This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goncalvez, A. P.
Right arrow Articles by Lai, C.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goncalvez, A. P.
Right arrow Articles by Lai, C.-J.

 Previous Article  |  Next Article 

Journal of Virology, July 2008, p. 7009-7021, Vol. 82, No. 14
0022-538X/08/$08.00+0     doi:10.1128/JVI.00291-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Humanized Monoclonal Antibodies Derived from Chimpanzee Fabs Protect against Japanese Encephalitis Virus In Vitro and In Vivo {triangledown}

Ana P. Goncalvez,1* Cheng-Hsin Chien,5 Kamolchanok Tubthong,4 Inna Gorshkova,3 Carrie Roll,1 Olivia Donau,1 Peter Schuck,3 Sutee Yoksan,4 Sy-Dar Wang,5 Robert H. Purcell,2 and Ching-Juh Lai1*

Molecular Viral Biology Section,1 Hepatitis Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases,2 Protein Biophysics, National Institute of Biomedical Imaging and Bioengineering, NIH, Bethesda, Maryland 20892,3 Institute of Science and Technology for Research and Development, Mahidol University, Nakhonpathom, Thailand,4 Adimmune Corporation, Taichung, Taiwan5

Received 8 February 2008/ Accepted 6 May 2008


arrow
ABSTRACT
 
Japanese encephalitis virus (JEV)-specific Fab antibodies were recovered by repertoire cloning from chimpanzees initially immunized with inactivated JE-VAX and then boosted with attenuated JEV SA14-14-2. From a panel of 11 Fabs recovered by different panning strategies, three highly potent neutralizing antibodies, termed Fabs A3, B2, and E3, which recognized spatially separated regions on the virion, were identified. These antibodies reacted with epitopes in different domains: the major determinant for Fab A3 was Lys179 (domain I), that for Fab B2 was Ile126 (domain II), and that for Fab E3 was Gly302 (domain III) in the envelope protein, suggesting that these antibodies neutralize the virus by different mechanisms. Potent neutralizing antibodies reacted with a low number of binding sites available on the virion. These three Fabs and derived humanized monoclonal antibodies (MAbs) exhibited high neutralizing activities against a broad spectrum of JEV genotype strains. Demonstration of antibody-mediated protection of JEV infection in vivo is provided using the mouse encephalitis model. MAb B2 was most potent, with a 50% protective dose (ED50) of 0.84 µg, followed by MAb A3 (ED50 of 5.8 µg) and then MAb E3 (ED50 of 24.7 µg) for a 4-week-old mouse. Administration of 200 µg/mouse of MAb B2 1 day after otherwise lethal JEV infection protected 50% of mice and significantly prolonged the average survival time compared to that of mice in the unprotected group, suggesting a therapeutic potential for use of MAb B2 in humans.


arrow
INTRODUCTION
 
Japanese encephalitis virus (JEV) is the prototype virus of the Japanese encephalitis (JE) group belonging to the Flavivirus genus of the Flaviviridae family. Other members of the group include Kunjin virus, St. Louis encephalitis virus, and West Nile encephalitis virus (WNV). JEV is widely distributed in South Asia, Southeast Asia, and the Asian Pacific Rim. In recent years, JE epidemics have spread to previously unaffected areas, such as northern Australia (14, 47), Pakistan (17), and India and Indonesia (27). The JE outbreak in India during July to November of 2005 was the longest and most severe in recent years, affecting >5,000 persons and causing >1,000 deaths (42). It is estimated that JEV causes 35,000 to 50,000 cases of encephalitis, including 10,000 deaths and as many neurologic sequelae, each year (61). Although only one JEV serotype is known to exist, cross-neutralization experiments have demonstrated antigenic differences among JEV strains (1). Phylogenic studies have identified five JEV genotypes, four of which are presently recognized (5, 55, 62). The wide geographical distribution and the existence of multiple strains, coupled with the high rate of mortality and residual neurological complications in survivors, make JEV infection an important public health problem.

The JE-VAX vaccine currently available in most countries is an inactivated whole-virus vaccine prepared from virus grown in mouse brain, and a three-dose regimen is required for young children (34). The requirements of multiple doses and the high vaccine manufacturing cost have prevented many countries from adapting an effective JEV vaccination campaign. A live-attenuated vaccine, JEV strain SA14-14-2, has been developed and extensively used in China and appears to be efficacious after one dose in a recent case-controlled study (59). A potentially promising, chimeric JEV vaccine constructed from the attenuated yellow fever 17D strain is in a late experimental stage (35). Until a JEV vaccine becomes generally available, passive immunization with potently neutralizing anti-JEV antibodies remains an attractive strategy for short-term prevention of and therapeutic intervention in encephalitic JEV infections.

Like other flaviviruses, JEV contains a single-stranded RNA genome that codes for the three virion proteins, i.e., the capsid (C), premembrane/membrane (prM/M), and envelope (E) proteins, and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). The E protein is the major protective antigen, eliciting neutralizing antibodies that play an important role in protective immune responses. In the replication cycle, the E protein mediates virus attachment to a putative cell receptor(s) and viral fusion with the endosomal membranes. Three-dimensional structures of several flavivirus E proteins have been determined by X-ray crystallography (20, 32, 33, 49). The head-to-tail dimers of E are tightly organized on the virion surface. The monomeric E is folded into three structurally distinct domains (domains I to III). Domain III adopts an immunoglobulin-like structure consisting of seven antiparallel β-strands. This domain is linked by a flexible region to domain I, which folds into an eight-stranded antiparallel β-barrel. Domain I contains approximately 120 amino acids in three segments disrupted by two inserts in the form of looped sequences, which together form the dimerization domain (domain II). At the distal end of one of these domain II inserts is a flavivirus-conserved peptide shown to be involved in membrane fusion (2, 23, 49).

Studies of mouse monoclonal antibodies (MAbs) from flavivirus infections have provided much information about E functional specificities and antigenic structures. A majority of cross-reactive, weakly to nonneutralizing antibodies react with epitope determinants involving the fusion peptide in domain II (56). Antibodies that recognize domain III epitopes are type-specific and efficient neutralizers of viral infection (39, 50). Domain III-reactive antibodies can neutralize the virus at an early infection step presumably by blocking viral attachment to cell receptors or by interfering with conformational changes to E, thereby preventing membrane fusion (6, 37). Mouse MAbs that neutralize flaviviruses, such as St. Louis encephalitis virus, yellow fever virus, and dengue virus (DENV), at high titers in vitro have also been shown to mediate protection of infection in vivo (4, 28). In the case of JEV, studies have shown that passive transfer of mouse MAbs can protect against prior and subsequent infection in mice, goats, and monkeys (21, 65). However, the possible immunogenicity of these antibodies limits their clinical utility in humans. Only a relatively few MAbs that efficiently neutralize flaviviruses and map to domain I or II have been characterized (7, 16, 24, 29, 36, 51). Consequently, the antigenic structures of these domains and their involvement in the protective immune response remain poorly understood.

Until recently, there has been a lack of primate-derived antibodies for characterization of flavivirus antigenic epitopes discovered with mouse antibodies. However, DENV type-specific and cross-reactive antibodies recently have been recovered from infected chimpanzees by repertoire cloning. A DENV-4-specific, highly neutralizing MAb (5H2) has been shown to react with epitope determinants in domain I, and a DENV-cross-reactive antibody (1A5) was shown to react with the fusion peptide in domain II (11, 24). It was also demonstrated that passively transferred MAb 1A5, which shares characteristics with a major subset of flavivirus cross-reactive antibodies, upregulates DENV replication by a mechanism of antibody-dependent enhancement (9). We have also shown that passive transfer with the highly neutralizing antibody MAb 5H2 protects mice and monkeys against DENV-4 challenge (24). As an extension of these studies of antibodies against DENV, the present study describes repertoire cloning, epitope mapping, and functional characterization of JEV-neutralizing MAbs from immunized chimpanzees. Several panning strategies were applied to recover Fabs that bind to epitopes in different antigenic domains. Representative MAbs that neutralized JEV efficiently and mapped to each of the three domains in E were selected for analysis of binding activities for JEV and evaluation of their in vitro neutralizing titers against strains belonging to the four JEV genotypes. The protective capacities of these humanized antibodies were analyzed in a mouse model of JE.


arrow
MATERIALS AND METHODS
 
Viruses and cultured cells. Simian Vero cells and mosquito C6/36 cells were grown in minimum essential medium (MEM). Schneider's Drosophila melanogaster line 2 (S2) cells were cultured in Schneider's Drosophila medium, and human embryonic kidney 293 T cells were cultured in Dulbecco's modified essential medium. All media were supplemented with 10% fetal bovine serum, 0.05 mg/ml gentamicin, and 2.5 units/ml amphotericin B (Fungizone). Media were purchased from Invitrogen (Carlsbad, CA), and cells were from the American Type Culture Collection (Manassas, VA). The inactivated JEV vaccine, JE-VAX, was obtained from Sanofi Pasteur Inc. (Swiftwater, PA). The attenuated JEV SA14-14-2 strain was kindly provided by K. Eckels and R. Putnak. The JEV stock used for infection of chimpanzees, phage library panning, and plaque reduction neutralization tests (PRNT) was prepared from infected C6/36 cells grown in Voges-Proskauer-serum-free medium (Invitrogen). The virus titer was approximately 108 focus-forming units (FFU)/ml as determined on Vero cell monolayers. PRNT using the four genotype strains of wild-type JEV was performed at the Center for Vaccine Development, Mahidol University (Nakhonpathom, Thailand). These strains were JE 1991 (genotype I), JE B1034/8 (genotype II), Beijing (genotype III), and JKT 9092 (genotype IV). The JEV prototype strain Nakayama, belonging to genotype III, was used for mouse challenge experiments performed at Adimmune Corporation (Taichung, Taiwan). Experiments to detect antibody-binding specificities were performed by enzyme-linked immunosorbent assay (ELISA) with DENV-1 (Hawaii), DENV-2 (New Guinea B), DENV-3 (H87), DENV-4 (814669), Langat virus (LGTV) strain TP 21, and a WNV/DENV-4 chimera as described previously (10).

Antibodies. Humanized MAbs 1A5 and 5H2 derived from chimpanzee Fabs were prepared by transient transfection of 293 T cells (10, 30) (Kemp Biotechnology, Gaithersburg, MD). Hyperimmune mouse ascites fluid (HMAF) raised against JEV was purchased from the American Type Culture Collection (Manassas, VA). Mouse JEV complex-reactive MAb 8743 (MAb 6B4A-10) was purchased from Chemicon (Temecula, CA). JEV E domain III-specific mouse MAb E3.3 was kindly provided by S.-C. Wu (26).

JEV E antigen preparations. Three different E antigen preparations from JEV SA14-14-2 were used: (i) JEV virions, (ii) domain III-specific E, and (iii) N-terminal 80% E. To prepare JEV virions, mosquito C6/36 cells grown in MEM plus supplements were infected with the virus at a multiplicity of infection of 0.1 in Voges-Proskauer-serum-free medium (Invitrogen, Carlsbad, CA) and incubated at 32°C. The culture medium was harvested 8 days after infection and kept frozen at –80°C. The virus preparation was used for panning, ELISA, and neutralization assays, as well as for selection of neutralization-escape variants. The recombinant domain III-specific E was constructed for use as panning antigen. The protein was expressed in bacteria with a histidine tag, essentially as described elsewhere (18, 64). The DNA sequence corresponding to amino acids 296 to 398 (DIII) near the C terminus of E was amplified by PCR from the viral cDNA of JEV SA 14-14-2. The DNA product was then purified and digested with EcoRI and HindIII, followed by insertion into the pET21 cloning vector (Novagen, Madison, WI). Escherichia coli [strain BL21(DE3)] was transformed with pET21 plasmid containing the insert. The histidine-tagged, domain III E protein was affinity purified through a column of Talon metal affinity resin (Clontech, Mountain View, CA). Western blot analysis and ELISA were performed using JEV HMAF and MAb E3.3 to confirm the identity and proper folding of the recombinant domain III E protein.

Recombinant 80% E was generated in Drosophila S2 cells essentially as described elsewhere (25, 31, 46). The DNA encoding amino acids 131 to 692 of the prM/N-terminal 80% E fusion protein was amplified by PCR from JEV cDNA using the primers GGAGCCATGAAGAGATCTAATTTCCAGGGG and GCCCAGCGTGCTCCGCGGTTTGTGCCAATGGTG. The DNA product was digested with BglII and SacII and inserted into the pMTBiP/V5-HisB expression vector (Invitrogen, Carlsbad, CA). The recombinant plasmid and a blasticidin resistance plasmid, pCoBlast, were cotransfected into Drosophila S2 cells according to the instructions for the Drosophila expression system kit (Invitrogen, Carlsbad, CA). Stably transformed cells were selected with blasticidin and then transferred to Drosophila serum-free medium (Invitrogen, Carlsbad, CA). Cultured S2 cells expressing JEV prM-80% E were induced with CuSO4 at 500 µM. The secreted 80% E protein is immediately followed by the V5 epitope flag and polyhistidine tag encoded by the plasmid vector. The recombinant E protein was affinity purified with Talon metal affinity resin. Western blot analysis and ELISA were performed with HMAF, MAb E3.3, and MAb 8743 to verify the identity of recombinant E. Variants of recombinant 80% E containing single amino acid substitutions were constructed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA).

Immunization of chimpanzees with JEV vaccines and construction of {gamma}1/{kappa} antibody library. Two chimpanzees (96A007 and 1620) were administered subcutaneously three doses of JE-VAX of 1 ml each at days 0, 7, and 30, according to the indicated regimen. One year later the chimpanzees were infected with a mixture of attenuated JEV strain SA14-14-2 and WNV/DENV-4 chimera each at 106 FFU, diluted in MEM plus 0.25% human serum albumin to boost the antibody response. Eight weeks after infection, bone marrow was aspirated from each chimpanzee and the lymphocytes were prepared by centrifugation on a Ficoll-Paque gradient. Repertoire cloning of chimpanzee Fab fragments was described earlier (30). Approximately 1 x 107 bone marrow lymphocytes from chimpanzee 96A007, which developed a higher JEV-neutralizing antibody titer than did chimpanzee 1620, were used for phage library construction. A library with a diversity of 2 x 108 to 1 x 109 was obtained at each cloning step.

Panning of phage library and selection of JEV-specific Fabs. The pComb 3H DNA library that contained the VL-CL and VH-CH1 inserts was used for phage preparation as described earlier (30). To increase the possibility of recovering antibodies against different epitopes on the JEV E, three different panning strategies were used. The phage library was first panned using JEV virions captured by chimpanzee convalescent-phase sera applied as a coating to the wells of an ELISA plate. Panning of the phage library by epitope masking was also conducted as described previously (8). Briefly, wells of a microtiter plate coated with JEV virions were incubated with purified Fab A3 (isolated in the panning described above) at a concentration of 50 µg/ml for 1 h at 37°C. One-fourth of the volume was removed before addition of 50 µl of the phage library. The third strategy of antibody selection was performed using domain III-specific E as panning antigen. Briefly, wells of a 96-well ELISA plate were coated with 5 µg/well of purified domain III E in 0.1 M carbonate buffer, pH 9.0. After being washed with phosphate-buffered saline (PBS), antigen-coated wells were blocked with 3% bovine serum albumin. The phage library was then added as described. Following three cycles of panning in each case, the selected phage population was used for infection of E. coli XL-1 to produce phagemid DNA. Phagemid DNA was cleaved with SpeI and NheI to remove the phage gene III segment and circularized for transformation of E coli XL-1. Transformed E. coli colonies were screened by ELISA to identify clones producing soluble Fab fragments reactive with JEV. Individual Fabs were prepared and screened for binding specificity to JEV virions or domain III E. Plasmids were sequenced to identify Fab clones with distinct VH and VL DNA inserts.

Production of Fabs and humanized MAbs. The histidine-tagged Fab produced in E. coli was affinity purified using Talon metal affinity resin. The Fab purity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the concentration was determined using the bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Construction of plasmids for expression of full-length humanized immunoglobulin G1 (IgG1) (designated as MAb thereafter) from cloned Fab DNA was carried out as described previously (30). MAb expression was verified by transfection of 293 T cells (purchased from ATCC) in the presence of Lipofectamine (Invitrogen, Carlsbad, CA) and grown in Optimem medium. One day after transfection, cells were washed and Dulbecco's modified essential medium was added. Cells were incubated for 5 to 7 days, and the culture medium was harvested. The medium was concentrated, and the MAb product was purified on a protein A column (Pierce, Rockford, IL). Scale-up MAb production was performed by Kemp Biotechnology (Gaithersburg, MD).

Measurement of neutralizing titers of Fab and MAb. The neutralizing titer of Fab or MAb was determined by PRNT against the representative JEV strains essentially as described elsewhere (30, 38). Virus foci that formed on the cell monolayer were immunostained, and the antibody 50% plaque reduction neutralization test (PRNT50) titer in µg/ml was calculated. The neutralization tests using the attenuated and wild-type JEV strains were performed in appropriate biologic containment laboratories at NIH and the University of Mahidol, Thailand, respectively.

Biotinylation of purified Fab and competition ELISA. Purified Fabs were biotinylated with EZ-Link N-hydroxysuccinimide-LC-biotin (Pierce, Rockford, IL) and used in competition ELISA. Briefly, biotin-labeled Fab at a fixed concentration was mixed with dilutions of a crude or purified preparation of competing Fab. The mixture was added to JEV virion-coated wells and incubated at 37°C. After washing, streptavidin-alkaline phosphatase (Pierce, Rockford, IL) was added to detect the amount of biotinylated Fab attached to the virus.

Measurement of binding affinity. Affinity binding analysis by ELISA or with a surface plasmon resonance (SPR) biosensor was performed to determine the Fab or MAb binding activity for JEV virions. ELISA was performed as described previously with minor modifications, i.e., in the absence of detergent at all steps (11, 48). JEV HMAF was used to coat the microtiter plate. Following blocking with 3% bovine serum albumin, JEV at a predetermined concentration was added and incubated at 37°C for 1 h. Dilutions of affinity-purified Fab were added and incubated at 37°C for 1 h. The Fab bound to JEV on the microtiter plate was detected using a goat anti-human IgG-alkaline phosphatase conjugate (Sigma, St. Louis, MO). The steady-state equilibrium affinity constant (KD) was calculated as the Fab concentration that produced 50% maximum binding.

The SPR biosensor experiments were conducted using a Biacore 3000 instrument (Biacore Inc., Piscataway, NJ) with short carboxymethylated dextran sensor surfaces (CM3; GE Healthcare, Piscataway, NJ) and standard amine coupling as described elsewhere (54). Since the recombinant E protein showed self-binding in preliminary experiments, the E protein was immobilized on the chip surface and the kinetics of Fab binding and dissociation were recorded for 40 to 50 min and 2 h to 10 h, respectively, at various Fab concentrations (53). Analysis of antibodies was conducted at a flow rate of 2 µl/min for Fab B2 and 5 µl/min for Fabs A3 and E3, using PBS-P buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2.3 mM KH2PO4, 0.005% surfactant P20, pH 7.4) at 25°C. The chip surface was regenerated with 0.05% Triton X-100-2 M NaCl in the case of Fab B2. No regeneration conditions were applied with Fabs A3 and E3. The kinetic traces were globally fitted with a model for continuous ligand distributions combined with a two-compartment approximation of mass transport (58).

Immunoprecipitation and Western blot analysis. Immunoprecipitation was performed with lysates of JEV-infected mosquito cells or purified recombinant E. C6/36 cells were infected with the virus at a multiplicity of infection of 1 and incubated for 5 days at 32°C. Infected cells were rinsed with PBS, and lysis buffer containing 1% NP-40, 0.15 M NaCl, and 0.1 M Tris, pH 7.5, was added. The cell lysate or recombinant E was incubated with the test antibody for 2 h at 4°C. A 10-µl suspension of protein A Sepharose beads (Calbiochem, La Jolla, CA) was added, and the mixture was incubated overnight at 4°C. The beads containing immunocomplexes were collected by centrifugation and washed three times with the lysis buffer. The immunocomplexes were supplemented with 4x loading buffer (Invitrogen, Carlsbad, CA) and separated by SDS-PAGE. After being transferred onto a nitrocellulose membrane, the E protein was detected by a mouse or humanized anti-JEV antibody followed by anti-mouse or anti-human IgG-horseradish peroxidase (HRP; Pierce, Rockford, IL) or by a mouse anti-V5 epitope MAb-HRP conjugate (Invitrogen, Carlsbad, CA) for chemiluminescence development (Pierce, Rockford, IL).

Selection of JEV antigenic variants. Affinity-purified Fabs A3, B2, and E3 were used for selection of neutralization-escape mutants (11). Briefly, approximately 1 x 107 FFU of parental JEV SA14-14-2 was mixed with 25 µg/ml of Fab in MEM and incubated at 37°C for 1 h. The mixture was added to the Vero cell monolayer and incubated at 37°C for 1 h. Following removal of the inoculum, the plate was rinsed once with PBS, refed with 3 ml of MEM containing 2% fetal bovine serum and 5 µg/ml of the selecting Fab, and incubated at 37°C for 5 days. Antibody-resistant variants were isolated by plaque-to-plaque purification on Vero cells, and the individual isolates were amplified in infected C6/36 cells in the presence of the selecting Fab. Sequence analysis of JEV antigenic variants was conducted as described previously (11). The JEV E structure modeling was performed with the crystal coordinates of WNV, accession code 2I69, as a template (20) and SwissModel (13, 43). Graphical development was performed using the UCSF Chimera package from the Resource for Biocomputing, Visualization, and Informatics (University of California, San Francisco) (44).

Mouse model for JEV challenge. Experiments involving passive antibody transfer in mice were performed at Adimmune Corporation (Taichung, Taiwan). The laboratory is approved for good manufacturing practices. For analysis of efficacy, groups of 4-week-old inbred ddy mice (either sex, n = 12) were infused with 0.5 ml of MAb at doses of 200, 40, 8, 1.6, and 0.32 µg per mouse by the intraperitoneal (i.p.) route and the control group received PBS diluent only. One day later, mice in all groups were challenged by the intracerebral (i.c.) route with 40 50% lethal doses (LD50) (1.5 FFU) of JEV strain Nakayama in 30 µl. The animals were monitored daily for clinical signs of infection, including ruffled hair, hunched back, paralysis, and death, for 2 weeks. When signs of encephalitic paralysis developed, mice were euthanized as the experiment end point. In the infection-intervention experiment by passive antibody transfer, a single dose of test MAb at 200 µg was administrated by the i.p. route at day 1, 3, or 5 following i.c. inoculation of 40 LD50 of JEV Nakayama. Mice were monitored daily for symptoms of encephalitis for 3 weeks. Student's t test was used to compare the average survival times between the mouse groups that received MAb and those that received PBS.


arrow
RESULTS
 
Chimpanzee antibody response to JEV vaccines and isolation of Fabs. Two chimpanzees were initially immunized with three doses of inactivated vaccine JE-VAX. After 2 months chimpanzees 96A007 and 1620 developed only moderate PRNT50 titers against JEV SA14-14-2 (1/100 and 1/71, respectively). After inoculation with a mixture of JEV SA14-14-2 and WNV/DENV-4 chimera, high JEV-neutralizing antibody titers, 1/10,633 and 1/3,114, were detected in the serum of chimpanzees 96A007 and 1620, respectively. Chimpanzee bone marrow was aspirated 8 weeks after infection, and the cells of chimpanzee 96A007 were used for a phage library construction.

Selection of Fabs from a combinatorial library with a single panning antigen often yields only a dominant antibody subset that may or may not be neutralizing. Highly neutralizing antibodies may be present as a minor subset. Therefore, three different panning strategies were performed in order to assemble a collection of JEV-neutralizing Fab antibodies for further functional characterizations.

(i) Fabs recovered from panning with JEV virions (group 1 Fabs). The phage library was first panned with JEV virions captured by chimpanzee polyclonal sera. A total of 200 E. coli clones were screened for Fabs reactive to the virus. Sequence alignment of 48 positive Fab clones identified four VH sequences, three of which, i.e., Fabs A3, G9, and B3, were similar but not identical (Fig. 1). These Fabs appeared to represent a dominant subset of antibodies in the library. The VL sequences of these four Fab clones showed three distinct patterns. Binding assay by ELISA showed that, with the exception of Fab A3, which was weakly reactive to WNV (detected only at 1/10 dilution), the other three Fabs reacted with JEV but not with DENV-1 to -4, WNV, or LGTV. These Fabs neutralized JEV efficiently at PRNT50 titers ranging from 2.55 to 7.91 nM (0.12 to 0.36 µg/ml) (Table 1).


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 1. VH and VL sequences of chimpanzee JEV-specific Fabs. Fabs were grouped according to the panning strategy: group 1, panning with JEV SA14-14-2 virions; group 2, panning with epitope masking; and group 3, panning with a JEV E domain III-specific recombinant protein. Sequences of the most potently neutralizing Fab in each group are colored (VH in blue and VL in red). Framework regions (FR), complementarity-determining regions (CDR), sequence identities (dots), and deletions (dashes) are indicated.


View this table:
[in this window]
[in a new window]

  		TABLE 1. JEV-neutralizing Fabs recovered by different panning strategies

(ii) Fabs recovered from panning by epitope masking (group 2 Fabs). To increase the possibility of recovering a different subset of antibodies binding to minor epitopes on E, Fab A3 (described above) was used for epitope masking in a new panning of virions. From some 200 clones screened, 12 Fabs bound to the virus. Sequence analysis identified five VH sequences different from members of the group 1 Fabs (Fig. 1). PRNT showed that three Fabs, i.e., B2, F1, and F3, had high neutralizing activities ranging from 0.25 to 0.45 nM (0.012 to 0.021 µg/ml), while Fabs A8 and G1 were not neutralizing (Table 1). Members of this Fab group bound to JEV but not to DENV-1 through -4, WNV, or LGTV as analyzed by ELISA.

(iii) Fabs recovered from panning with domain III E (group 3 Fabs). Evidence indicates that flavivirus infections elicit a major class of cross-reactive but weakly neutralizing antibodies that react with epitopes involving the fusion peptide in domain II E (41, 56). Studies of cloning of DENV-neutralizing antibodies from chimpanzees (10) and of cloning of WNV antibodies from humans (60) have suggested that antibodies reactive to domain III E are rare. Nevertheless, studies of WNV-neutralizing antibodies indicate that domain III E is an antigenic target in the murine model (39). The third strategy to recover chimpanzee antibodies against JEV used domain III-specific E as the panning antigen. Twenty-three Fabs were identified, and sequence analysis revealed two distinct VH segments, as present in Fabs E3 and B12, with Fab E3 representing 78% of the clones. Both Fabs were JEV specific. Fab E3 neutralized the virus at a relatively low titer (84.9 nM) compared to the neutralizing titers of Fabs selected with the previous panning strategies (Table 1). Fab B12 did not neutralize JEV (>1,070 nM).

(iv) Human homologs of chimpanzee antibodies. A search for sequence homology in the database showed the most closely related human IgG gene homologs of the panel of chimpanzee Fabs (Table 2). The {gamma}1 heavy chain sequences of these Fabs demonstrated similarity to the human VH1, VH3, VH4, or VH7 gene families with sequence homologies ranging from 67 to 83%, excluding the CDR-3 regions. The {kappa} light chain sequences exhibited the highest identity with human VK1, VK2, or VK3 gene families with sequence homologies of 80 to 95%, excluding the CDR-3 regions. The four Fabs in group 1 were most closely related to VH1 and VK1 germ line genes. The {gamma}1 heavy chain sequences of the most highly neutralizing Fabs in group 2 had the highest identity with the human VH3 gene family.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Sequence similarities between chimpanzee Fabs and their most closely related human immunoglobulin homologs

Fab binding sites on JEV shown by competition ELISA. Six Fabs that were distinct in their CDR-3H sequences were selected for analysis of the relatedness of their binding sites on JEV by competition ELISA (Fig. 1). Fabs A3, B2, and E3 were representatives of the three Fab groups that neutralized JEV most efficiently. Additionally, Fabs A8 and G1 (group 2) and Fab B12 (group 3) were selected for analysis of their binding sites on JEV. Binding competition was not detected among these Fabs with each other nor with DENV-4-specific Fab 5H2 as a negative control (30) (Fig. 2). Further, binding competition was not observed with Fab 1A5, a flavivirus-broadly reactive antibody that binds to the conserved fusion loop in E identified earlier (11). Thus, highly neutralizing Fabs A3, B2, and E3 as well as nonneutralizing Fabs A8, G1, and B12 recognized nonoverlapping epitopes on JEV.


Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 2. Analysis of Fab binding to JEV SA14-14-2. Fabs A3 (A), B2 (B), and E3 (C) were affinity purified, biotinylated, and used for analysis of binding activity to JEV SA14-14-2 by competition ELISA in the presence of competing, unlabeled Fabs. Fab 5H2, which did not react with JEV, was used as a negative control. Fab 1A5 is a flavivirus cross-reactive antibody that binds to determinants in the flavivirus E fusion loop. JEV Fab clones were grouped according to the panning procedure: group 1, orange; group 2, green; and group 3, blue.

Antigenic specificity of Fabs. The antigenic specificity of Fabs A3, B2, and E3 was first determined by Western blot analysis using their derived humanized MAbs. A lysate of JEV-infected C6/36 cells (Fig. 3A, upper panel) or a recombinant E preparation (Fig. 3A, lower panel) was separated by SDS-PAGE and then blotted on a nitrocellulose membrane. MAbs A3 and E3 bound to E (50 kDa and a minor band at 46 kDa), but no such binding was detected with MAb B2 under the same conditions. The possibility that MAb B2 reacts with a conformational epitope was investigated further by immunoprecipitation of the cell lysate (Fig. 3B, upper panel) or the recombinant E (Fig. 3B, lower panel) under native conditions, i.e., in the absence of SDS and β-mercaptoethanol. Binding of E by MAbs A3 and E3 was detected in both panels. By comparison, the binding activity of MAb B2 for virion E as well as recombinant E was low but definitely detected, indicating that MAb B2 reacted with native JEV E. All three MAbs failed to precipitate E under reducing conditions (data not shown).


Figure 3
View larger version (59K):
[in this window]
[in a new window]

  		FIG. 3. Identification of E as the binding target of JEV MAbs. (A) Purified MAbs were incubated with nitrocellulose membranes blotted with JEV strain SA14-14-2 (upper panel) or the recombinant JEV E protein (lower panel), separated by 4 to 12% SDS-PAGE under nonreducing conditions. HMAF against JEV was included as a positive control. (B) Immunoprecipitation of JEV-infected mosquito cell lysates (upper panel) or a recombinant JEV E protein (lower panel) was analyzed under nonreducing conditions by Western blotting with MAb 6B4A-10 and anti-mouse IgG-HRP (upper panel) or with MAb anti-V5 epitope-HRP (lower panel). Molecular size markers are shown on the left.

Binding activities of Fabs and derived MAbs for JEV. The binding activities of Fabs and their derived MAbs for JEV virions in the absence of detergents were determined by ELISA. The concentration of each antibody required to attain 50% maximum binding was calculated by nonlinear regression (Fig. 4A). The concentration provides an estimate of the binding affinity KD. Accordingly, the KD was 0.45 ± 0.06 nM for Fab A3, 0.28 ± 0.11 nM for Fab B2, and 0.98 ± 0.07 nM for Fab E3 (Table 3). Conversion from the monovalent Fab to the bivalent MAb form increased the antibody avidity three- to fourfold. A consistent correlation was observed for each antibody when the KD value was compared with the neutralization titer (r = 0.97).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 4. Binding activities of JEV Fabs. (A) Binding in response to different concentrations of purified Fabs was analyzed by ELISA on JEV SA14-14-2 virions attached to the solid phase with HMAF. The Fab concentration required to reach 50% saturation binding was calculated by nonlinear regression. (B) Representative sensograms of Fabs A3 (top) and B2 (bottom) analyzed by SPR with the recombinant JEV E protein, showing curves fitted using a model for continuous ligand distributions, combined with a two-compartment approximation of mass transport. Experimental data are shown in black, and fitted curves are shown in red.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Binding and neutralizing activities of Fabs and MAbs

The question arises whether there is a similar correlation between Fab binding affinity for recombinant E and the neutralization potency. SPR measurements allow a precise, real-time determination of Fab-E association and dissociation rates. Representative tracings for Fabs A3 and B2 are shown in Fig. 4B. Using this analysis, the affinity constant Kd measured for Fab A3 was 0.72 nM and that for Fab E3 was 0.35 nM, comparable to the KD values measured by ELISA (Table 3). The Kd of Fab B2 for binding to recombinant E was ≥150-fold weaker than that measured for Fab A3 or E3. The Kd of Fab B2 was also significantly weaker than the KD measured with virions by ELISA (110 nM versus 0.15 nM, respectively). Remarkably, the off-rate of Fab B2 was ≥120-fold higher than that of Fab A3 or E3.

Localization of epitope determinants on E. Fabs A3, B2, and E3 were each used to isolate neutralization-escape mutants of JEV SA14-14-2. Antigenic variant JEV-v1 was isolated from Fab A3, JEV-v2 was isolated from Fab B2, and JEV-v3 was isolated from Fab E3. When the selecting Fab was used in the neutralization assay, variants JEV-v1 and JEV-v2 showed approximately 340- and 132-fold more resistance than the parental virus, respectively (Fig. 5A and B). JEV-v3 was completely resistant to neutralization by 1,080 nM Fab E3 (Fig. 5C).


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 5. Neutralization of parental JEV and its variants using chimpanzee JEV Fabs. JEV neutralization-escape variants v1, v2, and v3 were selected with the Fabs A3, B2, and E3, respectively. Neutralization titrations by PRNT against parental JEV and antigenic variants v1, v2, and v3 with Fabs A3 (A), B2 (B), and E3 (C) are shown. PRNT was performed using approximately 70 FFU of each virus for incubation with serially diluted antibody at 37°C for 1 h. The reaction mixture was used to infect Vero cells. Foci of infected cells were detected by immunostaining.

To map the epitope determinants of JEV-neutralizing antibodies, the C-prM-E sequences of variants v1, v2, and v3 and the parental virus were determined. Figure 6A shows the sequence alignment in the regions surrounding the amino acid substitutions in the variants. Variant v1 contained two substitutions in E, Lys136-Asn (β-strand E0) and Lys179-Glu (β-strand G0), both located in domain I. These two amino acids are conserved, but the surrounding amino acids vary among members of the JE group, which possibly accounts for the lack of reactivity of Fab A3 with WNV by ELISA (Table 1). These amino acids were 20.7 Å apart and exposed on the surface of E, according to the three-dimensional JEV E protein model based on the WNV E crystal coordinates (Fig. 6B). Variant v2 also contained two substitutions, Ile126-Thr (β-strand e) and Tyr219-His ({alpha}-A), at a distance of 16.2 Å in domain II. Binding of Fab B2 to WNV was not observed, despite the conservation of Ile126 and surrounding amino acids (Fig. 6A). Variant v3 also contained two substitutions, Gly302-Asp in domain III and Ile126-Thr in domain II. The two positions were approximately 64.6 Å apart, and Fab E3 reacted with domain III sequences, suggesting that Ile126-Thr was probably not responsible for resistance to neutralization by this antibody. Based on the comparison of the escape variant and the wild-type virus PRNT50 titers, it is possible that there might be other major epitope determinants, especially for Fabs A3 and B2.


Figure 6
View larger version (41K):
[in this window]
[in a new window]

  		FIG. 6. Localization of epitope determinants of JEV MAbs. (A) Alignment of amino acid sequences among flavivirus E proteins. Sequences surrounding the amino acid substitutions found in JEV variants v1, v2, and v3 are shown. Clustal W v2 was used to obtain an optimal amino acid sequence alignment file. Abbreviations: MVEV, Murray Valley encephalitis virus; SLEV, St. Louis encephalitis virus; YFV, yellow fever virus; TBE, tick-borne encephalitis virus. (B) Three-dimensional structure model of JEV SA14-14-2 E protein. The structure modeling was performed with the crystal coordinates of WNV (Protein Data Bank code 2I69) and a Swiss Modeling workstation. Molecular graphics images were produced using the UCSF Chimera program. Positions of 126Ile, 136Lys, 179Lys, 219His, and 302Gly as viewed from the top (upper panel) and from the side (lower panel). E domain sequences are colored: domain I in red, domain II in yellow, and domain III in blue.

JEV recombinant E proteins containing single amino acid substitutions. Since there were two mutations in E of each JEV variant, the effect of each mutation on antibody binding was analyzed. JEV E proteins containing the single substitution Ile126-Thr, Lys136-Asn, Lys179-Asp, His219-Tyr, or Gly302-Asp were generated. Immunoblots showed that Lys136-Asn substitution had no effect, whereas the Lys179-Asp mutation lost reactivity for MAb A3 (Fig. 7A). Similarly, Gly302-Asp substitution lost reactivity for MAb E3, whereas Ile126-Thr had no effect, as predicted. The antibody-binding patterns of these E constructs were also confirmed by immunoprecipitation (Fig. 7B). The latter assay further showed that Ile126-Thr substitution lost the reactivity for MAb B2, whereas His219-Tyr did not affect binding. As a positive control, mouse MAb 6B4A-10 reacted with all of these mutant E constructs in both assays. These results support the conclusion that Lys136 in domain I, Ile126 in domain II, and Gly302 in domain III are the major epitope determinants of MAbs A3, B2, and E3, respectively.


Figure 7
View larger version (53K):
[in this window]
[in a new window]

  		FIG. 7. Binding analysis of mutant E proteins containing a single substitution at position 126, 136, 179, 219, or 302. (A) Binding of humanized MAbs A3 and E3 (top) and the control mouse MAb anti-V5 epitope (bottom) to various mutant proteins as analyzed by Western blotting. The wild-type (WT) and mutant E proteins reacted with the indicated antibody and were developed with an HRP-conjugated secondary antibody. (B) Binding of MAbs A3, B2, and E3 to WT and mutant E proteins analyzed by immunoprecipitation in the absence of detergents. The immunoprecipitates were developed by Western blotting using MAb anti-V5 epitope-HRP conjugate.

Neutralization of the attenuated and wild-type JEV strains by Fabs and humanized MAbs. Earlier we determined the neutralizing titers of Fabs using attenuated JEV strain SA14-14-2 (genotype III). Three highly neutralizing Fabs were further evaluated for neutralization of wild-type JEV strains representing each of the four genotypes. Each of these Fabs neutralized wild-type members of genotypes I to IV as efficiently as the attenuated strain, with the exception of Fab B2, which neutralized strain JKT 9092 (genotype IV) at a PRNT50 titer reduced by greater than 103-fold (Table 4). Fab B2 was the most efficient neutralizer of other strains, and Fab E3 was the least efficient. Humanized MAbs derived from these Fabs were also used for neutralization of the attenuated strain and the wild-type strains representing each genotype. MAbs A3 and B2 showed a PRNT50 titer 3- to 100-fold higher than that of the Fab counterpart. MAb E3 had a PRNT50 titer 40- to >1,000-fold higher than that measured for Fab E3 against all genotype strains. JEV JKT 9092, like other strains, was efficiently neutralized by MAbs A3 and E3, although it was only moderately neutralized by the highly neutralizing MAb B2.


View this table:
[in this window]
[in a new window]

  		TABLE 4. Neutralization of JEV strains representing genotypes I to IV by Fabs and humanized MAbs

Protective capacity of humanized MAbs against JEV infection in mice. The mouse JEV encephalitis model used for validation of the inactivated JEV vaccine in commercial production was employed to evaluate the protective capacity of humanized MAbs. Four-week-old, inbred ddy mice were each inoculated by the i.p. route with a single dose of MAb ranging from 0.32 to 200 µg. Mice were challenged with 40 LD50 of JEV strain Nakayama i.c. 24 h later. At a dose of 200 µg/per mouse, MAbs A3 and B2 protected 100% and MAb E3 protected 75% of mice in the groups, compared to no survivals in the unprotected group following virus challenge (Fig. 8). Titration of MAbs against virus infection showed a dose-dependent response in terms of the survival rate and average survival time. The 50% protective dose per mouse calculated by nonlinear regression analysis was 0.84 µg for MAb B2, 5.8 µg for MAb A3, and 24.7 µg for MAb E3.


Figure 8
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 8. Protective activity of humanized JEV IgG1 antibodies (MAbs) using a mouse JEV challenge model. Inbred ddy mice (n = 12) were injected i.p. with MAb A3 (A), MAb B2 (B), or MAb E3 (C) at various doses indicated. Unprotected control mice were administered PBS diluent. Twenty-four hours later mice were infected i.c. with JEV strain Nakayama. The animals were monitored daily and euthanized when clinical signs of infection appeared. Kaplan-Meier survival curves are shown.

The possibility of using these MAbs for therapy of JEV encephalitis was also investigated. MAb B2 administered at a single dose of 200 µg 1 day after JEV infection resulted in a 50% survival rate (Table 5). Although fewer survivals were found after similar transfer with the less-protective MAb A3 or E3 1 day after JEV infection, the average survival time increased significantly with MAb B2 (8.0 ± 1.4 days; P = 0.015, t test) or MAb A3 (7.4 ± 0.7 days; P = 0.0001, t test), compared with 5.9 ± 0.8 days for unprotected animals. Thus, passive transfer with either of these MAbs improved the outcome of JEV infection when administered 1 day prior to infection (Table 5). However, the average survival time was in the range of 6.2 ± 1.1 to 6.3 ± 0.5 days for MAb A3 and 5.2 ± 0.4 to 6.3 ± 0.5 days for MAb B2, not significantly different from the 5.8 ± 0.4 to 5.9 ± 0.1 days for the PBS control group when administered 3 or 5 days prior to infection.


View this table:
[in this window]
[in a new window]

  		TABLE 5. Protection by passive transfer of MAb to mice against prior infection with 40 LD50 of JEV strain Nakayama 1 day earlier


arrow
DISCUSSION
 
There have been growing efforts to recover antibodies against DENV, WNV, and other flaviviruses from chimpanzees and humans (3, 10, 30, 60). These studies have identified a number of MAbs that are useful for investigating viral antigenic structures and mechanisms of virus neutralization and for possible protection against flavivirus infections. Characterization of these antibodies has already revealed important features of E antigenic structures of these viruses and antibody responses to infections in chimpanzees and humans. Flavivirus infections induce broadly reactive, but weakly to nonneutralizing, antibodies that are reactive with major epitopes involving the fusion peptide in E. Type-specific highly neutralizing antibodies could be present as minor subsets, presumably in response to minor epitopes (11, 30, 40, 60).

Different panning strategies have served the purpose of recovering a panel of JEV antibodies reactive with epitopes that mapped to all three domains in E. Fab A3 and three other Fabs that were selected for strong binding to JEV SA14-14-2 virions were highly neutralizing (Table 1). These Fabs appear to represent a subset of neutralizing antibodies reactive to an immunodominant epitope(s) on JEV. A major determinant of the epitope reactive to Fab A3 mapped to Lys179 within a β-strand in domain I of E. Lys179 is conserved among JEV strains of different genotypes, suggesting the importance of this neutralizing antibody for protection. Interestingly, Lys179 of JEV E aligned with Lys174 in DENV-4 E. A recent study has identified this amino acid as an important epitope determinant of DENV-4 type-specific, highly neutralizing MAb 5H2, which had also been recovered from a chimpanzee (24). Humanized MAb 5H2 proved to be protective in monkeys against DENV-4 infection. Only a few mouse MAbs that neutralize flaviviruses have been shown to react with epitope determinants that mapped to domain I in E (16, 51, 52). For example, the epitope determinants of tick-borne encephalitis virus-neutralizing MAbs i2 and IC3 from mice have been mapped to positions 171 and 181 (corresponding to JEV E positions 170 and 180, respectively) (16). These results support the notion that a cluster of epitopes involving the antigenic determinant Lys179 in JEV E (or the corresponding Lys174 in DENV-4 E) apparently shared between rodents and primates (chimpanzees and possibly humans) may play an important role in inducing flavivirus type-specific antibodies.

Sequence analysis of Fab B2 neutralization-escape variant v2 identified Ile126 within the small loop between d and e β-strands in domain II. Evidence for epitope determinant Ile126 is also supported by the demonstration that substitution I126-T in recombinant 80% E truncated at the C terminus resulted in loss of binding for MAb B2. Epitopes that are closely related to this d-e loop epitope in domain II have been described for mouse antibodies against JEV or other flaviviruses by analysis of antigenic variants (15, 16, 29, 36). For example, antigenic variants partially resistant to mouse JEV-neutralizing MAb 503 were found to contain mutations at Ile126 (domain II), Lys136 (domain I), or Ser275 (domain II) in E clustered at the junction of domains I and II. Presumably, some of these amino acids are contact residues for this MAb. Thus, the epitope reactive to MAb 503 appears to consist of discontinuous sequences involving an important determinant at Ile126 (36). These observations suggest that these chimpanzee and mouse neutralizing MAbs react with similar or overlapping epitopes, probably involving a common determinant at or near position 126.

It is clear that JEV virions can select strongly neutralizing antibodies reactive to domain I- and II-specific epitopes. Two domain III-reactive Fabs were also recovered with the use of domain III-specific recombinant E. One of these (Fab E3) had a moderate neutralizing activity in vitro, and its epitope determinant mapped to JEV-conserved Gly302 within the N-terminal segment of domain III (amino acid residues 302 to 309). Further, Fab E3 competed with the binding of mouse MAb E3.3, which recognizes a conformation-dependent epitope in E domain III (63). It has been reported that the most potent flavivirus-neutralizing antibodies recognize epitopes on the upper lateral surface of domain III, composed of residues of the amino-terminal region and the three loops FG, BC, and DE (37, 57, 63). Highly neutralizing antibodies that recognize sequences in domain III were not recovered from the chimpanzee antibody library. This apparent lack of immunodominance of domain III antibodies was not surprising in view of our experience with neutralizing antibodies from DENV-infected chimpanzees and the recent characterization of human antibodies against WNV by others (40, 60). However, it cannot be ruled out that JEV virions or the recombinant domain III E protein applied as a coating on the plate had not assumed the native conformation for binding to highly neutralizing antibodies.

Recent studies with DENV, WNV, and tick-borne encephalitis virus suggest that a major subset of broadly cross-reactive antibodies are directed against immunodominant epitopes that include the fusion peptide in the E protein (11, 56, 60). The most plausible explanation for the lack of such antibodies in the current study is that the SA14-14-2 virus used for panning binds weakly to the cross-reactive antibodies, thereby preventing their isolation. Previously we have shown that the Phe107-Leu substitution in the E fusion loop alone was responsible for the reduced binding affinity of SA14-14-2 virions to the broadly cross-reactive chimpanzee MAb 1A5 (11).

ELISA provided useful insights into Fab binding activities for JEV virions. Highly neutralizing Fabs B2 and A3 reached half-maximum binding at approximately 0.5 nM and ~10 nM, respectively, whereas the comparable value for moderately neutralizing Fab E3 was ~100 nM (Fig. 4A). The concentration for half-maximum binding, together with the PRNT50 titers, allowed measurement of antibody neutralization potency, based on the calculation of the threshold occupancy of accessible antibody sites on the virion (45). According to the multiple-hit theory and stoichiometric analysis of epitope occupancy for neutralization (22), the most potent antibodies neutralize the virus at concentrations with low occupancy of the epitopes available for binding on the virion. The occupancy for the most potent JEV-neutralizing MAb B2 was approximately 28% of available sites, whereas the occupancies for MAbs A3 and E3 were calculated at 45% and 66% of the accessible sites, respectively (data not shown) (12, 45). It should be noted that in the current study the three JEV-neutralizing antibodies bind to specific epitopes in three separate E domains and most probably neutralize the virus by different mechanisms. Other contributing factors for assessment and interpretation of the antibody binding stoichiometry may also include the epitope presentation of antigen preparations. To that effect, the binding affinity of Fab B2 for the recombinant E protein measured by SPR was very different from that determined for the virion by ELISA, i.e., Kd of 110 nM versus KD of 0.28 nM (Table 3). One possible explanation is the conformational dependency of the B2 epitope, as shown by the loss of MAb B2 binding to the recombinant E or the virion in a Western blot assay. Accordingly, the number of accessible sites for B2 binding differed between the recombinant E and the virion on a molar basis. Taken together, one could speculate that the high neutralization potency of MAb B2 is partially determined by a higher affinity for a limited subset of E protein conformations that most closely mimic E on the viral surface.

The presently recognized four JEV genotypes show a 7% or greater nucleotide sequence divergence based on limited sequences (5, 55). Strains of genotype IV are the least similar and probably represent the ancestral lineage with up to 20% nucleotide and 6.5% amino acid divergence compared to other genotype strains. Genotypes I to III are most widespread and responsible for epidemic disease. Our analysis demonstrates that each of the three Fabs and derived humanized MAbs exhibits a high neutralizing activity against a broad spectrum of JEV genotype strains. One single exception is that the neutralizing activity of MAb B2 against JEV strain 9092 (genotype IV) was reduced by approximately 100-fold compared to that against other genotype strains. A sequence search of strain 9092 (accession no. U70409) in the database revealed that the substitution Ile126-Thr identified earlier in the B2 escape mutant was not present. This observation suggests the possibility that other mutations in E of the JEV strain affecting MAb B2 binding and neutralization are present. It would be of interest to determine the mutation(s) involved in the antibody-resistant phenotype of strain 9092 in order to map additional determinants of the MAb B2 epitope. On the other hand, a sequence analysis of other genotype IV strains revealed the presence of the Ile126-Thr substitution in strains JKT 6468 (accession no. AY184212) and JKT 7003 (accession no. 70408) in E, indicating that both JEV strains may exhibit resistance to neutralization by MAb B2. Strains of genotype IV were all isolated in 1980 and 1981 from mosquitoes and are believed to have remained in the Indonesia-Malaysia region (5). The significance of their involvement in epidemic viral encephalitis is not clear.

Unlike JEV genotype IV strains, strains of genotypes I to III have spread widely in Asia in recent years. Immunization using the inactivated or live SA14-14-2 JEV vaccine, each prepared from genotype III strains, has effectively controlled JE epidemics in most countries. However, JEV outbreaks remain a public health problem for residents in the regions where JEV vaccination is inadequate and a concern for travelers to these regions as well. Antibody-mediated prevention of JEV infection represents an attractive short-term alternative to vaccines. Demonstration of passive protection with humanized chimpanzee MAbs against JEV infection in vivo is provided herein. The 50% protective dose was measured for MAbs B2 (0.84 µg), A3 (5.8 µg), and E3 (24.7 µg) for 21-g mice. These experiments confirm the feasibility of MAbs for prevention of JEV encephalitis by passive transfer as described earlier (21). Administration of 200 µg/mouse of MAb B2 1 day after lethal i.c. JEV infection protected 50% of mice, whereas all mice in the control group died. A significant improvement of JEV infection survival time after administration of MAbs B2 and A3 was also evident. These results suggest a therapeutic potential for use of these MAbs.

In contrast, the average survival time was not prolonged when mice were inoculated with any of the antibodies 3 or 5 days after JEV challenge. Virus titers can reach ~1 x 107 to 1 x 108 FFU/g in the brain of 3-week-old mice 3 to 5 days after i.c. inoculation of JEV (35a). Other mouse JE models employing less-severe i.p. inoculation have also been described (19, 21). Studies have shown that inoculation of 200 µg of mouse MAb 503 on day 5 after i.p. challenge protected 82% of the animals (21). Passive protection at 3 or 5 days after infection by our humanized antibodies would probably have been possible if the virus were introduced into the animals i.p. However, we chose a more stringent test of protection by challenging mice i.c. Conceivably, early precise diagnosis of JEV infection and timely administration of effective, neutralizing antibody would help improve the infection outcome. Additionally, infection intervention may be further improved by the combined use of two or more MAbs, such as B2 and A3, that react to separate domains and possibly neutralize the virus by different mechanisms.


arrow
ACKNOWLEDGMENTS
 
This work was supported in part by the WHO Global Programme for Vaccines and Immunization (V22/181/117) and by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases and the National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 50 South Drive MSC 8005, Molecular Viral Biology Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892. Phone for A. Goncalvez: (301) 594-2426. Fax: (301) 402-6413. E-mail: agoncalvez{at}niaid.nih.gov. Phone for C.-J. Lai: (301) 594-2422. Fax: (301) 402-6413. E-mail: clai{at}niaid.nih.gov Back

{triangledown} Published ahead of print on 14 May 2008. Back


arrow
REFERENCES
 
    1
  1. Ali, A., and A. Igarashi. 1997. Antigenic and genetic variations among Japanese encephalitis virus strains belonging to genotype 1. Microbiol. Immunol. 41:241-252.[Medline]
    2. 2
  2. Allison, S. L., J. Schalich, K. Stiasny, C. W. Mandl, and F. X. Heinz. 2001. Mutational evidence for an internal fusion peptide in flavivirus envelope protein E. J. Virol. 75:4268-4275.[Abstract/Free Full Text]
    3. 3
  3. Arakawa, M., T. Yamashiro, G. Uechi, M. Tadano, and A. Nishizono. 2007. Construction of human Fab (gamma1/kappa) library and identification of human monoclonal Fab possessing neutralizing potency against Japanese encephalitis virus. Microbiol. Immunol. 51:617-625.[Medline]
    4. 4
  4. Brandriss, M. W., J. J. Schlesinger, E. E. Walsh, and M. Briselli. 1986. Lethal 17D yellow fever encephalitis in mice. I. Passive protection by monoclonal antibodies to the envelope proteins of 17D yellow fever and dengue 2 viruses. J. Gen. Virol. 67:229-234.[Abstract/Free Full Text]
    5. 5
  5. Chen, W. R., R. Rico-Hesse, and R. B. Tesh. 1992. A new genotype of Japanese encephalitis virus from Indonesia. Am. J. Trop. Med. Hyg. 47:61-69.[Abstract/Free Full Text]
    6. 6
  6. Crill, W. D., and J. T. Roehrig. 2001. Monoclonal antibodies that bind to domain III of dengue virus E glycoprotein are the most efficient blockers of virus adsorption to Vero cells. J. Virol. 75:7769-7773.[Abstract/Free Full Text]
    7. 7
  7. Daffis, S., R. E. Kontermann, J. Korimbocus, H. Zeller, H. D. Klenk, and J. Ter Meulen. 2005. Antibody responses against wild-type yellow fever virus and the 17D vaccine strain: characterization with human monoclonal antibody fragments and neutralization escape variants. Virology 337:262-272.[CrossRef][Medline]
    8. 8
  8. Ditzel, H. J., J. M. Binley, J. P. Moore, J. Sodroski, N. Sullivan, L. S. Sawyer, R. M. Hendry, W. P. Yang, C. F. Barbas III, and D. R. Burton. 1995. Neutralizing recombinant human antibodies to a conformational V2- and CD4-binding site-sensitive epitope of HIV-1 gp120 isolated by using an epitope-masking procedure. J. Immunol. 154:893-906.[Abstract]
    9. 9
  9. Goncalvez, A. P., R. E. Engle, M. St. Claire, R. H. Purcell, and C. J. Lai. 2007. Monoclonal antibody-mediated enhancement of dengue virus infection in vitro and in vivo and strategies for prevention. Proc. Natl. Acad. Sci. USA 104:9422-9427.[Abstract/Free Full Text]
    10. 10
  10. Goncalvez, A. P., R. Men, C. Wernly, R. H. Purcell, and C. J. Lai. 2004. Chimpanzee Fab fragments and a derived humanized immunoglobulin G1 antibody that efficiently cross-neutralize dengue type 1 and type 2 viruses. J. Virol. 78:12910-12918.[Abstract/Free Full Text]
    11. 11
  11. Goncalvez, A. P., R. H. Purcell, and C. J. Lai. 2004. Epitope determinants of a chimpanzee Fab antibody that efficiently cross-neutralizes dengue type 1 and type 2 viruses map to inside and in close proximity to fusion loop of the dengue type 2 virus envelope glycoprotein. J. Virol. 78:12919-12928.[Abstract/Free Full Text]
    12. 12
  12. Gromowski, G. D., and A. D. Barrett. 2007. Characterization of an antigenic site that contains a dominant, type-specific neutralization determinant on the envelope protein domain III (ED3) of dengue 2 virus. Virology 366:349-360.[CrossRef][Medline]
    13. 13
  13. Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723.[CrossRef][Medline]
    14. 14
  14. Hanna, J. N., S. A. Ritchie, D. A. Phillips, J. Shield, M. C. Bailey, J. S. Mackenzie, M. Poidinger, B. J. McCall, and P. J. Mills. 1996. An outbreak of Japanese encephalitis in the Torres Strait, Australia, 1995. Med. J. Aust. 165:256-260.[Medline]
    15. 15
  15. Hasegawa, H., M. Yoshida, T. Shiosaka, S. Fujita, and Y. Kobayashi. 1992. Mutations in the envelope protein of Japanese encephalitis virus affect entry into cultured cells and virulence in mice. Virology 191:158-165.[CrossRef][Medline]
    16. 16
  16. Holzmann, H., K. Stiasny, M. Ecker, C. Kunz, and F. X. Heinz. 1997. Characterization of monoclonal antibody-escape mutants of tick-borne encephalitis virus with reduced neuroinvasiveness in mice. J. Gen. Virol. 78:31-37.[Abstract]
    17. 17
  17. Igarashi, A., M. Tanaka, K. Morita, T. Takasu, A. Ahmed, A. Ahmed, D. S. Akram, and M. A. Waqar. 1994. Detection of west Nile and Japanese encephalitis viral genome sequences in cerebrospinal fluid from acute encephalitis cases in Karachi, Pakistan. Microbiol. Immunol. 38:827-830.[Medline]
    18. 18
  18. Jaiswal, S., N. Khanna, and S. Swaminathan. 2004. High-level expression and one-step purification of recombinant dengue virus type 2 envelope domain III protein in Escherichia coli. Protein Expr. Purif. 33:80-91.[CrossRef][Medline]
    19. 19
  19. Jan, L. R., C. S. Yang, L. S. Henchal, H. Sumiyoshi, P. L. Summers, D. R. Dubois, and C. J. Lai. 1993. Increased immunogenicity and protective efficacy in outbred and inbred mice by strategic carboxyl-terminal truncation of Japanese encephalitis virus envelope glycoprotein. Am. J. Trop. Med. Hyg. 48:412-423.[Abstract/Free Full Text]
    20. 20
  20. Kanai, R., K. Kar, K. Anthony, L. H. Gould, M. Ledizet, E. Fikrig, W. A. Marasco, R. A. Koski, and Y. Modis. 2006. Crystal structure of West Nile virus envelope glycoprotein reveals viral surface epitopes. J. Virol. 80:11000-11008.[Abstract/Free Full Text]
    21. 21
  21. Kimura-Kuroda, J., and K. Yasui. 1988. Protection of mice against Japanese encephalitis virus by passive administration with monoclonal antibodies. J. Immunol. 141:3606-3610.[Abstract]
    22. 22
  22. Klasse, P. J., and Q. J. Sattentau. 2002. Occupancy and mechanism in antibody-mediated neutralization of animal viruses. J. Gen. Virol. 83:2091-2108.[Abstract/Free Full Text]
    23. 23
  23. Kuhn, R. J., W. Zhang, M. G. Rossmann, S. V. Pletnev, J. Corver, E. Lenches, C. T. Jones, S. Mukhopadhyay, P. R. Chipman, E. G. Strauss, T. S. Baker, and J. H. Strauss. 2002. Structure of dengue virus: implications for flavivirus organization, maturation, and fusion. Cell 108:717-725.[CrossRef][Medline]
    24. 24
  24. Lai, C. J., A. P. Goncalvez, R. Men, C. Wernly, O. Donau, R. E. Engle, and R. H. Purcell. 2007. Epitope determinants of a chimpanzee dengue virus type 4 (DENV-4)-neutralizing antibody and protection against DENV-4 challenge in mice and rhesus monkeys by passively transferred humanized antibody. J. Virol. 81:12766-12774.[Abstract/Free Full Text]
    25. 25
  25. Ledizet, M., K. Kar, H. G. Foellmer, T. Wang, S. L. Bushmich, J. F. Anderson, E. Fikrig, and R. A. Koski. 2005. A recombinant envelope protein vaccine against West Nile virus. Vaccine 23:3915-3924.[CrossRef][Medline]
    26. 26
  26. Lin, C. W., and S. C. Wu. 2003. A functional epitope determinant on domain III of the Japanese encephalitis virus envelope protein interacted with neutralizing-antibody combining sites. J. Virol. 77:2600-2606.[Abstract/Free Full Text]
    27. 27
  27. Mackenzie, J. S., D. J. Gubler, and L. R. Petersen. 2004. Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat. Med. 10:S98-S109.[CrossRef][Medline]
    28. 28
  28. Mathews, J. H., and J. T. Roehrig. 1984. Elucidation of the topography and determination of the protective epitopes on the E glycoprotein of Saint Louis encephalitis virus by passive transfer with monoclonal antibodies. J. Immunol. 132:1533-1537.[Abstract]
    29. 29
  29. McMinn, P. C., E. Lee, S. Hartley, J. T. Roehrig, L. Dalgarno, and R. C. Weir. 1995. Murray valley encephalitis virus envelope protein antigenic variants with altered hemagglutination properties and reduced neuroinvasiveness in mice. Virology 211:10-20.[CrossRef][Medline]
    30. 30
  30. Men, R., T. Yamashiro, A. P. Goncalvez, C. Wernly, D. J. Schofield, S. U. Emerson, R. H. Purcell, and C. J. Lai. 2004. Identification of chimpanzee Fab fragments by repertoire cloning and production of a full-length humanized immunoglobulin G1 antibody that is highly efficient for neutralization of dengue type 4 virus. J. Virol. 78:4665-4674.[Abstract/Free Full Text]
    31. 31
  31. Men, R. H., M. Bray, and C. J. Lai. 1991. Carboxy-terminally truncated dengue virus envelope glycoproteins expressed on the cell surface and secreted extracellularly exhibit increased immunogenicity in mice. J. Virol. 65:1400-1407.[Abstract/Free Full Text]
    32. 32
  32. Modis, Y., S. Ogata, D. Clements, and S. C. Harrison. 2003. A ligand-binding pocket in the dengue virus envelope glycoprotein. Proc. Natl. Acad. Sci. USA 100:6986-6991.[Abstract/Free Full Text]
    33. 33
  33. Modis, Y., S. Ogata, D. Clements, and S. C. Harrison. 2005. Variable surface epitopes in the crystal structure of dengue virus type 3 envelope glycoprotein. J. Virol. 79:1223-1231.[Abstract/Free Full Text]
    34. 34
  34. Monath, T. P. 2002. Japanese encephalitis vaccines: current vaccines and future prospects. Curr. Top. Microbiol. Immunol. 267:105-138.[Medline]
    35. 35
  35. Monath, T. P., F. Guirakhoo, R. Nichols, S. Yoksan, R. Schrader, C. Murphy, P. Blum, S. Woodward, K. McCarthy, D. Mathis, C. Johnson, and P. Bedford. 2003. Chimeric live, attenuated vaccine against Japanese encephalitis (ChimeriVax-JE): phase 2 clinical trials for safety and immunogenicity, effect of vaccine dose and schedule, and memory response to challenge with inactivated Japanese encephalitis antigen. J. Infect. Dis. 188:1213-1230.[CrossRef][Medline]
    36. 35
  36. Mori, Y., T. Yamashita, Y. Tanaka, Y. Tsuda, T. Abe, K. Moriishi, and Y. Matsuura. 2007. Processing of capsid protein by cathepsin L plays a crucial role in replication of Japanese encephalitis virus in neural and macrophage cells. J. Virol. 81:8477-8487.[Abstract/Free Full Text]
    37. 36
  37. Morita, K., M. Tadano, S. Nakaji, K. Kosai, E. G. Mathenge, B. D. Pandey, F. Hasebe, S. Inoue, and A. Igarashi. 2001. Locus of a virus neutralization epitope on the Japanese encephalitis virus envelope protein determined by use of long PCR-based region-specific random mutagenesis. Virology 287:417-426.[CrossRef][Medline]
    38. 37
  38. Nybakken, G. E., T. Oliphant, S. Johnson, S. Burke, M. S. Diamond, and D. H. Fremont. 2005. Structural basis of West Nile virus neutralization by a therapeutic antibody. Nature 437:764-769.[CrossRef][Medline]
    39. 38
  39. Okuno, Y., T. Fukunaga, M. Tadano, Y. Okamoto, T. Ohnishi, and M. Takagi. 1985. Rapid focus reduction neutralization test of Japanese encephalitis virus in microtiter system. Arch. Virol. 86:129-135.[CrossRef][Medline]
    40. 39
  40. Oliphant, T., M. Engle, G. E. Nybakken, C. Doane, S. Johnson, L. Huang, S. Gorlatov, E. Mehlhop, A. Marri, K. M. Chung, G. D. Ebel, L. D. Kramer, D. H. Fremont, and M. S. Diamond. 2005. Development of a humanized monoclonal antibody with therapeutic potential against West Nile virus. Nat. Med. 11:522-530.[CrossRef][Medline]
    41. 40
  41. Oliphant, T., G. E. Nybakken, S. K. Austin, Q. Xu, J. Bramson, M. Loeb, M. Throsby, D. H. Fremont, T. C. Pierson, and M. S. Diamond. 2007. Induction of epitope-specific neutralizing antibodies against West Nile virus. J. Virol. 81:11828-11839.[Abstract/Free Full Text]
    42. 41
  42. Oliphant, T., G. E. Nybakken, M. Engle, Q. Xu, C. A. Nelson, S. Sukupolvi-Petty, A. Marri, B. E. Lachmi, U. Olshevsky, D. H. Fremont, T. C. Pierson, and M. S. Diamond. 2006. Antibody recognition and neutralization determinants on domains I and II of West Nile virus envelope protein. J. Virol. 80:12149-12159.[Abstract/Free Full Text]
    43. 42
  43. Parida, M., P. K. Dash, N. K. Tripathi, Ambuj, S. Sannarangaiah, P. Saxena, S. Agarwal, A. K. Sahni, S. P. Singh, A. K. Rathi, R. Bhargava, A. Abhyankar, S. K. Verma, P. V. Rao, and K. Sekhar. 2006. Japanese encephalitis outbreak, India, 2005. Emerg. Infect. Dis. 12:1427-1430.[Medline]
    44. 43
  44. Peitsch, M. C. 1996. ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling. Biochem. Soc. Trans. 24:274-279.[Medline]
    45. 44
  45. Pettersen, E. F., T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng, and T. E. Ferrin. 2004. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem. 25:1605-1612.[CrossRef][Medline]
    46. 45
  46. Pierson, T. C., Q. Xu, S. Nelson, T. Oliphant, G. E. Nybakken, D. H. Fremont, and M. S. Diamond. 2007. The stoichiometry of antibody-mediated neutralization and enhancement of West Nile virus infection. Cell Host Microbe 1:135-145.[CrossRef][Medline]
    47. 46
  47. Putnak, R. J., B. A. Coller, G. Voss, D. W. Vaughn, D. Clements, I. Peters, G. Bignami, H. S. Houng, R. C. Chen, D. A. Barvir, J. Seriwatana, S. Cayphas, N. Garcon, D. Gheysen, N. Kanesa-Thasan, M. McDonell, T. Humphreys, K. H. Eckels, J. P. Prieels, and B. L. Innis. 2005. An evaluation of dengue type-2 inactivated, recombinant subunit, and live-attenuated vaccine candidates in the rhesus macaque model. Vaccine 23:4442-4452.[CrossRef][Medline]
    48. 47
  48. Pyke, A. T., D. T. Williams, D. J. Nisbet, A. F. van den Hurk, C. T. Taylor, C. A. Johansen, J. Macdonald, R. A. Hall, R. J. Simmons, R. J. Mason, J. M. Lee, S. A. Ritchie, G. A. Smith, and J. S. Mackenzie. 2001. The appearance of a second genotype of Japanese encephalitis virus in the Australasian region. Am. J. Trop. Med. Hyg. 65:747-753.[Abstract]
    49. 48
  49. Raffai, R., K. H. Weisgraber, R. MacKenzie, B. Rupp, E. Rassart, T. Hirama, T. L. Innerarity, and R. Milne. 2000. Binding of an antibody mimetic of the human low density lipoprotein receptor to apolipoprotein E is governed through electrostatic forces. Studies using site-directed mutagenesis and molecular modeling. J. Biol. Chem. 275:7109-7116.[Abstract/Free Full Text]
    50. 49
  50. Rey, F. A., F. X. Heinz, C. Mandl, C. Kunz, and S. C. Harrison. 1995. The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature 375:291-298.[CrossRef][Medline]
    51. 50
  51. Roehrig, J. T. 2003. Antigenic structure of flavivirus proteins. Adv. Virus Res. 59:141-175.[CrossRef][Medline]
    52. 51
  52. Ryman, K. D., T. N. Ledger, R. C. Weir, J. J. Schlesinger, and A. D. Barrett. 1997. Yellow fever virus envelope protein has two discrete type-specific neutralizing epitopes. J. Gen. Virol. 78:1353-1356.[Abstract]
    53. 52
  53. Ryman, K. D., H. Xie, T. N. Ledger, G. A. Campbell, and A. D. Barrett. 1997. Antigenic variants of yellow fever virus with an altered neurovirulence phenotype in mice. Virology 230:376-380.[CrossRef][Medline]
    54. 53
  54. Schuck, P. 1997. Use of surface plasmon resonance to probe the equilibrium and dynamic aspects of interactions between biological macromolecules. Annu. Rev. Biophys. Biomol. Struct. 26:541-566.[CrossRef][Medline]
    55. 54
  55. Schuck P., L. F. Boyd, and P. S. Andersen. 1999. Measuring protein interactions by optical biosensors, p. 20.2.1-20.2.21. In J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield (ed.), Current protocols in protein science. John Wiley & Sons, Inc., New York, NY.
    56. 55
  56. Solomon, T., H. Ni, D. W. Beasley, M. Ekkelenkamp, M. J. Cardosa, and A. D. Barrett. 2003. Origin and evolution of Japanese encephalitis virus in southeast Asia. J. Virol. 77:3091-3098.[Abstract/Free Full Text]
    57. 56
  57. Stiasny, K., S. Kiermayr, H. Holzmann, and F. X. Heinz. 2006. Cryptic properties of a cluster of dominant flavivirus cross-reactive antigenic sites. J. Virol. 80:9557-9568.[Abstract/Free Full Text]
    58. 57
  58. Sukupolvi-Petty, S., S. K. Austin, W. E. Purtha, T. Oliphant, G. E. Nybakken, J. J. Schlesinger, J. T. Roehrig, G. D. Gromowski, A. D. Barrett, D. H. Fremont, and D. S. Diamond. 2007. Type- and subcomplex-specific neutralizing antibodies against domain III of dengue virus type 2 envelope protein recognize adjacent epitopes. J. Virol. 81:12816-12826.[Abstract/Free Full Text]
    59. 58
  59. Svitel, J., H. Boukari, D. Van Ryk, R. C. Willson, and P. Schuck. 2007. Probing the functional heterogeneity of surface binding sites by analysis of experimental binding traces and the effect of mass transport limitation. Biophys. J. 92:1742-1758.[CrossRef][Medline]
    60. 59
  60. Tandan, J. B., H. Ohrr, Y. M. Sohn, S. Yoksan, M. Ji, C. M. Nam, and S. B. Halstead. 2007. Single dose of SA 14-14-2 vaccine provides long-term protection against Japanese encephalitis: a case-control study in Nepalese children 5 years after immunization. Vaccine 25:5041-5045.[CrossRef][Medline]
    61. 60
  61. Throsby, M., C. Geuijen, J. Goudsmit, A. Q. Bakker, J. Korimbocus, R. A. Kramer, M. Clijsters-van der Horst, M. de Jong, M. Jongeneelen, S. Thijsse, R. Smit, T. J. Visser, N. Bijl, W. E. Marissen, M. Loeb, D. J. Kelvin, W. Preiser, J. ter Meulen, and J. de Kruif. 2006. Isolation and characterization of human monoclonal antibodies from individuals infected with West Nile virus. J. Virol. 80:6982-6992.[Abstract/Free Full Text]
    62. 61
  62. Tsai, T. F. 2000. New initiatives for the control of Japanese encephalitis by vaccination: minutes of a WHO/CVI meeting, Bangkok, Thailand, 13-15 October 1998. Vaccine 18(Suppl. 2):1-25.[CrossRef][Medline]
    63. 62
  63. Uchil, P. D., and V. Satchidanandam. 2001. Phylogenetic analysis of Japanese encephalitis virus: envelope gene based analysis reveals a fifth genotype, geographic clustering, and multiple introductions of the virus into the Indian subcontinent. Am. J. Trop. Med. Hyg. 65:242-251.[Abstract]
    64. 63
  64. Wu, K. P., C. W. Wu, Y. P. Tsao, T. W. Kuo, Y. C. Lou, C. W. Lin, S. C. Wu, and J. W. Cheng. 2003. Structural basis of a flavivirus recognized by its neutralizing antibody: solution structure of the domain III of the Japanese encephalitis virus envelope protein. J. Biol. Chem. 278:46007-46013.[Abstract/Free Full Text]
    65. 64
  65. Wu, S. C., C. H. Yu, C. W. Lin, and I. M. Chu. 2003. The domain III fragment of Japanese encephalitis virus envelope protein: mouse immunogenicity and liposome adjuvanticity. Vaccine 21:2516-2522.[CrossRef][Medline]
    66. 65
  66. Zhang, M. J., M. J. Wang, S. Z. Jiang, and W. Y. Ma. 1989. Passive protection of mice, goats, and monkeys against Japanese encephalitis with monoclonal antibodies. J. Med. Virol. 29:133-138.[Medline]

Journal of Virology, July 2008, p. 7009-7021, Vol. 82, No. 14
0022-538X/08/$08.00+0     doi:10.1128/JVI.00291-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Vogt, M. R., Moesker, B., Goudsmit, J., Jongeneelen, M., Austin, S. K., Oliphant, T., Nelson, S., Pierson, T. C., Wilschut, J., Throsby, M., Diamond, M. S. (2009). Human Monoclonal Antibodies against West Nile Virus Induced by Natural Infection Neutralize at a Postattachment Step. J. Virol. 83: 6494-6507 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goncalvez, A. P.
Right arrow Articles by Lai, C.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goncalvez, A. P.
Right arrow Articles by Lai, C.-J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»