), and radioactivity was measured in a scintillation counter.

EBV-negative Akata 31 BL (AK31) cells (20) expressing a conditional EBNA2 type 1 or type 2 were obtained by first electroporating 5 x 106 cells with 5 µg of puro-oriP-EBNA1 vector (2) using a Bio-Rad electroporator set at 960 µF and 250 V. A 1-µg/ml concentration of puromycin was added 24 h after transfection. The selected AK31 cell line expressing EBNA1 was grown out, characterized, and then transfected with pER-EBNA2 T1 or pER-EBNA2 T2 vector using the same electroporation conditions. A 1-mg/ml concentration of G418 was added at 24 h posttransfection, and selection was carried on in G418 and puromycin for about 4 weeks, by which time cells expressing EBNA1 and ER-EBNA2 had grown out. Daudi BL cells were transfected with pER-EBNA2 T1 or pER-EBNA2 T2 under the same electroporation conditions and selected with 400 µg/ml G418.

293 cells were transfected using Lipofectamine complexes formed by mixing 50 µl of serum-free medium containing 8 µg of plasmid DNA with 50 µl of serum-free medium containing 10 µl of Lipofectamine and incubating for 20 min at room temperature. The complexes were added to 6 x 106 cells at 90% confluence and incubated for 24 h at 37°C before replacing the medium and adding 1 µg/ml puromycin. Cells were passaged as required to avoid confluence and counted after 8 days.

For short hairpin RNA (shRNA) RNAi of CXCR7, oligonucleotides GATCCCCAGCAAAGTAGCTTCGGGTCTTCAAGAGAGACCCGAAGCTACTTTGCTTTTTTGGAAA and AGCTTTTCCAAAAAAGCAAAGTAGCTTCGGGTCTCTCTTGAAGACCCGAAGCTACTTTGCTGGG were cloned into puro-oriP-SUPER, a puromycin-resistant version of the pHEBo-SUPER plasmid described previously (38), and plasmid DNA was Amaxa electroporated into EREB2.5 cells. Transfected cells were grown in 1 µg/ml puromycin, and viable cell numbers were determined at the indicated time points. Samples were taken on day 7 for reverse transcription-PCR (RT-PCR) analysis.

RNA extraction and RT-PCR. Total cell RNA was extracted using Trizol, and cDNA was prepared using the Protoscript first-strand cDNA synthesis kit (New England Biolabs). Before reverse transcription, RNA samples were treated with RQ1 RNase-free DNase (Promega). CXCR7 PCR used the following primers: Splice 1 Fw, CAGCTTCAGATCTGGGTATTTATCC; Splice 2 Fw, GCAGCCAGCAGAGCTCACAGTTG; and Splice 1/2 rev, TGGGCATGTTGGGACACATCACC. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was amplified with primers TGCCTCCTGCACCACCAACT and CGCCTGCTTCACCACCTTC. ADAMDEC1 was amplified with primers CTCTCCCTACAAAAAACCAAGCAC and TGTGTGAAGTATCCTCTCAACCCG.

Microarray analysis. Microarray analysis was performed on Agilent G4112F 44K HD arrays (design ID 014850) exactly as recommended by the manufacturer (Two-Color Microarray-Based Gene Expression Analysis V5.0.1; Agilent Technologies). Data extraction was performed with feature extraction software V9.1.3.1 by using the protocol file GE2-v5_91_0806.xml. AK31:EBNA1/ER-EBNA2 type 1 or type 2 cells were pretreated for 1 h with protein synthesis inhibitors and then with or without estrogen for 4 h in the presence of protein synthesis inhibitors. Total cell RNA was extracted and used for expression profiling. The experiment was performed in duplicate, and the resulting RNAs were hybridized pairwise (estrogen treated versus control) on four individual microarrays. The geometric mean of the four ratios/probe across all arrays was calculated. The output files from the Agilent feature extraction software for each microarray include the signal (MedianSignal), standard deviation of the signal (PixSDev), background (BGMedianSignal), and corrected signal (ProcessedSignal [dye-normalized signal after surrogate algorithm, used for computation of log ratio]) for each channel (Cy3 and Cy5). From these, a signal-to-noise ratio for each channel signal/background) and relative error (standard deviation, signal/signal) were calculated. Analyses were done with the log ratio calculated from the corrected signals (Cy3 and Cy5). To describe the quality of the ratio value, the smaller of the two signal-to-noise ratio values was used, while for the relative error the higher one was selected. The microarray data analysis was performed using the software Genedata Expressionist Pro (Genedata AG, Basel, Switzerland).

Immunoblotting and enzyme-linked immunosorbent assay (ELISA). Sodium dodecyl sulfate gel electrophoresis and Western immunoblotting were performed as described previously (38). Antibodies and dilutions used were as follows: EBNA2, DAKO PE2 mouse monoclonal (1/500); LMP1, DAKO CS1-4 mouse monoclonal (1/500); IRF4, AB-cam ab27508 rabbit polyclonal (1/1,000); interleukin-1β (IL-1β), ABcam ab10749 mouse monoclonal (1/200); actin, Abcam AC-15 (1/20,000); Cell Signaling Technologies anti-cleaved human PARP Asp214 (1/1,000); and c-MYC, Abcam 9E-10 mouse monoclonal (1/500). Secondary antibodies were horseradish peroxidase-conjugated anti-mouse or anti-rabbit at 1/2,000, and detection was by enhanced chemiluminescence (GE Healthcare).

ELISA for IL-1β used the Quantikine DLB50 kit (R&D Systems). AK31:EBNA1/ER-EBNA2 T1 or T2 cells were treated with estrogen for 24 h or kept untreated as controls, and then protein was extracted in 200 µl chloramphenicol acetyltransferase (CAT)-ELISA buffer. The extract was added to the ELISA plate provided in the kit and incubated for 2 h. The plate was washed three times and then incubated for 1 h with secondary antibody, washed three times, and developed, following the instructions with the kit.

Analysis of DNA content by PI staining. Cells were harvested and fixed in 70% ethanol in phosphate-buffered saline (PBS) overnight at 4°C. Fixed cells were washed three times in 1 ml cold PBS, resuspended in 500 µl 50-µg/ml propidium iodide (PI) in PBS containing RNase A (0.5 mg/ml), and incubated for 30 min at 37°C prior to analysis. PI-stained cells were then analyzed for DNA content by flow cytometry.

Apoptosis assays. For the JC-1 assay, cells were cultured at a density of 1 x 106 cells/ml in medium containing 2 µM JC-1 (Molecular Probes, Invitrogen) for 30 min at 37°C with 5% CO2. Positive control samples were also incubated with 50 µM membrane potential disrupter carbonyl cyanide m-chlorophenylhydrazone (Molecular Probes, Invitrogen) to uncouple mitochondria. After the incubation period, cells were washed in 2 ml warm PBS and resuspended in 500 µl PBS for analysis by flow cytometry.

To measure DNA laddering, cells were harvested after treatment and DNA was extracted as described previously (15). The extent of DNA fragmentation was visualized on a 1% agarose gel containing ethidium bromide.


arrow
RESULTS
 
Assay for EBNA2 function distinguishes type 1 from type 2. Transfection of an oriP plasmid expressing wild-type type 1 EBNA2 into EREB2.5 cells was previously demonstrated to allow continued growth of the cells in the absence of estrogen. EBNA2 is known to be essential for the growth of LCLs, and the wild-type EBNA2 takes over from the ER-EBNA2, with the episomal ER-EBNA2 plasmid eventually being lost from the cells (16, 24, 37). This procedure was adapted into an assay that functionally distinguishes type 1 from type 2 EBNA2. The type 1 EBNA2 sequences in the EBNA2 T1 expression plasmid (24) were replaced with type 2 EBNA2 coding sequence. The type 1 or type 2 EBNA2 plasmid was then transfected into EREB2.5 cells that had been growing normally with estrogen, and estrogen was removed from the culture. Monitoring DNA synthesis by [3H]thymidine incorporation gave the expected continued DNA synthesis with type 1 EBNA2, but with type 2 EBNA2 there was only a brief period of DNA synthesis before incorporation of [3H]thymidine declined and cell proliferation ceased (Fig. 1A). A negative control transfection in which a plasmid expressing no EBNA2 was transfected gave no significant [3H]thymidine incorporation. Such transfections eventually resulted in outgrowth in the absence of estrogen of typical LCLs with type 1 EBNA2 (Fig. 1B). These cells expressed EBNA2 and after 3 months in culture had almost completely lost expression of the ER-EBNA2 fusion protein, as detected by Western blotting (Fig. 1B), presumably because of passive loss of the ER-EBNA2 plasmid from the cells. The plasmids encoding type 1 and type 2 differed only in the EBNA2 coding region and expressed similar levels of EBNA2 protein at early times after transfection (3 days), as detected by Western blotting with the PE2 monoclonal antibody (Fig. 1C). To check that the PE2 monoclonal antibody detects type 1 and type 2 EBNA2 with equal efficiency on a Western blot, EBNA2 was prepared by in vitro translation incorporating [35S]methionine. Dilutions of the samples were analyzed by Western blotting with PE2, and a phosphorimager was used to measure [35S]Met incorporation on the same gel. The results (Fig. 1D) showed that PE2 detected type 1 and type 2 EBNA2 with approximately equal efficiency in the Western blotting assay.

In Fig. 1A, the key point of difference in the time course of [3H]thymidine incorporation was about 3 to 4 days after transfection, when incorporation in the type 1 transfection was still increasing strongly as the cells proliferated but the culture with type 2 EBNA2 was stopping DNA synthesis. EBNA2 regulates expression of the viral LMP1 protein, and LMP1 signal transduction is an important factor in proliferation and survival of EBV LCLs, but it was noticeable that the levels of LMP1 at 3 or 4 days after transfection and estrogen withdrawal were similar in the Western blotting samples from the type 1 and type 2 transfections. In contrast, there were major differences in the expression levels of some cell genes identified previously as EBNA2 targets, for example, RUNX3 and IRF4 (Fig. 1C). We showed previously that RUNX3 is required for proliferation of EREB2.5 LCLs (38), so this experiment indicates that differential expression of a cell gene that is directly controlled by EBNA2 correlates with the different proliferative capacities of type 1 and type 2 EBNA2.

Identification of cell genes differentially regulated by type 1 and type 2 EBNA2. Our previous strategy for identification of direct target genes of type 1 EBNA2 in the EREB2.5 LCL background (37) cannot be applied to type 2 EBNA2 because the ER-EBNA2 (type 2) does not sustain cell proliferation. There were many similarities in the lists of EBNA2 target genes identified by our approach and that of EBNA2 expression in an EBV-negative BL cell line (28), so we therefore created EBV-negative Akata (AK31) BL cell lines with constitutive expression of type 1 or type 2 ER-EBNA2. The ER-EBNA2 was expressed from episomal oriP vectors selected with G418, and the EBNA1 required for this plasmid maintenance was provided from another oriP plasmid in the cells under puromycin selection. There was characteristically some stabilization of the EBNA2 protein when the cells were treated with estrogen (Fig. 2), as is seen also in EREB2.5 cells. The AK31:EBNA1/ER-EBNA2 cell lines were treated with estrogen in the presence of protein synthesis inhibitors for 4 h, and total cell RNA was analyzed by microarray expression profiling. Levels of cell RNAs in response to type 1 or type 2 EBNA2 activation were compared. Most cell genes are not regulated by EBNA2 activation, but based on the filter criteria applied, approximately 150 genes were induced twofold or more, consistent with previous studies (28, 37, 51). Examples of these genes that were also classified as direct targets of EBNA2 regulation in EREB2.5 cells in our previous analysis (37) are shown in Fig. 2. For most of these, there was no detectable difference in regulation by type 1 or type 2 EBNA2, but for a few genes there was significantly more induction by type 1 EBNA2. The genes regulated differentially in Fig. 2 included those for myristoylated alanine-rich protein kinase C (PKC) substrate (MARCKS), IL-1β, ADAMDEC1, and CXCR7 (also known as RDC1 or CMKOR1). The induction of mRNA expression for these genes was about threefold higher with type 1 EBNA2.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 2. Bar chart summary of microarray expression profiling comparing genes regulated by ER-EBNA2 type 1 and type 2 stably transfected in AK31 BL cells. Cells were pretreated for 1 h with protein synthesis inhibitors and then with or without estrogen for 4 h in the presence of protein synthesis inhibitors. Total cell RNA was extracted and used for expression profiling on Agilent 44K microarrays (as described in Materials and Methods section). The experiment was performed in duplicate, and the resulting RNAs were hybridized pairwise (estrogen-treated versus control) on individual microarrays. For each condition the values were averaged and a standard error was calculated. Each bar represents the ratio of the mean of values with estrogen over the mean of the values without estrogen (fold induction). The inset shows Western blotting using PE2 antibody of ER-EBNA2 levels in the AK31:EBNA1/ER-EBNA2 cells with or without 4 h of treatment with estrogen.

Induction of IL-1β was confirmed at the protein level in AK31:EBNA1/ER-EBNA2 (type 1) cells in response to estrogen activation of the EBNA2, by both ELISA (Fig. 3A) and Western blotting (Fig. 3B), but this protein was intracellular and could not be detected in the culture medium. RT-PCR for ADAMDEC1 confirmed its induction (Fig. 3C), and MARCKS has been reported previously to be induced by EBV infection of BL cells (6). Interestingly, CXCR7 was the RNA most strongly induced by EBNA2 type 1 in our previous study on direct EBNA2 targets in EREB2.5 LCLs (37) and was also found to be strongly induced in the EBV-negative BL cell background in other studies (28).


Figure 3
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 3. (A) ELISA detection of IL-1β. AK31:EBNA1/ER-EBNA2 type 1 or type 2 cells were cultured with or without estrogen for 24 h. The medium and cell extracts (IC) were assayed for IL-1β by ELISA. (B) Cells were treated as for panel A and analyzed by Western blotting for IL-1β. (C) Cells were treated as for panel A and analyzed by RT-PCR for ADAMDEC1 and GAPDH as a positive control. Error bars indicate standard errors.

Induction of CXCR7 both in the AK31:EBNA1/ER-EBNA2 T1 cells and in EREB2.5 cells in response to estrogen activation of the EBNA2 was confirmed by RT-PCR (Fig. 4A). Two known splice variants in the leader exons of CXCR7 and a novel splice of exon 2 directly to the coding exon were observed in the RT-PCR assays (Fig. 4A). The differential regulation of CXCR7 and ADAMDEC1 by type 1 and type 2 EBNA2 observed in the BL cell lines (Fig. 2) was also seen in EREB2.5 cells transfected with EBNA2 expression vectors followed by withdrawal of estrogen (Fig. 4B), similar to the experiment shown in Fig. 1. The time course of the experiment in Fig. 4B was slightly slower than that shown in Fig. 1, and the differential regulation of CXCR7 and ADAMDEC1 by type 1 and type 2 EBNA2 was most clearly seen at 7 and 10 days after transfection, relative to a GAPDH control (Fig. 4B). EREB2.5 cells were not unusual in expressing CXCR7; a similar pattern of expression was observed in a panel of LCLs (Fig. 4C). These LCLs were derived from cord blood (C2-BL16, C2-Akata, IB4, and EREB2.5) or peripheral blood (LCL3 and Obaji LCL) B cells and contained several different EBV strains (LCL3 contains B95-8 EBV). C2-BL16 contains a type 2 EBV but has a level of CXCR7 RNA similar to that in the other lines, suggesting that once an LCL has been established, cells with this level of CXCR7 may be selected, if CXCR7 is required for LCL proliferation or survival.

Using a similar shRNA plasmid transfection approach to that we applied previously to test the contribution of RUNX3 and p55{alpha} phosphatidylinositol 3-kinase to LCLs (37, 38), we investigated the effect of depleting CXCR7. Knockdown of CXCR7, detected at the RNA level (Fig. 5A and B), resulted in a severe impairment of accumulation of transfected EREB2.5 cells (Fig. 5A) or LCL3 cells (Fig. 5B) and cell death. In those experiments p53 RNAi and the empty vector were used as negative controls (37, 38) and affected neither the levels of CXCR7 RNA nor accumulation of the cells in culture. The shRNA plasmids were also transfected into 293 cells, and puromycin selection was applied (Fig. 5C). There was no difference between the CXCR7 and empty vector shRNA plasmids in the production of puromycin-resistant 293 cells, indicating that the CXCR7 shRNA construct was not nonspecifically toxic and did not prevent function of the puromycin resistance gene used in Fig. 5A and B.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 5. (A) Plasmids expressing shRNA for CXCR7 or p53 as a negative control or the control empty vector (V) were transfected into EREB2.5 cells, and the transfected cells were selected with puromycin. Live cell counts (trypan blue exclusion) at the indicated times after transfection are shown. CXCR7 RNA was assayed by RT-PCR at 7 days after transfection using the exon 2 primer combination shown in the upper panels of panel A. (B) As for panel A but with LCL3 cells (an LCL infected with B95-8 EBV). Here the CXCR7 RNA was assayed by RT-PCR at 6 days after transfection. (C) To show that the CXCR7 shRNA plasmid was not nonspecifically toxic to cells and that it did not prevent function of the puromycin resistance gene, the shRNA plasmids used for panels A and B were transfected into 293 cells and selected with puromycin. The control (Ctrl) sample received a plasmid lacking the puromycin resistance gene. Live cell counts at 8 days after transfection are shown. Error bars indicate standard errors.

These results show that some cell genes (including CXCR7) can be differentially regulated by type 1 and type 2 EBNA2 and that a CXCR7 gene product is required for LCL proliferation or survival.

Type 1 and type 2 EBNA2 both cause cell cycle arrest and apoptosis in EBV-negative BL cell lines expressing EBNA1. In the experiment shown in Fig. 2, the effects of EBNA2 on cell gene expression were measured only 4 h after activation of the ER-EBNA2 by estrogen. Earlier work has shown that there appears to be an incompatibility between EBNA2 expression and latency I BL cells that results in selection of tumor cells lacking EBNA2 expression (23). One potential mechanism for this is the ability of type 1 EBNA2 to downregulate the expression of the translocated c-MYC allele in BL cells and consequently cause cell cycle arrest (21). Many African BL tumors contain type 2 EBV, so we therefore compared the effects of type 1 and type 2 ER-EBNA2 on AK31 BL cells over a longer time period. Both type 1 and type 2 ER-EBNA2 suppressed c-MYC protein levels (Fig. 6A) and caused the previously described (21) accumulation of cells in the G1 phase of the cell cycle after about 24 h (Fig. 6B). In addition to the previously reported cell cycle arrest (21), these BL cells subsequently died by apoptosis in response to EBNA2 expression. The accumulation of cleaved PARP (Fig. 6B), subdiploid DNA content on fluorescence-activated cell sorting (Fig. 6B), JC-1 assay (Fig. 6C), and DNA laddering (Fig. 6D) all confirmed the apoptotic mechanism of cell death. Similar effects of accumulation in G1 and subsequent apoptosis were also observed in DG75 EBV-negative BL cells containing the same ER-EBNA2 plasmids (data not shown). Both type 1 and type 2 EBNA2 caused all these effects, but in some experiments the PARP cleavage in response to type 2 EBNA2 was slightly slower (Fig. 6A).


Figure 6
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 6. (A) Type 1 and type 2 EBNA2 both repress MYC expression and drive apoptosis in AK31 BL cells. AK31:EBNA1/ER-EBNA2 T1 and T2 stable cells were induced with 5 µM β-estradiol for 0 to 72 h. Extracts from cells were probed with indicated antibodies. (B) Analysis of EBNA2 T1- and T2-driven apoptosis in AK31 cells. AK31:EBNA1/ER-EBNA2 T1 and T2 stable cells induced with 5 µM β-estradiol for 0 to 72 h were ethanol fixed and stained with propidium iodide prior to analysis of DNA content by flow cytometry. Upper panels, DNA content analysis of AK31:EBNA1/ER-EBNA2 cells following ER-EBNA2 T1 activation, demonstrating a transient increase in G0/G1 populations followed by apoptosis at later time points. Numbers inserted into the histogram profiles denote the percent subdiploid, G0/G1, S, and G2/M populations, respectively. Lower panels, bar chart comparing subdiploid and G0/G1 DNA contents for both T1 and T2 ER-EBNA2 stable populations. (C) Type 1 and type 2 EBNA2 drive mitochondrial/intrinsic apoptosis in AK31 cells. AK31:EBNA1/ER-EBNA2 T1 and T2 stable cells were induced with 5 µM β-estradiol for 0 to 72 h and analyzed for apoptosis. The JC-1 assay was performed at each time point. The upper panel shows example profiles of carbonyl cyanide m-chlorophenylhydrazone-treated positive control at 0 h and 72 h with or without activation of T1 ER-EBNA2 stable cells. The bar chart (lower panel) shows a comparison between EBNA2 T1/T2-driven intrinsic apoptosis or the percentage of normal (N) cells versus apoptotic (Ap) cells in both cell populations. (D) DNA laddering analysis was also performed on AK31:EBNA1/ER-EBNA2 T1 or T2 cells induced with 5 µM β-estradiol for 0 to 72 h.

Differential regulation of LMP1 by type 1 and type 2 EBNA2. A previous report compared the levels of LMP1 in LCLs stably expressing type 1 or type 2 EBNA2 and found them to be similar (9). We transfected the ER-EBNA2 (type 1 and type 2) plasmids into Daudi BL cells, which contain an endogenous EBV genome with a deletion of the EBNA2 gene, and selected transfected cell lines with G418. Because LMP1 is normally induced by EBNA2, LMP1 protein is not usually present in Daudi cells at a significant level. When EBNA2 function was induced by adding estrogen, type 1 EBNA2 induced LMP1 much more rapidly than type 2 EBNA2 (Fig. 7), even though the expression of type 2 EBNA2 was slightly stronger (Fig. 7). This difference in LMP1 induction was large but transient; after 48 h there was little difference in the levels of LMP1, consistent with the previously published results for cells stably expressing type 1 or type 2 EBNA2 (9). In contrast to the EREB2.5 cells (Fig. 1), where the continued expression of LMP1 was measured following transfection of EBNA2, this Daudi cell system measures the effect of EBNA2 activation in cells that start with no LMP1 expression, which is more like the induction of LMP1 during infection of primary B cells by EBV.


Figure 7
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 7. Daudi BL cells stably transfected with ER-EBNA2 type 1 or type 2 were cultured with or without estrogen for the indicated times, and protein extracts of the cells were analyzed by Western blotting for EBNA2 (PE2 antibody), LMP1 (CS1-4 antibody), or actin as a loading control.


arrow
DISCUSSION
 
The important biological difference between type 1 and type 2 EBV strains is the much greater ability of type 1 strains to convert primary human B cells into continuously proliferating LCLs (9, 32). The systems that we have devised allow study of gene regulation by EBNA2 at physiological levels on target genes in their normal regulatory context. The results suggest several possible reasons why type 1 EBV strains may produce LCLs more efficiently than type 2 strains. Timely induction of LMP1 is important to allow survival of B cells driven into the cell cycle by EBNA2 and EBNA-LP, and our results with Daudi cells suggest that type 1 EBNA2 induces LMP1 much more rapidly and efficiently than type 2 EBNA2.

Previous studies comparing the abilities of type1 and type 2 EBNA2 to induce gene expression focused on LMP1 (43, 44) and CD23 (43). Transient-transfection assays of EBNA2 expression vectors in BL30/P3HR1 or Daudi cells assayed by immunoprecipitation of LMP1 gave a higher induction by type 2 EBNA2 in some experiments but equal induction in others (44). In contrast, transient-transfection assays with BJAB cells gave about a 2.5-fold-higher induction of an LMP1 promoter CAT reporter with type 1 EBNA2 and about a 1.5-fold-higher induction of a CD23 promoter CAT construct (43). These results were interpreted to suggest that higher transactivation by type 1 EBNA2 might be the basis for the more efficient transforming properties of type 1 EBV. At that time the cooperation of EBNA2 with EBNA-LP was not taken into account.

All our experiments have been performed in the presence of the two-repeat type 1 EBNA-LP that is expressed from p554 series plasmids (24). There is some evidence that type 1 and type 2 EBNA-LP can differ in their ability to cooperate with EBNA2 (29) in induction of the LMP1 promoter and that EBV sequence variation in the LMP1 promoter (studied in P3HR1 EBV) can cause it to respond to type 1 EBNA2 slightly differently from the prototypic B95-8 LMP1 promoter (18). In some respects it is surprising that we observed no outgrowth with type 2 EBNA2 in the EREB2.5 complementation assay, since type 2 strains of EBV usually give rise to a low-efficiency transformation of primary B cells. It is possible that the two-repeat type 1 EBNA-LP expressed from both the type 1 and type 2 EBNA2 expression vectors used in this study cooperates more effectively with the type 1 EBNA2 than the type 2 EBNA2, but there is no specific evidence for this. The EBNA-LP activity in the EREB2.5 cells is further complicated by the presence of the P3HR1 truncated EBNA-LP, which has recently been reported to be a gain-of-function mutant, acquiring the ability to inactivate protein phosphatase 2A (13). These additional levels of complexity have not yet been explored in our study, but they do not affect our conclusion that there can be differential regulation of a relatively small number of cell genes by type 1 and type 2 EBNA2.

The Akata cell line used for the microarray analysis and apoptosis studies in this paper has an 8:14 translocation (41), similar to the BL cell lines studied previously (21), so the repression of c-MYC by EBNA2 shown in Fig. 6 presumably occurs by the same mechanism involving the immunoglobulin Mu enhancer. In the Akata cells, type 1 and type 2 EBNA2 appeared to be equally effective in repressing c-MYC, so there is no reason to think that the differential regulation of cell target genes that we observed is mediated by c-MYC. The protein synthesis inhibitors present in the microarray study would also most likely prevent indirect effects that could occur via c-MYC. The mechanism by which apoptosis occurs in the Akata BL cells after cell cycle arrest (Fig. 6) remains to be determined, but the similar effects of type 1 and type 2 EBNA2 in BL cells are consistent with both EBV types being found in African BL tumors.

The experiments illustrated in Fig. 1 with the EREB2.5 LCL involved Amaxa transient transfection and could be performed only on a small scale, so it was possible to test only a few EBNA2 target genes by Western blotting (Fig. 1C) or RT-PCR (Fig. 4B). It is noticeable that RUNX3, which is known to be required for LCL proliferation (38) and was differentially expressed in the LCL experiment (Fig. 1C), was not in the list of differentially regulated target genes in the Akata BL system (Fig. 2). Although RUNX3 was confirmed as an EBNA2 target gene in BL cells (28), it was only slightly induced in those experiments, and it seems likely that differences in the transcription factor content in the different cell backgrounds will affect which genes are detected as EBNA2 targets, as will the different experimental procedures used. However, the biochemical functions of the four genes identified in Fig. 2, namely, those for MARCKS, IL-1β, ADAMDEC1, and CXCR7, are likely to be relevant to B-cell proliferation and survival. ADAMDEC1 and CXCR7 were also shown to be differentially regulated by type 1 and type 2 EBNA2 in the LCL background (Fig. 4B).

MARCKS is a PKC substrate, and its phosphorylation has been used as a marker of PKC activation (1). It regulates membrane ruffling and cell spreading (30) and can reversibly inhibit phospholipase C (14) Targeted disruption of the gene encoding MARCKS in mice resulted in numerous developmental defects and perinatal death (40). MARCKS was previously shown to be induced by EBV infection (6), although in our experiments the induced level of MARCKS RNA was still very low, so it is probably also regulated by another EBV gene product apart from EBNA2. IL-1β is a cytokine involved in lymphocyte proliferation and has been reported previously to be expressed in EBV-infected LCLs (26). Its function normally requires that it is secreted so that it can activate via its specific receptor, but intracellular IL-1β protein similar to that seen in our BL studies has been studied previously as an inhibitor of caspase activation (42), and an intracellular IL-1{alpha} precursor form has been reported to function as a transcription regulator (8, 45), so this intracellular IL-1β might be functional. ADAMDEC1 is a metalloprotease that is expressed in lymphocytes, dendritic cells, and macrophages (5). Its precise function is not yet known, but its expression has been used as a marker to distinguish splenic from peritoneal B cells of the B-1a class (39).

CXCR7 (RDC1, CMKOR1) was recently found to be the receptor for chemokine SDF-1/CXCL12 in T lymphocytes (4) although there is doubt about this being the ligand for CXCR7 in B cells (17). The function of CXCR7 in normal B cells has not yet been determined, but we demonstrated (Fig. 5A and B) that it is required for LCL proliferation or survival, and a previous study identified CXCR7 as essential for transformation of endothelial cells by Kaposi's sarcoma-associated herpesvirus (31).

Further work will be required to characterize differential gene regulation by type 1 and type 2 EBNA2, but there does appear to be a small number of cell genes that are more differentially regulated than the great majority of EBNA2 target genes. We do not expect a single cell gene to complement the deficiency in type 2 EBV immortalization of B cells, but it may be a relatively small number of genes that are required. The mechanism of the differential effects of type 1 and type 2 EBNA2 on these few genes remains to be determined, but we conclude that differential induction of LMP1 and a relatively small number of cell genes correlates with the different transforming abilities of type 1 and type 2 EBV.


arrow
ACKNOWLEDGMENTS
 
We thank Bettina Kempkes for the EREB2.5 cell line and the p554 and p554-4 plasmids and Marcus Thelen for advice on CXCR7.

This work was partly supported by funding under the Sixth Research Framework Programme of the European Union, project INCA (LSHC-CT-2005-018704), and by the Leukemia Research Fund and the Ludwig Institute for Cancer Research.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Virology, Faculty of Medicine, Imperial College London, St. Mary's Campus, Norfolk Place, London W2 1PG, United Kingdom. Phone: 44 20 7594 2005. Fax: 44 20 7594 3973. E-mail: p.farrell{at}imperial.ac.uk Back

{triangledown} Published ahead of print on 14 May 2008. Back


arrow
REFERENCES
 
    1
  1. Aderem, A. 1992. The MARCKS brothers: a family of protein kinase C substrates. Cell 71:713-716.[CrossRef][Medline]
    2. 2
  2. Amon, W., U. K. Binne, H. Bryant, P. J. Jenkins, C. E. Karstegl, and P. J. Farrell. 2004. Lytic cycle gene regulation of Epstein-Barr virus. J. Virol. 78:13460-13469.[Abstract/Free Full Text]
    3. 3
  3. Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, P. Tuffnell, and B. Barrell. 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310:207-211.[CrossRef][Medline]
    4. 4
  4. Balabanian, K., B. Lagane, S. Infantino, K. Y. Chow, J. Harriague, B. Moepps, F. Arenzana-Seisdedos, M. Thelen, and F. Bachelerie. 2005. The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes. J. Biol. Chem. 280:35760-35766.[Abstract/Free Full Text]
    5. 5
  5. Bates, E. E., W. H. Fridman, and C. G. Mueller. 2002. The ADAMDEC1 (decysin) gene structure: evolution by duplication in a metalloprotease gene cluster on chromosome 8p12. Immunogenetics 54:96-105.[CrossRef][Medline]
    6. 6
  6. Birkenbach, M., K. Josefsen, R. Yalamanchili, G. Lenoir, and E. Kieff. 1993. Epstein-Barr virus-induced genes: first lymphocyte-specific G protein-coupled peptide receptors. J. Virol. 67:2209-2220.[Abstract/Free Full Text]
    7. 7
  7. Brady, G., G. J. MacArthur, and P. J. Farrell. 2007. Epstein-Barr virus and Burkitt lymphoma. J. Clin. Pathol. 60:1397-1402.[Abstract/Free Full Text]
    8. 8
  8. Buryskova, M., M. Pospisek, A. Grothey, T. Simmet, and L. Burysek. 2004. Intracellular interleukin-1alpha functionally interacts with histone acetyltransferase complexes. J. Biol. Chem. 279:4017-4026.[Abstract/Free Full Text]
    9. 9
  9. Cohen, J. I., F. Wang, J. Mannick, and E. Kieff. 1989. Epstein-Barr virus nuclear protein 2 is a key determinant of lymphocyte transformation. Proc. Natl. Acad. Sci. USA 86:9558-9562.[Abstract/Free Full Text]
    10. 10
  10. Dambaugh, T., K. Hennessy, L. Chamnankit, and E. Kieff. 1984. U2 region of Epstein-Barr virus DNA may encode Epstein-Barr nuclear antigen 2. Proc. Natl. Acad. Sci. USA 81:7632-7636.[Abstract/Free Full Text]
    11. 11
  11. de Jesus, O., P. R. Smith, L. Spender, C. Elgueta Karstegl, H. H. Niller, D. Huang, and P. J. Farrell. 2003. Updated Epstein-Barr virus (EBV) DNA sequence and analysis of a promoter for the BART (CST, BARF0) RNAs of EBV. J. Gen. Virol. 84:1443-1450.[Abstract/Free Full Text]
    12. 12
  12. Dolan, A., C. Addison, D. Gatherer, A. J. Davison, and D. J. McGeoch. 2006. The genome of Epstein-Barr virus type 2 strain AG876. Virology 350:164-170.[CrossRef][Medline]
    13. 13
  13. Garibal, J., E. Hollville, A. I. Bell, G. L. Kelly, B. Renouf, Y. Kawaguchi, A. B. Rickinson, and J. Wiels. 2007. Truncated form of the Epstein-Barr virus protein EBNA-LP protects against caspase-dependent apoptosis by inhibiting protein phosphatase 2A. J. Virol. 81:7598-7607.[Abstract/Free Full Text]
    14. 14
  14. Glaser, M., S. Wanaski, C. A. Buser, V. Boguslavsky, W. Rashidzada, A. Morris, M. Rebecchi, S. F. Scarlata, L. W. Runnels, G. D. Prestwich, J. Chen, A. Aderem, J. Ahn, and S. McLaughlin. 1996. Myristoylated alanine-rich C kinase substrate (MARCKS) produces reversible inhibition of phospholipase C by sequestering phosphatidylinositol 4,5-bisphosphate in lateral domains. J. Biol. Chem. 271:26187-26193.[Abstract/Free Full Text]
    15. 15
  15. Gong, J., F. Traganos, and Z. Darzynkiewicz. 1994. A selective procedure for DNA extraction from apoptotic cells applicable for gel electrophoresis and flow cytometry. Anal. Biochem. 218:314-319.[CrossRef][Medline]
    16. 16
  16. Gordadze, A. V., R. Peng, J. Tan, G. Liu, R. Sutton, B. Kempkes, G. W. Bornkamm, and P. D. Ling. 2001. Notch1IC partially replaces EBNA2 function in B cells immortalized by Epstein-Barr virus. J. Virol. 75:5899-5912.[Abstract/Free Full Text]
    17. 17
  17. Infantino, S., B. Moepps, and M. Thelen. 2006. Expression and regulation of the orphan receptor RDC1 and its putative ligand in human dendritic and B cells. J. Immunol. 176:2197-2207.[Abstract/Free Full Text]
    18. 18
  18. Jansson, A., P. Johansson, S. Li, and L. Rymo. 2007. Activity of the LMP1 gene promoter in Epstein-Barr virus-transformed cell lines is modulated by sequence variations in the promoter-proximal CRE site. J. Gen. Virol. 88:1887-1894.[Abstract/Free Full Text]
    19. 19
  19. Jansson, A., P. Johansson, W. Yang, L. Palmqvist, A. Sjoblom-Hallen, and L. Rymo. 2007. Role of a consensus AP-2 regulatory sequence within the Epstein-Barr virus LMP1 promoter in EBNA2 mediated transactivation. Virus Genes 35:203-214.[CrossRef][Medline]
    20. 20
  20. Jenkins, P., U. Binné, and P. Farrell. 2000. Histone acetylation and reactivation of Epstein-Barr virus from latency. J. Virol. 74:710-720.[Abstract/Free Full Text]
    21. 21
  21. Jochner, N., D. Eick, U. Zimber-Strobl, M. Pawlita, G. W. Bornkamm, and B. Kempkes. 1996. Epstein-Barr virus nuclear antigen 2 is a transcriptional suppressor of the immunoglobulin mu gene: implications for the expression of the translocated c-myc gene in Burkitt's lymphoma cells. EMBO J. 15:375-382.[Medline]
    22. 22
  22. Johannsen, E., E. Koh, G. Mosialos, X. Tong, E. Kieff, and S. R. Grossman. 1995. Epstein-Barr virus nuclear protein 2 transactivation of the latent membrane protein 1 promoter is mediated by J kappa and PU.1. J. Virol. 69:253-262.[Abstract]
    23. 23
  23. Kelly, G., A. Bell, and A. Rickinson. 2002. Epstein-Barr virus-associated Burkitt lymphomagenesis selects for downregulation of the nuclear antigen EBNA2. Nat. Med. 8:1098-1104.[CrossRef][Medline]
    24. 24
  24. Kempkes, B., D. Spitkovsky, P. Jansen-Durr, J. W. Ellwart, E. Kremmer, H. J. Delecluse, C. Rottenberger, G. W. Bornkamm, and W. Hammerschmidt. 1995. B-cell proliferation and induction of early G1-regulating proteins by Epstein-Barr virus mutants conditional for EBNA2. EMBO J. 14:88-96.[Medline]
    25. 25
  25. Kieff, E., and A. Rickinson. 2001. Epstein-Barr virus and its replication, p. 2511-2573. In D. Knipe and P. Howley (ed.), Fields virology, 4th ed. Lippincott, Philadelphia, PA.
    26. 26
  26. Krauer, K. G., D. K. Belzer, D. Liaskou, M. Buck, S. Cross, T. Honjo, and T. Sculley. 1998. Regulation of interleukin-1beta transcription by Epstein-Barr virus involves a number of latent proteins via their interaction with RBP. Virology 252:418-430.[CrossRef][Medline]
    27. 27
  27. Laux, G., F. Dugrillon, C. Eckert, B. Adam, U. Zimber-Strobl, and G. W. Bornkamm. 1994. Identification and characterization of an Epstein-Barr virus nuclear antigen 2-responsive cis element in the bidirectional promoter region of latent membrane protein and terminal protein 2 genes. J. Virol. 68:6947-6958.[Abstract/Free Full Text]
    28. 28
  28. Maier, S., G. Staffler, A. Hartmann, J. Hock, K. Henning, K. Grabusic, R. Mailhammer, R. Hoffmann, M. Wilmanns, R. Lang, J. Mages, and B. Kempkes. 2006. Cellular target genes of Epstein-Barr virus nuclear antigen 2. J. Virol. 80:9761-9771.[Abstract/Free Full Text]
    29. 29
  29. McCann, E. M., G. L. Kelly, A. B. Rickinson, and A. I. Bell. 2001. Genetic analysis of the Epstein-Barr virus-coded leader protein EBNA-LP as a co-activator of EBNA2 function. J. Gen. Virol. 82:3067-3079.[Abstract/Free Full Text]
    30. 30
  30. Myat, M. M., S. Anderson, L. A. Allen, and A. Aderem. 1997. MARCKS regulates membrane ruffling and cell spreading. Curr. Biol. 7:611-614.[CrossRef][Medline]
    31. 31
  31. Raggo, C., R. Ruhl, S. McAllister, H. Koon, B. J. Dezube, K. Fruh, and A. V. Moses. 2005. Novel cellular genes essential for transformation of endothelial cells by Kaposi's sarcoma-associated herpesvirus. Cancer Res. 65:5084-5095.[Abstract/Free Full Text]
    32. 32
  32. Rickinson, A. B., L. S. Young, and M. Rowe. 1987. Influence of the Epstein-Barr virus nuclear antigen EBNA 2 on the growth phenotype of virus-transformed B cells. J. Virol. 61:1310-1317.[Abstract/Free Full Text]
    33. 33
  33. Rowe, M., D. T. Rowe, C. D. Gregory, L. S. Young, P. J. Farrell, H. Rupani, and A. B. Rickinson. 1987. Differences in B cell growth phenotype reflect novel patterns of Epstein-Barr virus latent gene expression in Burkitt's lymphoma cells. EMBO J. 6:2743-2751.[Medline]
    34. 34
  34. Sample, J., L. Young, B. Martin, T. Chatman, E. Kieff, A. Rickinson, and E. Kieff. 1990. Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. J. Virol. 64:4084-4092.[Abstract/Free Full Text]
    35. 35
  35. Sjoblom, A., A. Jansson, W. Yang, S. Lain, T. Nilsson, and L. Rymo. 1995. PU box-binding transcription factors and a POU domain protein cooperate in the Epstein-Barr virus (EBV) nuclear antigen 2-induced transactivation of the EBV latent membrane protein 1 promoter. J. Gen. Virol. 76:2679-2692.[Abstract/Free Full Text]
    36. 36
  36. Sjoblom, A., W. Yang, L. Palmqvist, A. Jansson, and L. Rymo. 1998. An ATF/CRE element mediates both EBNA2-dependent and EBNA2-independent activation of the Epstein-Barr virus LMP1 gene promoter. J. Virol. 72:1365-1376.[Abstract/Free Full Text]
    37. 37
  37. Spender, L. C., W. Lucchesi, G. Bodelon, A. Bilancio, C. E. Karstegl, T. Asano, O. Dittrich-Breiholz, M. Kracht, B. Vanhaesebroeck, and P. J. Farrell. 2006. Cell target genes of Epstein-Barr virus transcription factor EBNA-2: induction of the p55alpha regulatory subunit of PI3-kinase and its role in survival of EREB2.5 cells. J. Gen. Virol. 87:2859-2867.[Abstract/Free Full Text]
    38. 38
  38. Spender, L. C., H. J. Whiteman, C. E. Karstegl, and P. J. Farrell. 2005. Transcriptional cross-regulation of RUNX1 by RUNX3 in human B cells. Oncogene 24:1873-1881.[CrossRef][Medline]
    39. 39
  39. Stoermann, B., K. Kretschmer, S. Duber, and S. Weiss. 2007. B-1a cells are imprinted by the microenvironment in spleen and peritoneum. Eur. J. Immunol. 37:1613-1620.[CrossRef][Medline]
    40. 40
  40. Stumpo, D. J., C. B. Bock, J. S. Tuttle, and P. J. Blackshear. 1995. MARCKS deficiency in mice leads to abnormal brain development and perinatal death. Proc. Natl. Acad. Sci. USA 92:944-948.[Abstract/Free Full Text]
    41. 41
  41. Takada, K., and Y. Ono. 1989. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63:445-449.[Abstract/Free Full Text]
    42. 42
  42. Tatsuta, T., J. Cheng, and J. D. Mountz. 1996. Intracellular IL-1beta is an inhibitor of Fas-mediated apoptosis. J. Immunol. 157:3949-3957.[Abstract]
    43. 43
  43. Wang, F., H. Kikutani, S. F. Tsang, T. Kishimoto, and E. Kieff. 1991. Epstein-Barr virus nuclear protein 2 transactivates a cis-acting CD23 DNA element. J. Virol. 65:4101-4106.[Abstract/Free Full Text]
    44. 44
  44. Wang, F., S. F. Tsang, M. G. Kurilla, J. I. Cohen, and E. Kieff. 1990. Epstein-Barr virus nuclear antigen 2 transactivates latent membrane protein LMP1. J. Virol. 64:3407-3416.[Abstract/Free Full Text]
    45. 45
  45. Werman, A., R. Werman-Venkert, R. White, J. K. Lee, B. Werman, Y. Krelin, E. Voronov, C. A. Dinarello, and R. N. Apte. 2004. The precursor form of IL-1alpha is an intracrine proinflammatory activator of transcription. Proc. Natl. Acad. Sci. USA 101:2434-2439.[Abstract/Free Full Text]
    46. 46
  46. Wu, D. Y., G. V. Kalpana, S. P. Goff, and W. H. Schubach. 1996. Epstein-Barr virus nuclear protein 2 binds to a component of the human SNF-SWI complex, hSNF5/Ini1. J. Virol. 70:6020-6028.[Abstract]
    47. 47
  47. Wu, D. Y., A. Krumm, and W. H. Schubach. 2000. Promoter-specific targeting of human SWI-SNF complex by Epstein-Barr virus nuclear protein 2. J. Virol. 74:8893-8903.[Abstract/Free Full Text]
    48. 48
  48. Wu, D. Y., D. C. Tkachuck, R. S. Roberson, and W. H. Schubach. 2002. The human SNF5/INI1 protein facilitates the function of the growth arrest and DNA damage-inducible protein (GADD34) and modulates GADD34-bound protein phosphatase-1 activity. J. Biol. Chem. 277:27706-27715.[Abstract/Free Full Text]
    49. 49
  49. Young, L. S., and A. B. Rickinson. 2004. Epstein-Barr virus: 40 years on. Nat. Rev. Cancer 4:757-768.[CrossRef][Medline]
    50. 50
  50. Zeng, M. S., D. J. Li, Q. L. Liu, L. B. Song, M. Z. Li, R. H. Zhang, X. J. Yu, H. M. Wang, I. Ernberg, and Y. X. Zeng. 2005. Genomic sequence analysis of Epstein-Barr virus strain GD1 from a nasopharyngeal carcinoma patient. J. Virol. 79:15323-15330.[Abstract/Free Full Text]
    51. 51
  51. Zhao, B., S. Maruo, A. Cooper, R. C. M., E. Johannsen, E. Kieff, and E. Cahir-McFarland. 2006. RNAs induced by Epstein-Barr virus nuclear antigen 2 in lymphoblastoid cell lines. Proc. Natl. Acad. Sci. USA 103:1900-1905.[Abstract/Free Full Text]
    52. 52
  52. Zimber-Strobl, U., E. Kremmer, F. Grasser, G. Marschall, G. Laux, and G. W. Bornkamm. 1993. The Epstein-Barr virus nuclear antigen 2 interacts with an EBNA2 responsive cis-element of the terminal protein 1 gene promoter. EMBO J. 12:167-175.[Medline]

Journal of Virology, August 2008, p. 7456-7466, Vol. 82, No. 15
0022-538X/08/$08.00+0     doi:10.1128/JVI.00223-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Brady, G., Whiteman, H. J., Spender, L. C., Farrell, P. J. (2009). Downregulation of RUNX1 by RUNX3 Requires the RUNX3 VWRPY Sequence and Is Essential for Epstein-Barr Virus-Driven B-Cell Proliferation. J. Virol. 83: 6909-6916 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lucchesi, W.
Right arrow Articles by Farrell, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucchesi, W.
Right arrow Articles by Farrell, P. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»