Previous Article | Next Article ![]()
Journal of Virology, July 2008, p. 6778-6781, Vol. 82, No. 13
0022-538X/08/$08.00+0 doi:10.1128/JVI.00473-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261,1 Department of Microbiology and Cancer Center, University of Virginia Health System, Charlottesville, Virginia 229082
Received 4 March 2008/ Accepted 7 April 2008
|
|
|---|
|
|
|---|
1,100 copies of the UL26.5 scaffold protein and
90 copies of the UL26 protein (2, 9). The UL26 and UL26.5 genes are expressed as 3'-coterminal transcripts, with the promoter for the UL26.5 gene located within the coding region of UL26 (9). The UL26.5 open reading frame (encoding 329 amino acids) overlaps and is in frame with the carboxyl-terminal end of the HSV-1 UL26 open reading frame (encoding 635 amino acids). The UL26 gene encodes a protease that cleaves itself and the UL26.5 protein at a position 25 amino acids from the C termini of these two proteins (5, 12, 13). Cleavage of the UL26 and UL26.5 proteins is not required for capsid assembly, but the cleavage event is essential for DNA encapsidation (6). The scaffold aids in the assembly of the 125-nm outer shell structure. The scaffold is removed from the capsid when DNA is packaged in order to make room for the viral genome. The DNA enters the capsid through the portal vertex, which consists of 12 copies of the UL6 protein (15, 21). The portal is located at only one of the 12 capsid vertices (3, 4). The location of the portal at a unique vertex in the capsid suggests that there is a mechanism to control portal incorporation. Direct interaction of the scaffold with the portal has been demonstrated by in vitro experiments with purified proteins (16). In studies done using an in vitro capsid assembly assay, the interaction of the scaffold protein and portal proteins was found to be essential for incorporation of the portal into the capsid (14). More importantly, these studies found that in order for the portal to be incorporated into the capsid, it needs to be present when the assembly reaction is started (14). Delaying addition of the portal to the assembly reaction resulted in assembly of capsids that lacked a portal complex. Studies with deletion mutants demonstrate that amino acids 143 to 151 of the scaffold protein are critical for the formation of portal-containing capsids assembled in vitro (19). The results of these in vitro studies indicated that portal incorporation into the capsid was mediated by its specific interaction with the scaffolding protein. The goal of the current study was to demonstrate that this region of the scaffold protein is essential for producing infectious virus and for forming portal-containing capsids in HSV-1-infected cells.
An HSV-1 mutant was isolated that contained a deletion that removed sequences coding for amino acids 143 to 150 of the scaffold protein or amino acids 449 to 456 of UL26 (Fig. 1). The mutant was created using an infectious bacterial artificial chromosome (BAC) clone of the HSV-1 KOS genome (KOS-37) (7). The KOS BAC clone was transferred to GS1783 (an Escherichia coli strain containing an inducible ISceI gene, provided by G. Smith, Northwestern University Medical School), and mutagenesis was performed using the two-step bacteriophage
Red-mediated homologous recombination system described by Tischer et al. (20). PCR was used to produce a construct that contained the kanamycin resistance gene (aphAI from plasmid pEPkan) with the forward primer 5'-ACTGCGACCAGGACGAACCGGACGCGGACTACGGCGCGCCGCGCGGGGTCGACTAGGGATAACAGGGTAATCGATTT-3' and the reverse primer 5'GCCGCGCGCCGGGAGTCGACCCCGCGCGGCGCGCCGTAGTC CGCGTCCGGTTCGCCAGTGTTACAACCAATTAACC-3'.
![]() View larger version (27K): [in a new window] |
FIG. 1. (A) Physical map of the HSV-1 genome showing the location of the UL26.5 gene, which encodes the 329-amino-acid VP22a scaffold protein. UL and US, long and short unique region sequences. The next line shows the location of the eight amino acids (amino acids 143 to 150) deleted from the scaffold mutant (bvFH411) that previously were shown to be essential for interaction with the UL6 portal protein. Regions that are conserved in the scaffold proteins of alphaherpesviruses are in bold. (B and C) Nuclear lysates of Vero cells infected at an MOI of 5 with KOS (B) or bvFH411 (C) were subjected to sucrose gradient sedimentation, and the protein composition for each gradient fraction was determined by SDS-PAGE (stained gel). Lane 1 is the bottom and lane 11 is the top of the gradient. Gradient fractions that contained C and B capsids are indicated (there was no A capsid band present in KOS gradient). The positions of the capsid proteins (major capsid protein, VP5; triplex proteins, VP19C and VP23; scaffold protein, VP22a; protease, VP24; smallest capsid protein, VP26) are indicated. Molecular mass standards are visible in lane M (kDa). In the bottom panels, gradient fractions were analyzed by SDS-PAGE followed by immunoblotting for UL6 using the 1C9 antibody (16).
|
Studies with the in vitro capsid assembly assay showed that the scaffold protein missing amino acids 143 to 151 was capable of forming intact B capsids with no obvious morphological differences from capsids formed with the wild-type scaffold protein (19). However, the B capsids formed with the mutant scaffold protein did not incorporate the portal protein. To further examine the different capsid forms made in infected cells, nuclear lysates were prepared from Vero cells infected (multiplicity of infection [MOI] of 5) with KOS or bvFH411. The lysates were subjected to 20 to 60% sucrose gradient centrifugation, and capsids were viewed as visible light-scattering bands (10). In KOS-infected Vero cells, capsids with B and C bands being the most prominent were observed, while lysates of bvFH411-infected Vero cells contained only B capsids (data not shown). To determine whether the portal protein was present in these capsids, the sucrose gradient fractions (0.75 ml/fraction) were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining to detect capsid proteins or by Western blot analysis to detect the UL6 protein (Fig. 1). The KOS gradient showed that the UL6 portal protein was found only in the fractions that contained B and C capsids, with each of these fractions containing similar amounts of UL6 (Fig. 1B). This would be expected, since the amount of UL6 (12 copies/capsid) is the same in all capsid forms (15, 21). The gradient from cells infected with the UL26.5 mutant contained only B capsids (Fig. 1C). UL6 was found to be present in the B capsid fractions but at a much lower level than in the capsids isolated from KOS-infected cells (Fig. 1B). To directly compare the amounts of UL6 present in the B capsids isolated from KOS and the UL26.5 mutant, equal amounts of capsids were separated on an SDS-polyacrylamide gel (Fig. 2). The stained gel demonstrated that similar amounts of capsids were loaded for both KOS and bvFH411. In addition, this gel showed that the scaffold protein (VP22a) from the UL26.5 mutant was slightly smaller than the wild-type scaffold protein due to the deletion of amino acids 143 to 150. The capsids produced with the wild-type scaffold showed a significant amount of UL6 associated with the B capsid fractions, while the capsids produced by the scaffold mutant showed no detectable portal protein. These observations indicate that, similar to what was found with the in vitro capsid assembly assay; the deletion of the portal binding domain of the scaffold protein prevents portal incorporation into capsids.
![]() View larger version (52K): [in a new window] |
FIG. 2. Comparison of the UL6 contents in B capsids isolated from KOS- and bvFH411-infected Vero cells. Equal amounts of capsids were separated by SDS-PAGE, and the gel was either stained or immunoblotted using the UL6 antibody 1C9 (16). Molecular mass standards are visible in lane M (kDa).
|
Thin sections of Vero cells infected with the UL26.5 deletion virus were examined by transmission electron microscopy to determine the type of capsids present (Fig. 3). The nuclei were found to contain capsids which had electron-translucent cores (B capsids). No dense-core capsids (C capsids) or empty capsids (A capsids) were observed in these cells (Fig. 3A to C), and there were no enveloped capsids detected in the cytoplasm (micrographs not shown). In contrast, when Vero cells were infected with wild-type KOS virus, an abundance of DNA-containing capsids was observed (Fig. 3D). The data demonstrate that deletion of residues 143 to 150 of the UL26.5 protein blocks DNA packaging but does not interfere with the assembly of B capsids.
![]() View larger version (159K): [in a new window] |
FIG. 3. Electron micrographs showing thin sections of Vero cells infected with bvFH411 (A to C) and KOS (D) viruses. The boxed area in panel A is shown at higher magnification in panel B, and similarly, the boxed area in panel B is shown enlarged in panel C. The large white, black, and small white arrows indicate representative A, B, and C capsids, respectively. Note that while cells infected with bvFH411 contain many A and B capsids (A to C), DNA-containing capsids (C capsids) are found only in KOS-infected cells (D).
|
![]() View larger version (36K): [in a new window] |
FIG. 4. Processing of viral DNA. Vero or C32 cells were infected with the indicated virus at an MOI of 5 PFU per cell. Total infected-cell DNA was isolated at 16 h postinfection, digested with BamHI, and subjected to Southern blot analysis using the BamHI K joint fragment (32P labeled) as a probe. Scanned images of the autoradiograph obtained from the Southern blots are shown. The locations of the BamHI K joint fragment and the two end fragments, BamHI-Q and -S, in the HSV-1 genome are shown at the bottom.
|
Finally, while this paper was under review, a related paper reporting on an HSV-1 mutant containing a deletion of amino acids 143 to 151of the HSV-1 scaffold protein was published. Similar conclusions about the role of this region in portal incorporation into capsids were reported (22).
This work was supported by Public Health Services grants AI060836 (to F.L.H.) and AI41644 (to J.C.B.) from the National Institutes of Health.
Published ahead of print on 16 April 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»